ID: 973107256

View in Genome Browser
Species Human (GRCh38)
Location 4:46355672-46355694
Sequence CAGGAACCCCCAAATAATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973107250_973107256 3 Left 973107250 4:46355646-46355668 CCCTTTGCTAAAGATCCTGCCAA 0: 1
1: 0
2: 2
3: 4
4: 152
Right 973107256 4:46355672-46355694 CAGGAACCCCCAAATAATCAGGG 0: 1
1: 0
2: 0
3: 13
4: 126
973107251_973107256 2 Left 973107251 4:46355647-46355669 CCTTTGCTAAAGATCCTGCCAAG 0: 1
1: 0
2: 2
3: 9
4: 126
Right 973107256 4:46355672-46355694 CAGGAACCCCCAAATAATCAGGG 0: 1
1: 0
2: 0
3: 13
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973107256 Original CRISPR CAGGAACCCCCAAATAATCA GGG Intronic
900189363 1:1346754-1346776 CAGGAACCCCCGACTCACCAGGG + Intronic
901676638 1:10889248-10889270 AAGGAACCCACTAATAAGCAGGG - Intergenic
905251915 1:36654742-36654764 CAGGAACCCCCAAAGCTTCAAGG - Intergenic
906653365 1:47530247-47530269 TAGGAACCCACATATAATGAGGG + Intergenic
907211005 1:52821702-52821724 TAGAAACCCCCAAAACATCAGGG - Exonic
909730937 1:78888511-78888533 CAGGAAACCCAAAATAAAAAGGG + Intergenic
915620375 1:157079117-157079139 CAGGGACCCCCACACAACCAGGG - Intergenic
916500909 1:165385931-165385953 CAGGACCCCCTAGATAATCCAGG - Intergenic
916968089 1:169975157-169975179 GAGGAACCCCCAAATAAGGAGGG + Intronic
917257811 1:173134652-173134674 CAGGAAGCCCCAAACAAACAAGG + Intergenic
917429442 1:174950633-174950655 CAGTAACCCCCAAATTTCCAAGG + Intronic
919916121 1:202140458-202140480 CAGGAACCACCTATTCATCAGGG + Intronic
923364130 1:233243150-233243172 CAGGAATCCCCAAAGAGACATGG + Intronic
1067313415 10:45137471-45137493 CAGAAAAACCCAAATAACCAAGG + Intergenic
1068907322 10:62341257-62341279 CAGGAGCCCCCAAGTTATCTTGG - Intergenic
1069274652 10:66574710-66574732 CAGGAAGCTCAAAGTAATCATGG - Intronic
1070052591 10:72903826-72903848 CAATAAACCCCAAATAATGATGG + Intronic
1070975794 10:80604557-80604579 CAGTCACCCCCAGATAATGAAGG + Intronic
1073397670 10:103231320-103231342 CAGGAATCCACAAATACTCTTGG + Intergenic
1077616204 11:3675860-3675882 CAGAATCCCCCAAAGAACCAGGG - Exonic
1077929539 11:6716653-6716675 CAGGAACACCCAAGAAGTCATGG - Intergenic
1079528081 11:21414788-21414810 GGGGAACCCCCAGATAATCCCGG + Intronic
1085187535 11:74589189-74589211 CAGCAACCACCTAATAATCCTGG + Intronic
1085318590 11:75561169-75561191 TAGGAAACCCTAAATAATCTGGG - Intergenic
1091672134 12:2459641-2459663 CAGGAAAACCCAAATAATTTAGG - Intronic
1091967580 12:4757953-4757975 CAGGAACTCAGAAATAATGAGGG - Intronic
1092679406 12:10961352-10961374 CAGCATCCCCCAAATAAACCAGG + Intronic
1096096083 12:48936640-48936662 CTGGAGCCCCCAAAAAAACAAGG + Exonic
1097581922 12:61468322-61468344 CAGGAAAGCAAAAATAATCATGG - Intergenic
1098435285 12:70461878-70461900 CATGAAACCCCAAAGAAGCAAGG + Intergenic
1101200949 12:102435706-102435728 CAGGAACCCCCACAGAATTATGG - Intronic
1104379042 12:128291117-128291139 CAGGAATCCCCAAATTCTCGAGG + Intronic
1109010176 13:56930598-56930620 GAGGAACCCCCAAAAAGGCAAGG + Intergenic
1112606778 13:100914086-100914108 CAGGAACCCACAAGAAGTCAAGG - Intergenic
1113470563 13:110542017-110542039 AAGGAACTGCCAAATAATAAGGG + Intronic
1114732315 14:25006490-25006512 GAGGAACCCTCACATAAACATGG + Intronic
1119883944 14:78124477-78124499 CAGTATCCCCCAAATAAGCCCGG - Intergenic
