ID: 973103272

View in Genome Browser
Species Human (GRCh38)
Location 4:46297904-46297926
Sequence GCATCTCGTAAGTTTTGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973103270_973103272 -2 Left 973103270 4:46297883-46297905 CCTTTGAGCTTTGACTTCACTGC 0: 1
1: 0
2: 3
3: 36
4: 477
Right 973103272 4:46297904-46297926 GCATCTCGTAAGTTTTGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973103272 Original CRISPR GCATCTCGTAAGTTTTGGTA TGG Intronic
No off target data available for this crispr