ID: 973106459

View in Genome Browser
Species Human (GRCh38)
Location 4:46344694-46344716
Sequence ACTACTACACAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973106454_973106459 5 Left 973106454 4:46344666-46344688 CCAGGACATTAACTAAAGGGGAT 0: 1
1: 0
2: 0
3: 5
4: 84
Right 973106459 4:46344694-46344716 ACTACTACACAGAAGGAGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973106459 Original CRISPR ACTACTACACAGAAGGAGGA GGG Intronic
902150524 1:14439227-14439249 AATACAAAAGAGAAGGAGGAAGG - Intergenic
903176497 1:21584611-21584633 ACTTGAACCCAGAAGGAGGAGGG + Intergenic
905027403 1:34860162-34860184 ACCTCTACACAGAAGGGGAAGGG - Intergenic
906134536 1:43487598-43487620 ACTTGAACCCAGAAGGAGGAGGG + Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908365481 1:63418688-63418710 ACTACTACAAAGATGGAGGGTGG + Intronic
908447018 1:64208752-64208774 GCTTCTAAACAGAACGAGGAAGG + Intronic
910409656 1:86926874-86926896 ACTTCTATAAGGAAGGAGGAAGG - Intronic
913373736 1:118129094-118129116 GCTCCTACACAGATGAAGGAAGG + Intronic
913974423 1:143443241-143443263 ACCACTACATAGAAACAGGAAGG + Intergenic
914068813 1:144268855-144268877 ACCACTACATAGAAACAGGAAGG + Intergenic
914110342 1:144697499-144697521 ACCACTACATAGAAACAGGAAGG - Intergenic
920204110 1:204279100-204279122 TCATCTGCACAGAAGGAGGAGGG + Intronic
921720395 1:218464585-218464607 AATACTACAAATAAAGAGGAGGG - Intergenic
923143101 1:231178114-231178136 ATTACCACACATAAGGAGGGAGG - Intronic
924635114 1:245779075-245779097 ACTTGAACCCAGAAGGAGGAGGG + Intronic
1066818517 10:39453583-39453605 AAAACTACACAGAAGGATTATGG - Intergenic
1067609799 10:47701861-47701883 ATAACTACACAGAAGGGGGTGGG + Intergenic
1067987912 10:51171605-51171627 AGTACTAGACAGGAGGATGAAGG - Intronic
1070144098 10:73761145-73761167 ACTGCTCCACAGAAGGACAAAGG - Intronic
1071555727 10:86599960-86599982 AGTTCCACACAGAAAGAGGAGGG - Intergenic
1079089608 11:17471363-17471385 AGTTCAACAGAGAAGGAGGAAGG + Intronic
1079775027 11:24514452-24514474 ATTACAGCACAGAATGAGGAAGG + Intronic
1080932877 11:36831113-36831135 ACTACTAGACAGGAGAGGGAAGG - Intergenic
1081556862 11:44172310-44172332 ATTCCTTCACACAAGGAGGAAGG - Intronic
1085789325 11:79483378-79483400 CTTACCACAAAGAAGGAGGAAGG + Intergenic
1085807634 11:79650890-79650912 ACTAATTCACAGAAGCAGAAAGG - Intergenic
1086293125 11:85333970-85333992 ACTACTCCAGAGAAGCAAGAAGG - Intronic
1086487155 11:87318613-87318635 AATATTATTCAGAAGGAGGATGG + Intronic
1087856290 11:103095446-103095468 ACTATTATACAGAAGGATGTAGG + Intergenic
1089330304 11:117684867-117684889 ATTGCTCCACAGAGGGAGGAAGG + Intronic
1090549105 11:127799626-127799648 ACAACTACACAAAAGGAGAAGGG - Intergenic
1091248452 11:134120656-134120678 ACTACCACAAGGAAAGAGGACGG + Intronic
1092780908 12:11985934-11985956 ACTACTAGACAGAAGTCTGAAGG + Intergenic
1093000524 12:13990863-13990885 ACAGATACACAGAAGGATGAGGG + Intergenic
1094575608 12:31682418-31682440 GCCACTACTCAGAAGGGGGAGGG + Intronic
1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG + Intergenic
1098693782 12:73525622-73525644 ACTAGGACACAGAAGGAATATGG + Intergenic
1099293588 12:80802753-80802775 CCGGCTACACAGGAGGAGGAGGG - Intronic
1100604836 12:96143131-96143153 GATACTACACACAGGGAGGAGGG + Intergenic
1100791777 12:98138083-98138105 CCAAGTGCACAGAAGGAGGAAGG - Intergenic
1102724552 12:115049413-115049435 ACTGACACACAGAAGGAGAAAGG + Intergenic
1105595162 13:21830626-21830648 ACTACTAGAGAGGAGGGGGAGGG - Intergenic
1105698868 13:22919042-22919064 ACCATCACACAGAAGGAGGAGGG - Intergenic
1105850617 13:24331902-24331924 ACCATCACAAAGAAGGAGGAGGG - Intergenic
1106466738 13:30020303-30020325 ACTACTACAGAGAAGCACGTTGG - Intergenic
1106622077 13:31380363-31380385 ACTACTAGATGGAAGGAGGGAGG + Intergenic
1108372722 13:49787012-49787034 ACTAATACAAAGAAGGGTGAAGG + Intronic
1110868949 13:80428305-80428327 ACAAAAACACAGAAGCAGGAAGG + Intergenic
1110917899 13:81046464-81046486 ACTAATACAAAGAGGGAGGATGG - Intergenic
1111220324 13:85196809-85196831 ACAAATACACAGATGGAAGATGG + Intergenic
1112345372 13:98584862-98584884 ATTAGTACTCAGCAGGAGGAGGG + Intergenic
1113079124 13:106498576-106498598 ACTATAAGACAGTAGGAGGAAGG + Intronic
1114055039 14:18960651-18960673 ACTACCAGACAGAAAAAGGAGGG - Intergenic
1114107502 14:19441127-19441149 ACTACCAGACAGAAAAAGGAGGG + Intergenic
1118244022 14:64090592-64090614 AGTTCTACACAGAAAGTGGAGGG + Intronic
1119040947 14:71274062-71274084 ACTATTACAGAGAAGAAGAATGG + Intergenic
1119394308 14:74314948-74314970 GCTCCTACACAGAAGGATGGAGG + Intronic
1123413946 15:20081654-20081676 AGTTCTGCACATAAGGAGGAAGG - Intergenic
1123523288 15:21088765-21088787 AGTTCTGCACATAAGGAGGAAGG - Intergenic
1124204397 15:27704696-27704718 AATCATACACAGCAGGAGGATGG + Intergenic
1128716101 15:69909253-69909275 ACTGCCACACAGAAAAAGGAGGG + Intergenic
1131454825 15:92575400-92575422 AGCAATAGACAGAAGGAGGAAGG + Intergenic
1132459679 16:45417-45439 AGAACTACATTGAAGGAGGACGG + Intergenic
1135263877 16:21004756-21004778 AATACTCCAAAGAAGGAAGAGGG - Intronic
1135719594 16:24803932-24803954 ACTAGTAAACAGAAGGTGGCTGG - Intronic
1136989376 16:35142769-35142791 ACTGCTCCACCCAAGGAGGAGGG + Intergenic
1137901236 16:52271564-52271586 ATGACATCACAGAAGGAGGATGG + Intergenic
1138235005 16:55374687-55374709 ACTGACACACAGAGGGAGGAAGG + Intergenic
1140775810 16:78248058-78248080 ACTAATACACACATAGAGGATGG - Intronic
1144642275 17:16944123-16944145 GCCACTCCACAGAAGCAGGAGGG - Intronic
1148336451 17:46845150-46845172 ACTGCTCAAAAGAAGGAGGAAGG - Intronic
1150430787 17:65115245-65115267 ACAACAACACAAAATGAGGAAGG - Intergenic
1151370561 17:73644259-73644281 ACTAGTACAGAAGAGGAGGAAGG - Intergenic
1151412434 17:73940168-73940190 ACAAATACAGAGAAGGGGGAAGG + Intergenic
1151451369 17:74200247-74200269 ACTTCCAGACAGAAGGAGGGAGG - Intergenic
