ID: 973100568

View in Genome Browser
Species Human (GRCh38)
Location 4:46263462-46263484
Sequence CTTTTTTCACACATGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2197
Summary {0: 1, 1: 0, 2: 1, 3: 125, 4: 2070}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973100568_973100571 6 Left 973100568 4:46263462-46263484 CCCAGCACCATGTGTGAAAAAAG 0: 1
1: 0
2: 1
3: 125
4: 2070
Right 973100571 4:46263491-46263513 GTTTCCCCATTAAATTATCTTGG 0: 1
1: 2
2: 31
3: 205
4: 823

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973100568 Original CRISPR CTTTTTTCACACATGGTGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr