ID: 973105584

View in Genome Browser
Species Human (GRCh38)
Location 4:46332311-46332333
Sequence AACATTTTCTAGGAGGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973105584 Original CRISPR AACATTTTCTAGGAGGATTA AGG (reversed) Intronic
903784225 1:25846992-25847014 AACACTTTCCAGGGGGATTCAGG - Intronic
905613837 1:39379597-39379619 AAAATTCTCTAGGAGAGTTAAGG - Intronic
907424697 1:54372335-54372357 ATCTTTGTCTTGGAGGATTATGG - Intronic
907694246 1:56705718-56705740 AACATGTTCATGGATGATTATGG - Intronic
911861107 1:102950501-102950523 AATATTTTCTAGGATGACTGAGG - Intronic
914991444 1:152502591-152502613 GACATTTACTGGGGGGATTAAGG + Intergenic
916195646 1:162219694-162219716 GACATTTCCTAGAAGGATGAAGG - Intronic
916821904 1:168407663-168407685 TACATTGTCTAGGAGGAGTGAGG + Intergenic
916960506 1:169883567-169883589 AACACCTTCTTGGAGGACTATGG + Intronic
917489467 1:175485634-175485656 AATCTTTTCTAGGATGATAAAGG - Intronic
918416632 1:184315843-184315865 TAAATTTTCTAGGAGTCTTAGGG - Intergenic
921688553 1:218120279-218120301 AATATTTTCTGGGAGGAGGAAGG - Intergenic
921905441 1:220490850-220490872 AGGATTTTCTAGGAGGTTTCGGG - Intergenic
921955411 1:220978384-220978406 AACATTTTCATGGAAGAATAAGG + Intergenic
922732872 1:227960674-227960696 AACAATTTTCAGGTGGATTAGGG + Intergenic
923405367 1:233654063-233654085 GGTATTTTCTAGGAGGATTAAGG - Intronic
923565921 1:235075823-235075845 AACATTTTCTTGGAGGGTGGTGG - Intergenic
1063560884 10:7126079-7126101 CAGATTTTCTATGAGGATTGGGG - Intergenic
1063884674 10:10565254-10565276 AACATTTTCTGGAAAAATTAAGG - Intergenic
1064606529 10:17047337-17047359 AATCTTTCCTAGGAAGATTAAGG - Intronic
1064665968 10:17651698-17651720 TACAGTTTCCAGGAGGATCAGGG + Intronic
1065120001 10:22519505-22519527 TACATTTTCTTGGAGTATTTAGG - Intergenic
1065409255 10:25405238-25405260 AACATTTTCTAGTAAGAGAAGGG + Intronic
1067700269 10:48566709-48566731 AAGATTTTCTAAGAGGACCATGG - Intronic
1067731415 10:48814365-48814387 AACATTTCTTAGGAGGAGGAAGG + Intronic
1067764131 10:49072440-49072462 AACAAGTTTGAGGAGGATTAAGG - Intronic
1071125331 10:82328208-82328230 AACATTTGCTAGAAGGAGAAGGG + Intronic
1072222456 10:93338147-93338169 AACATTATCTAGTATGATTGTGG - Intronic
1073664162 10:105510962-105510984 AACAATTTCTAGGAAGATTAGGG + Intergenic
1075229256 10:120658993-120659015 AAATCTTTCTAGGAGAATTACGG - Intergenic
1080109584 11:28550757-28550779 AACATTTTATAAAAGGATTTAGG - Intergenic
1080243393 11:30153036-30153058 AATATTTCCTAGGAGCTTTATGG - Intergenic
1080580277 11:33636827-33636849 AACATTTTCCCTGAGGATAAGGG + Intronic
1082703025 11:56457119-56457141 AACAATTAAAAGGAGGATTAGGG - Intergenic
1082908296 11:58337909-58337931 AACATTTTGAAAGAGGTTTATGG - Intergenic
1083585222 11:63852772-63852794 AACATTTTCATGTAGTATTATGG + Intronic
1086119912 11:83294984-83295006 AACAGTTTCTTGGAGGATGAGGG - Intergenic
1087800422 11:102497518-102497540 ACCATTTTCTGACAGGATTATGG + Intronic
1090109807 11:123894906-123894928 AACATTCTCCAGGAGTATTTAGG + Intergenic
1092015684 12:5156431-5156453 ATCATTGTCTTGGAGGGTTAGGG + Intergenic
1092620786 12:10265131-10265153 AATAATTTCTAGGTAGATTATGG - Intergenic
1093406142 12:18806978-18807000 ACCATTTTCTTGGACAATTATGG - Intergenic
1093657542 12:21713258-21713280 TACATTTTCCAGGATCATTATGG + Intronic
1094033322 12:26038940-26038962 AACATTTTCTAGAAAAATAAGGG - Intronic
1096924628 12:55129950-55129972 AACATTCCCTAGAAGGATCATGG - Exonic
1097096149 12:56550060-56550082 ACCATAGTATAGGAGGATTAAGG - Intronic
1098935739 12:76477216-76477238 AACAGTTTCTAAGAGTATAAAGG - Intronic
1099760618 12:86915746-86915768 AACCTTTTGTAGGAGGATATGGG - Intergenic
1099777826 12:87155882-87155904 AACATTCTCTAGGTAGTTTATGG - Intergenic
1101632567 12:106509865-106509887 AACATTTGCTTGAAGGAGTAAGG - Exonic
1103371823 12:120425085-120425107 AACATTTTCTATAGGGATTATGG + Intergenic
1105442317 13:20425703-20425725 AACATGTTCTAGGGGGAAGATGG - Intronic
1106443285 13:29800005-29800027 AAAATTTTCTAGGATGACTAGGG + Intronic
1107282798 13:38755795-38755817 AAAATTGTCTAGTAGGATTAGGG + Intronic
1110224967 13:73110189-73110211 AACTTTATCTAGAAGGATTGTGG + Intergenic
1110844266 13:80175954-80175976 GACATTTTTTAGGAGTATTGGGG - Intergenic
1113219464 13:108083057-108083079 AAAATTTTCTAGGTGACTTAAGG - Intergenic
1113348056 13:109499925-109499947 AACATTTACAAGGTGGAATAAGG + Intergenic
1113406591 13:110046504-110046526 GATATTTTTAAGGAGGATTAGGG - Intergenic
1114690901 14:24580192-24580214 AACCTATTCTAGGTAGATTATGG + Intergenic
1115081443 14:29456408-29456430 AATGTTTTCTATGAGGATCATGG - Intergenic
1115418035 14:33159403-33159425 AACGTTTTCTTGTAGAATTATGG + Intronic
1115563914 14:34607982-34608004 TCCATTTTCTAGGAGGTTTTAGG - Intronic
1117433330 14:55692683-55692705 AACATTATATAGGAAGATGAAGG - Intronic
1120950683 14:90038932-90038954 AACATTTTTTAGAATGATTTTGG + Intronic
1121005932 14:90490749-90490771 AGAATTTTCTTGCAGGATTATGG + Intergenic
1122043142 14:99004194-99004216 ACCATATTCTAGCAGGATGAGGG - Intergenic
1124132861 15:27005111-27005133 GAAATTTTCTAGCAGGATCATGG + Intronic
1124345887 15:28921264-28921286 AAGATTTTGTAGGAAGATAAGGG - Intronic
1124556604 15:30731581-30731603 TAAATTTTTTAGGAGGATTAAGG - Intronic
1124674675 15:31674156-31674178 TAAATTTTTTAGGAGGATTAAGG + Intronic
1125050093 15:35286840-35286862 AAGATTATCTAAGAGTATTATGG + Intronic
1126146423 15:45477162-45477184 AACATTTTCAAGCAGCATTCTGG - Intergenic
1126962146 15:54008937-54008959 AAGAGTTTCTGGGAGGATTACGG + Intergenic
1127436374 15:58962431-58962453 AAAACTTTCTAGAAGGTTTAGGG - Intronic
1130195322 15:81774561-81774583 AATATTTTCAAATAGGATTATGG + Intergenic
1132077088 15:98830912-98830934 ATCATTTTCTAGGAGGCCTCAGG + Intronic
1133992834 16:10723158-10723180 AGCAAATTCTAGGAGGATAATGG + Intergenic
1140761839 16:78116323-78116345 AATATTTTCTAGCATGATTAGGG + Intronic
1141966509 16:87448723-87448745 AACATTTTGTGGGAGGCTGAGGG - Intronic
1143729158 17:8870692-8870714 AAGATTATGTAGGAGGATGAAGG + Intergenic
1144508281 17:15852756-15852778 AACATTTTCAGAGAGGCTTAAGG + Intergenic
1145172402 17:20670400-20670422 AACATTTTCAGAGAGGCTTAAGG + Intergenic
1149311796 17:55401762-55401784 AACATTTTCTAGGTGGCATGTGG - Intronic
1149568276 17:57654421-57654443 ATCATTTTCTAGAAGGAGTGAGG - Intronic
1150489077 17:65561902-65561924 AACAGTTTCTGGTAGCATTATGG + Intronic
1151080133 17:71320075-71320097 AACATTTTTTATCAGGAGTATGG + Intergenic
1151298644 17:73204860-73204882 AACATTTTTTAGAAGGAACATGG + Intronic
1151438597 17:74113968-74113990 AACATTTTCTTTCAGGATGAGGG + Intergenic
1153786482 18:8539529-8539551 AGCAATTTCTAGAAGGATTCAGG - Intergenic
1153954731 18:10086587-10086609 AACAGGTTCTGTGAGGATTAGGG + Intergenic
1156366123 18:36428876-36428898 AACATTTTCAAGCAGGATTATGG + Intronic
1159404855 18:67987470-67987492 TACATTTTCTAACAAGATTAAGG + Intergenic
1162247008 19:9409582-9409604 AACATTTTTTAGTGGGATGATGG + Intergenic
1163524097 19:17809876-17809898 AACATTTTCAAGGAGGAACAGGG + Intronic
1167565607 19:50254636-50254658 AGCTTTGTTTAGGAGGATTATGG - Intronic
925810144 2:7692365-7692387 AATATGTTCTAGGAGGATACAGG - Intergenic
926023631 2:9519314-9519336 AGAATATTCTAGGAGGCTTAGGG + Intronic
928226015 2:29448834-29448856 AAGATTTTCTAAGAGGATTCAGG - Intronic
930481602 2:51954392-51954414 AACATTTTCAAGGAGATTTAAGG + Intergenic
932832490 2:75004582-75004604 GAAATTTTCTAGGTGGATTTAGG + Intergenic
934145173 2:89085971-89085993 AACATCTTCTGGGTGGATTTAGG - Intergenic
934224080 2:90114584-90114606 AACATCTTCTGGGTGGATTTAGG + Intergenic
937305756 2:120869500-120869522 CTCATTACCTAGGAGGATTATGG - Intronic
939762874 2:146206079-146206101 AACATTTTCAAGAAGGGATACGG + Intergenic
941639210 2:167969467-167969489 AACCTTTCCTGGGAGGATTCAGG - Intronic
943590917 2:189795757-189795779 GACATTTTATAGGAGAACTATGG + Exonic
945092122 2:206185427-206185449 AACATATTCTAGAAGCAATAAGG + Intronic
946685405 2:222264760-222264782 ACCATTTTGTAGGAGCATTTTGG - Intronic
947149699 2:227102647-227102669 AACATTTTGGACGAGAATTATGG - Intronic
1169434262 20:5571371-5571393 ATTATTTTCTATAAGGATTATGG - Intronic
1170174115 20:13448800-13448822 ATTATTTTCTTGGAGTATTATGG - Intronic
1171986650 20:31665609-31665631 AACATTTTCAGGGAGGCTAAGGG + Exonic
1173710240 20:45149216-45149238 AACTGTTTCTAGGAGGAGCATGG + Intergenic
1174987771 20:55474673-55474695 AACACATTCTAGGAGGTTGATGG + Intergenic
1177299411 21:19222560-19222582 AAAATTCTCTAGGAGGTTTTAGG + Intergenic
1177529791 21:22344273-22344295 AAATTTTTCTAGGTGGATTATGG - Intergenic
1181344106 22:22204538-22204560 AACATTTTAAAAGATGATTATGG - Intergenic
1183306085 22:37083955-37083977 AACATTTTATTGAAGGATTGAGG + Intronic
953535520 3:43774141-43774163 CACTTTTTCCATGAGGATTATGG + Intergenic
955716974 3:61840123-61840145 AACATTTCCTGGTAGTATTAGGG + Intronic
955837217 3:63069355-63069377 TAGATTTTCTAAAAGGATTATGG + Intergenic
955997619 3:64693476-64693498 AACATTTTGTAGAGGGATGAAGG - Intergenic
959413386 3:106053408-106053430 ATTATTTTCTAGGAGTTTTATGG - Intergenic
959933502 3:112007094-112007116 AATATTTTCAAGGAGTTTTAGGG + Intronic
960436889 3:117637123-117637145 TACATTTTCTAGGATGATGGTGG - Intergenic
962557444 3:136569423-136569445 AAAACTTTCTAGGAAAATTAGGG + Intronic
963362598 3:144294729-144294751 AACTTTTTCGAGAAGGATAAAGG - Intergenic
965203019 3:165684701-165684723 AACATTTAGTAGGAGAAATAAGG - Intergenic
965267518 3:166563698-166563720 TACATTTTCTGGAAGTATTAAGG - Intergenic
965338282 3:167455139-167455161 ACAATTTTAGAGGAGGATTAAGG - Intronic
966591851 3:181692920-181692942 AGGATTTGCTAGCAGGATTATGG + Intergenic
967379142 3:188838282-188838304 AAAAGATTCTAGGAGGATAAGGG + Intronic
967616817 3:191579895-191579917 AACCTTTTCTAGGAGTCTGAGGG + Intergenic
968409495 4:376546-376568 AACATTTTTTAGAAGTATTCAGG - Intronic
970568285 4:17353708-17353730 AAAATTTACTAGAAGGATTCTGG - Intergenic
970825390 4:20266820-20266842 AACTTTTTGTAGGAGAATCAGGG + Intronic
973105584 4:46332311-46332333 AACATTTTCTAGGAGGATTAAGG - Intronic
974924549 4:68281327-68281349 AAAAATTTGTAGGAGGTTTAAGG - Intergenic
976419540 4:84824750-84824772 TACATTTTCTAGCAGTATTGAGG - Intronic
977574451 4:98661000-98661022 AATAAGTTCTATGAGGATTAAGG + Intergenic
978967436 4:114758094-114758116 AACATGTTCTGAGAGGTTTATGG - Intergenic
979070387 4:116196544-116196566 ATAAATTTCTGGGAGGATTATGG + Intergenic
980061038 4:128129900-128129922 ATCATCTTCTAGGACGTTTATGG - Intronic
981112618 4:140953255-140953277 ACCATTTTTTAGAATGATTAAGG - Intronic
982284575 4:153721912-153721934 AACATTTTCTAGCAGGAAAGCGG - Intronic
982412709 4:155097172-155097194 AACATTTTATAGAATGATTGAGG - Intergenic
983737623 4:171082681-171082703 AAAAGTTTCTAGGAGGAAGAAGG + Intergenic
984257481 4:177406035-177406057 ATCATTTTCTACAAGTATTATGG - Intergenic
984398799 4:179234761-179234783 AATATTTTCTAGTATGATTGGGG + Intergenic
984642478 4:182183320-182183342 AACATCTTCTAGGTGGGTTCTGG - Intronic
985915103 5:2911787-2911809 AACATTTCCTGGGTGGATGAAGG - Intergenic
987493287 5:18609439-18609461 AACATTTTATATGAGGATATAGG + Intergenic
989039615 5:37213986-37214008 AACATTTTCTAGTACATTTATGG - Intronic
991156903 5:63448154-63448176 AAAATTTCCTAGGAGCATGAAGG + Intergenic
991776898 5:70094159-70094181 AACAGGTTCTACAAGGATTAAGG + Intergenic
991856185 5:70969604-70969626 AACAGGTTCTACAAGGATTAAGG + Exonic
991870199 5:71102377-71102399 AACAGGTTCTACAAGGATTAAGG + Intergenic
992741063 5:79774198-79774220 AATGTTTTCTGTGAGGATTATGG - Intronic
992975768 5:82117896-82117918 AATGTTTTTTAGGAGGATTGTGG + Intronic
994502415 5:100596493-100596515 AACTTTTTCTAGGAGGAAGTAGG - Intergenic
996347699 5:122504885-122504907 CACATTTTCTAGGATGGTCAGGG + Intergenic
997121872 5:131182806-131182828 AACTTCTACTAGGAGTATTAGGG - Intronic
999013078 5:148064170-148064192 AACATTTTTTGGCAGGAGTAGGG - Intronic
1000487254 5:161862591-161862613 AACATATTTTAGGTCGATTAGGG - Intronic
1003362121 6:5437446-5437468 AAGATTTTCTACTATGATTATGG + Intronic
1003466674 6:6386792-6386814 TAAATTTTCAAGGAAGATTAAGG - Intergenic
1003780468 6:9419194-9419216 AACATTTTATAGGAGAGTTGAGG + Intergenic
1003789801 6:9533145-9533167 AACATTTTTTAACAGGAATAGGG - Intergenic
1007868639 6:45006058-45006080 AATATTTTATAGAAGGATAAAGG - Intronic
1008313514 6:50008489-50008511 CAGATTTACTATGAGGATTATGG - Intergenic
1008452039 6:51664076-51664098 AACATTTTTTTGGAGTAATAAGG + Intronic