1152033900 17:77859943-77859965 CCAACAAGACAGAAGGAGGAAGG - Intergenic
1155048382 18:22124625-22124647 AATACTACACAGCAAGAAGAAGG + Intergenic
1155842102 18:30658896-30658918 ACTACCACACAGCAAAAGGAGGG + Intergenic
1156499035 18:37545318-37545340 GCTACTAGGCAGCAGGAGGAAGG - Intronic
1164092144 19:21966258-21966280 AATTCTAAAAAGAAGGAGGAAGG - Intronic
1164196285 19:22965577-22965599 AATTCTAAAGAGAAGGAGGAAGG - Intergenic
1165056575 19:33180687-33180709 ACCACTACACAGCAAGAGAAAGG + Intronic
1165552302 19:36597739-36597761 AATACTACACAGCAAAAGGAAGG + Intronic
1166539879 19:43598067-43598089 AATCTTACCCAGAAGGAGGAAGG + Intronic
1166801828 19:45462628-45462650 AATAATACAGAGGAGGAGGAGGG - Intronic
927353897 2:22151617-22151639 ACAACCACACAGCTGGAGGAAGG - Intergenic
928031636 2:27784628-27784650 ATAAAGACACAGAAGGAGGAAGG + Intronic
928411400 2:31057124-31057146 ACTACTAGACAGGAGAAGGAGGG + Intronic
928614258 2:33020774-33020796 ACAAATACTCATAAGGAGGAAGG - Intronic
929772345 2:44902946-44902968 ACTACCACACAGAAAAAGGAGGG + Intergenic
930144733 2:47990321-47990343 AGTACTCACCAGAAGGAGGATGG - Intergenic
930307624 2:49695104-49695126 ACTAGTAAAGAGAAGGAGGCAGG - Intergenic
932668342 2:73716026-73716048 AGTCCTACATAGAATGAGGAAGG + Intergenic
932697800 2:73971110-73971132 ACTTCTGCTCAGAAGGTGGAGGG + Intergenic
933177786 2:79195342-79195364 GCTGCTACCCAGAAGGAAGAAGG - Intronic
933276796 2:80292463-80292485 AATACTACTCTGAACGAGGAGGG + Intronic
934179129 2:89604216-89604238 ACCACTACATAGAAACAGGAAGG + Intergenic
934289413 2:91678484-91678506 ACCACTACATAGAAACAGGAAGG + Intergenic
935265754 2:101392453-101392475 AATGACACACAGAAGGAGGAAGG + Intergenic
935283913 2:101546597-101546619 ACAACTAATCAGAAGAAGGATGG + Intergenic
935518903 2:104078981-104079003 ACTTCAACTCAGAAGGAGCAGGG + Intergenic
937827602 2:126383884-126383906 AGTCCTACACAAAAGCAGGAAGG + Intergenic
938394370 2:130931487-130931509 CATACTACAGAGAAGGAAGAGGG - Intronic
938473050 2:131583438-131583460 ACTACCAGACAGAAAAAGGAGGG - Intergenic
939424233 2:142014135-142014157 GCTACTCCACAGACGGAGTAGGG - Intronic
944117875 2:196208741-196208763 AGGAATACACAGAAGGAGGCTGG + Intronic
946709040 2:222487719-222487741 ACCACTGGACAGGAGGAGGATGG - Intronic
948403432 2:237700938-237700960 AATTCTACACAGAAGCTGGAAGG - Intronic
948697500 2:239739796-239739818 ACTCCTCCACAGACAGAGGAAGG + Intergenic
1169502911 20:6178177-6178199 ACAGAGACACAGAAGGAGGATGG + Intergenic
1169780726 20:9307082-9307104 AGTTCCACACAGAAGGAGGAGGG + Intronic
1170008034 20:11690101-11690123 ACAACAACTCAGAAGAAGGATGG - Intergenic
1172305250 20:33876057-33876079 ACTAATACACAGAGGAAAGAAGG + Intergenic
1178727336 21:35065522-35065544 ACTAATGCAGAGAAAGAGGAGGG + Intronic
1180473520 22:15683201-15683223 ACTACCAGACAGAAAAAGGAGGG - Intergenic
1180722867 22:17922346-17922368 AGAACTACACAAAAGGAGAAAGG + Intronic
1181543893 22:23589938-23589960 ACTGCTACACAGAGGGATGAAGG - Intergenic
1182546173 22:31077913-31077935 AGTTCTGCACATAAGGAGGAAGG + Intronic
1183139649 22:35924870-35924892 ACTATTACAAAGTAGGAGGCTGG + Intronic
1184266736 22:43351276-43351298 ACTGCAGGACAGAAGGAGGATGG - Intergenic
949465462 3:4339099-4339121 GCTACGTCACAGAATGAGGAGGG - Intronic
951404160 3:22273763-22273785 ACTATTCCACAGGATGAGGAGGG + Intronic
952401737 3:32969655-32969677 AGAACTACATTGAAGGAGGATGG + Intergenic
952979498 3:38723422-38723444 ACTGCTTCACAGAAGGTGAAGGG - Exonic
955643420 3:61110698-61110720 ACCACACCACAGAAGGAAGAAGG + Intronic
957234015 3:77561032-77561054 TCTATTACACAGAGGGAAGATGG - Intronic
957254016 3:77813423-77813445 ACTACTCTGCAGGAGGAGGAAGG + Intergenic
958433353 3:94068036-94068058 ACTACTGCACAGAGGGAGAAGGG - Intronic
958677708 3:97288236-97288258 ACTACTACAGAGGGTGAGGAAGG - Intronic
959007978 3:101042205-101042227 ATGGCTACAGAGAAGGAGGAAGG - Intergenic
959217918 3:103477203-103477225 CCTGCTACAAAGAAGGATGATGG - Intergenic
960135789 3:114103549-114103571 ACTACGGCGCAGAAGAAGGACGG - Intergenic
962751325 3:138436327-138436349 ATTAGGACACAGAAGGAAGACGG - Intronic
964275202 3:155002269-155002291 ACTTCTACACAGGAGTAGAATGG + Intergenic
966202421 3:177370911-177370933 GCCATCACACAGAAGGAGGAGGG - Intergenic
968678323 4:1898021-1898043 AGTTCCACCCAGAAGGAGGAGGG - Intronic
969234710 4:5857697-5857719 ACTAGTAAGCAGAAGAAGGAAGG + Intronic
969830153 4:9789400-9789422 ACCACTACATAGAAACAGGAAGG - Intronic
970328846 4:14957769-14957791 CTTTCTCCACAGAAGGAGGAAGG + Intergenic
972784113 4:42311164-42311186 ACTAGAAGACAGGAGGAGGAAGG - Intergenic
972838837 4:42907639-42907661 GCTACTACATATAAGGAGCAGGG - Intronic
972926648 4:44016695-44016717 ACTGCCACACAGAAAAAGGAGGG + Intergenic
972926657 4:44016767-44016789 ACTGCCACACAGAAAAAGGAGGG + Intergenic
972926674 4:44016896-44016918 ACTGCCACACAGAAGAAGGAGGG + Intergenic
972926679 4:44016939-44016961 ACTGCCACACAGAAAAAGGAGGG + Intergenic
973106459 4:46344694-46344716 ACTACTACACAGAAGGAGGAGGG + Intronic
973251950 4:48069750-48069772 ACTGAGACATAGAAGGAGGAAGG - Intronic
974963732 4:68735322-68735344 GCTTCCACACAGAAAGAGGAGGG + Intergenic
976325697 4:83769348-83769370 AGAAATACACAGAAGGGGGAAGG - Intergenic
976708502 4:88043479-88043501 ACAACCACACAGAAATAGGAGGG - Intronic
978110433 4:104958003-104958025 ACTAATACCCAGAATGTGGAAGG - Intergenic
978360941 4:107931069-107931091 ACTACTACACCGAAGCATGCAGG + Intergenic
978400900 4:108329645-108329667 ACTACTAGAGGGAGGGAGGAGGG + Intergenic
979805812 4:124969634-124969656 ACTACTAGAGAGAAGAGGGAGGG - Intergenic
982663345 4:158231163-158231185 GCTCCTACACAGAACGTGGAGGG + Intronic
982714510 4:158792748-158792770 ACTGCTTCACAGAATGAGAATGG + Intronic
984901265 4:184588727-184588749 ACTAATACACAGAATGTGGATGG - Intergenic
985977292 5:3430283-3430305 AGTTCTCCACAGAAGGACGATGG + Intergenic
986969048 5:13311012-13311034 ACTAGTACACACAAGCTGGAAGG - Intergenic