1008757452 6:54814244-54814266 AACATTTCCTATGAGTTTTAAGG + Intergenic
1009972536 6:70640235-70640257 AACATAATCTAGGAGAAATATGG + Intergenic
1010081359 6:71867865-71867887 GACATTTTCTAGGAACTTTAAGG - Intergenic
1010579130 6:77572733-77572755 AACATTTTCTAGAAGTCCTATGG - Intergenic
1011704089 6:89983819-89983841 AACATATTCTAGCAGGAGTGGGG + Intronic
1014847151 6:126291447-126291469 ACTATTTTCTAAGATGATTACGG - Intergenic
1016088198 6:139942108-139942130 AATATTTTGTAGGAAGTTTATGG + Intergenic
1018331158 6:162728220-162728242 GACATTTTCTAGGAAGATGGTGG + Exonic
1018948415 6:168363107-168363129 AACATTTTCTTGAATGATTCTGG - Intergenic
1024614309 7:51096479-51096501 AACATTTAATAGAAAGATTAAGG + Intronic
1025028429 7:55536630-55536652 AACATTTTCCAAGAGGAAGACGG + Intronic
1026441709 7:70450684-70450706 GACATTTTGGAGGAGGATTCAGG + Intronic
1027527200 7:79284891-79284913 AGAATCCTCTAGGAGGATTAAGG - Intronic
1028094820 7:86746951-86746973 AACATGTTCAAAGAGGATTTGGG + Intronic
1030326724 7:108227566-108227588 AAGATTTTCTAAGTGGATGAAGG + Intronic
1030806213 7:113922904-113922926 AAGATTTTCCAAGAGGATGATGG + Intronic
1030917845 7:115339092-115339114 AGAATTTTCTAGGAGGCATAAGG - Intergenic
1034672366 7:152868432-152868454 CACATTTTCCAGGAGGGTCATGG - Intergenic
1036679790 8:10863717-10863739 AACATTGCCAAAGAGGATTATGG - Intergenic
1037197857 8:16213899-16213921 AACATTTTCTCTGATGATGAGGG - Intronic
1039433514 8:37544053-37544075 CACATTTTCTGGGGGGATTGGGG - Intergenic
1043006804 8:74829991-74830013 AAGATTTTAGAGAAGGATTAGGG + Intronic
1043067621 8:75595168-75595190 AACACTTTCCAGGAGGAATTTGG + Intergenic
1044301893 8:90593989-90594011 AACAGTTTCCAGGAGGAAGAAGG + Intergenic
1045958930 8:107944234-107944256 AAAATTTTCTCGTAGGACTAAGG + Intronic
1046391054 8:113573550-113573572 AACATTTTTTAGCAGTAATAAGG - Intergenic
1047921167 8:129636040-129636062 AACATTTTCCACGAGGGCTAAGG - Intergenic
1050181510 9:2927956-2927978 AACATTTTCTAGGATTATAGAGG - Intergenic
1051349951 9:16189805-16189827 AACATTTTTGTGGAGGAGTAAGG - Intergenic
1051390724 9:16560409-16560431 AACATTTTATAAGAGGAAAATGG + Intronic
1058325474 9:103691450-103691472 AACACTTTCTTGTAGGATTGAGG - Intergenic
1186622222 X:11253424-11253446 AACATTTCCACGGAGGATTTTGG - Intronic
1189503946 X:41592374-41592396 AACATTTTCAACTATGATTATGG + Intronic
1192743711 X:73918052-73918074 AACAACATCTAGGAGGACTAGGG + Intergenic
1194625406 X:96221036-96221058 AATATTTACTAGGTAGATTAGGG - Intergenic
1194945569 X:100063013-100063035 AACATTTTCTAGGTAGACAAAGG + Intergenic
1195850078 X:109273368-109273390 AGCTTTTTCTAGAAGAATTAGGG - Intergenic
1197412087 X:126129450-126129472 AATGTTTTCTAGTAAGATTATGG - Intergenic
1198393190 X:136196934-136196956 AGAATTTTCTAGTGGGATTAAGG + Intronic
1200704100 Y:6426806-6426828 TGCATTTTCCAGGAGGATTTTGG - Intergenic
1201030011 Y:9737902-9737924 TGCATTTTCCAGGAGGATTTTGG + Intergenic
1202053515 Y:20805278-20805300 AGCAGTTGCTAGGATGATTATGG - Intergenic
1202178551 Y:22119798-22119820 TACATTTTCCAGGAGGATTTTGG - Intergenic
1202212810 Y:22466596-22466618 TACATTTTCCAGGAGGATTTTGG + Intergenic