987416601 5:17669179-17669201 ACTAAAACACAGAAGGTGCAGGG + Intergenic
988763300 5:34340541-34340563 ACTACTACAGAGATGGGGGGAGG - Intergenic
991014456 5:61916002-61916024 GGTTCCACACAGAAGGAGGAAGG - Intergenic
993121331 5:83778315-83778337 ACTAGTACAGAGAAGGATTATGG + Intergenic
995714890 5:115072661-115072683 ACTCCCATACAGAGGGAGGAGGG + Intergenic
997039862 5:130240085-130240107 ACTACTAGAGAGAAGAGGGAGGG - Intergenic
999036035 5:148350826-148350848 ACTACTATGCAGAAGCAGTATGG - Intergenic
999749928 5:154620255-154620277 AAAACAAGACAGAAGGAGGAAGG - Intergenic
1000151706 5:158508486-158508508 ACTACTACACTGAGGGAAGAAGG - Intergenic
1002336588 5:178483501-178483523 ACTACAACTCAGAAGTGGGAAGG + Intronic
1003109328 6:3240460-3240482 AATACTGCGCAGAAGGACGAAGG + Intronic
1003126861 6:3362692-3362714 TCCACTACACAGAGTGAGGATGG + Intronic
1003526034 6:6898483-6898505 ATTAGTACACAGCAGGTGGAGGG - Intergenic
1003990485 6:11481856-11481878 ACAAATACACAGAAGGAACATGG + Intergenic
1005250158 6:23936376-23936398 ACTGATACACATCAGGAGGAAGG - Intergenic
1007709000 6:43809721-43809743 ACTGCCATACAGAAGGCGGATGG + Intergenic
1009023516 6:57970685-57970707 AATTCTATACAGAAGGAGGGTGG + Intergenic
1009199088 6:60722250-60722272 AATTCTATACAGAAGGAGGGTGG + Intergenic
1010899159 6:81404289-81404311 GGACCTACACAGAAGGAGGAAGG - Intergenic
1010982288 6:82381907-82381929 TATACTATCCAGAAGGAGGATGG - Intergenic
1011125175 6:83999583-83999605 ACTAATACACATAGGGAAGATGG - Intergenic
1013141308 6:107338494-107338516 ACTACTATACACAAGAAGGGAGG - Intronic
1015692792 6:135944179-135944201 ACTAGAGCATAGAAGGAGGAGGG + Intronic
1016090583 6:139973877-139973899 ACTAGGACAGAGAAGAAGGAGGG - Intergenic
1017074993 6:150609754-150609776 AGTGGTACAGAGAAGGAGGATGG + Intronic
1020676665 7:11192058-11192080 AATTCCACACAGAAAGAGGAGGG - Intergenic
1022760144 7:33339910-33339932 TCCAATACACAGAGGGAGGAGGG + Intronic
1023183379 7:37509040-37509062 ACTACAAAACATAAGGGGGAAGG - Intergenic
1023262247 7:38369882-38369904 AATATTACACAGAATGTGGAGGG + Intergenic
1023609720 7:41960424-41960446 ACTACTACTTAGAAAGAGGAAGG + Intergenic
1024175320 7:46834471-46834493 ACAACTTCACTGAAGCAGGAGGG + Intergenic
1025115511 7:56254763-56254785 ACTTATGAACAGAAGGAGGACGG - Intergenic
1027778864 7:82498950-82498972 AGAACTACACAGAAGGTGGAGGG + Intergenic
1027817294 7:82992233-82992255 ACTACTACAAAGAAAGATGTAGG + Intronic
1028061225 7:86319262-86319284 ACTACTAAACAGAGGGAGGAAGG + Intergenic
1028213956 7:88109023-88109045 ACTAATATAAAGAAGGAGTAGGG - Intronic
1028971958 7:96869179-96869201 ATTAATACACAGAATGAGGTTGG + Intergenic
1030866696 7:114709027-114709049 ACTACTAGACAGAAGAGGGTAGG - Intergenic
1030942417 7:115670499-115670521 ATAGTTACACAGAAGGAGGAAGG + Intergenic
1031506849 7:122595745-122595767 CCAACTACACAGAAGTAGAATGG + Intronic
1031903707 7:127438326-127438348 ACTTCTACATAGGAGGAGGCAGG + Intergenic
1034483680 7:151342785-151342807 ACCACTTGACAGAAGGACGAAGG - Intronic
1034496223 7:151424452-151424474 TCTACTAGACAGAAGGTTGAAGG - Intergenic
1038277723 8:26135773-26135795 ACTACTACACAGGGGCATGAAGG - Intergenic
1039586041 8:38707930-38707952 ATTTTTACACAGAAGGCGGAGGG - Intergenic
1040995268 8:53394727-53394749 ATTACTACACAGGAGAAGGTGGG - Intergenic
1042369353 8:67973126-67973148 ACTACTTCAGAGAAGAAGCAGGG - Intronic
1043508498 8:80926262-80926284 ACAAATACACATAAGGAGGGAGG + Intergenic
1043684381 8:83068280-83068302 TCTGCTACAGAGAAGGAGCAGGG - Intergenic
1045771119 8:105741869-105741891 ACTACTAAAATGAAGGAAGAAGG + Intronic
1046129659 8:109951494-109951516 ACTACTAGAGAGCAGAAGGAAGG - Intergenic
1047739084 8:127793105-127793127 AACACTACACAGAAAGAGGGAGG + Intergenic
1050275247 9:3990660-3990682 TCTACTATACAGAAGAGGGAAGG + Intronic
1050405817 9:5307685-5307707 ATTCCAACACAGAAGGACGAGGG - Intergenic
1050420846 9:5463866-5463888 ACTACTCTACAGAAGTAGGTAGG + Intronic
1051051435 9:12936977-12936999 TATAATACACAGAAAGAGGATGG - Intergenic
1051097386 9:13482230-13482252 ACTACTACAAAGAAGGAAAAAGG - Intergenic
1052721824 9:32180854-32180876 AATAGTACACAGAATGAGGCTGG + Intergenic
1053073750 9:35115958-35115980 ACAAGTCCACAGAAGGTGGAAGG - Intronic
1053511617 9:38692867-38692889 ACTACTCCATAGGAGGGGGAGGG - Intergenic
1053534015 9:38907969-38907991 ACTACTCCAGAGATGGAGGCAGG + Intergenic
1054206239 9:62132388-62132410 ACTACTCCAGAGATGGAGGCAGG + Intergenic
1054457218 9:65439723-65439745 AAAACGACACAGGAGGAGGAGGG + Intergenic
1054632118 9:67455958-67455980 ACTACTCCAGAGATGGAGGCAGG - Intergenic
1055307363 9:74943613-74943635 AGTGCTACAGAGAAGGAAGAGGG + Intergenic
1055357210 9:75449804-75449826 AGTACAAGACAGAAGGGGGAGGG + Intergenic
1055770734 9:79714396-79714418 ATAACTACACAGTAGGTGGATGG - Intronic
1056057157 9:82837750-82837772 ACTACTTCACACAATTAGGATGG + Intergenic
1058099833 9:100906984-100907006 ATTACTAAAAAGTAGGAGGAGGG + Intergenic
1058801453 9:108548305-108548327 ACTAAAACTCAGAAGGATGAAGG - Intergenic
1059856970 9:118410080-118410102 AATACAAGACAGAAAGAGGAAGG + Intergenic
1186187417 X:7035132-7035154 ACTTCTATACAGAAGGTGGGTGG - Intergenic
1188177729 X:27013827-27013849 ACTACTAGATAGGAGAAGGAGGG - Intergenic
1189578902 X:42384833-42384855 ACTGTTACCCAGAAGGAGAAAGG - Intergenic
1191091563 X:56628685-56628707 ACTACTACACAAAACAATGAGGG + Intergenic
1193120471 X:77818032-77818054 ACTACTACATAGACAGAGTAGGG + Intergenic
1194971120 X:100345200-100345222 ATTACTACACAGAATAATGATGG - Intronic
1196262149 X:113595830-113595852 ACAACTTCACTGAAGGAGCAGGG - Intergenic
1196553407 X:117057757-117057779 ACAAACACACAGAAGGAAGATGG - Intergenic
1197446446 X:126555809-126555831 ACTGCTCCACAGGAGCAGGAAGG + Intergenic
1197516462 X:127436463-127436485 ACTGTTAAACAGAAAGAGGAAGG + Intergenic
1197843991 X:130781025-130781047 AGTACTAGACAAAAGGAAGAGGG - Intronic
1202039845 Y:20669929-20669951 ACACATACACAGAAAGAGGATGG - Intergenic