1121786818 14:96668109-96668131 CAGGAAGCTCCCAATATTCATGG + Intergenic
1123400054 15:19975103-19975125 CAGGAACCTCCAAGTTCTCAGGG - Intergenic
1124021303 15:25926686-25926708 CAGGAACCTCAAGATAATTAGGG + Intergenic
1125217022 15:37286794-37286816 GAGAATCCCCCAAATAACCAGGG + Intergenic
1126372188 15:47959326-47959348 AAGGAACGCCCAAGTAAGCATGG + Intergenic
1128471955 15:67961904-67961926 CTGGAGCCCCCAGATAATCCTGG + Intergenic
1129395215 15:75240691-75240713 CAGAAAGCCCCAAATAATAGTGG - Intergenic
1131229559 15:90649870-90649892 CAGCACCCCAGAAATAATCATGG + Intergenic
1131542092 15:93283132-93283154 CAGGAACCTCTCAATATTCAAGG - Intergenic
1131728781 15:95256593-95256615 CAAGAACCCCAAAATAATAATGG - Intergenic
1132516046 16:366512-366534 CAGGTACCCCCAAAACCTCAGGG + Intergenic
1132623203 16:878015-878037 CAGGAGCCCCCAAACACACATGG + Intronic
1135180922 16:20273583-20273605 CAGAAACCCCCAAGTAATAATGG - Intergenic
1138699904 16:58851656-58851678 CCAGAACTCCCAAATATTCAAGG - Intergenic
1142903055 17:3025595-3025617 CAGGAACCACCCAATACACATGG - Intronic
1143420378 17:6786658-6786680 TAAAAACCCCCAAATCATCATGG + Intronic
1147242139 17:39097363-39097385 TAGTAAACCCCAAATGATCATGG - Intronic
1148962688 17:51406657-51406679 GAGGAACCCCCAAAAGATTAAGG + Intergenic
1149555514 17:57570826-57570848 CAGGAACCCCCATATAAGAGAGG - Intronic
1151863004 17:76779898-76779920 CAGAAACCCCCAAACAAACCTGG + Intronic
1153793356 18:8599869-8599891 GAGGAACCCCCAAATTGTAAAGG + Intergenic
1155071445 18:22320524-22320546 CAGAAACCCCCAAAAGCTCATGG + Intergenic
1156400229 18:36733067-36733089 CATGCACCCACAGATAATCAAGG + Intronic
1158443960 18:57502527-57502549 TATGAACCCCCAACTAATCAGGG - Intergenic
1160265263 18:77336407-77336429 CAGGGTCCCCCAGATAATCCAGG - Intergenic
1162303298 19:9856639-9856661 CAGTAACCCCCAAGTGACCAAGG - Intronic
1165692257 19:37872780-37872802 CAGAAACACAAAAATAATCACGG - Intergenic
1167376201 19:49113721-49113743 CATGAAGCCCCAAATCCTCAAGG + Intergenic
1168208890 19:54874362-54874384 GAGAAATCCCAAAATAATCAGGG + Intronic
926750742 2:16196837-16196859 CAGGAATACCCTAATAAACATGG + Intergenic
928375313 2:30768926-30768948 CAGGAACCCCCAAATAGCACAGG + Intronic
929422229 2:41804314-41804336 CATGAACCCCCATACAAACATGG + Intergenic
930599565 2:53427511-53427533 CAGGAACACACAACTAATTAGGG + Intergenic
931053569 2:58441642-58441664 CTGGGACCACCAAATATTCAGGG - Intergenic
932911623 2:75812115-75812137 CAGAAACCCCTAAACAATTATGG - Intergenic
933632034 2:84669909-84669931 CAAAAAACCCCAAATAGTCAAGG - Intronic
935999914 2:108817150-108817172 CAGGACCACCCACATAATCCTGG - Intronic
936988592 2:118337027-118337049 CAAAAATCCCCAAATCATCAAGG - Intergenic
938208728 2:129446361-129446383 GAGGAACCCACAAATAAAGAGGG + Intergenic
939561316 2:143735589-143735611 CAGGAACGAACAAATAATAAGGG - Intronic
946444816 2:219729036-219729058 CAGGAACTTCCCATTAATCATGG - Intergenic
947500429 2:230667257-230667279 CAGCAACCCCCAGAAACTCAGGG - Intergenic
1168814873 20:729392-729414 CAGAAACCGCATAATAATCATGG + Intergenic
1169021899 20:2336470-2336492 CAGGAAGAGCCAGATAATCATGG + Intronic
1173395672 20:42677435-42677457 CAGGAACCCTCAGAGAAACACGG + Intronic
1173406792 20:42773414-42773436 CTGAAACCCCCAAAAAATCCAGG + Intronic
1173623621 20:44455373-44455395 AAGAAAACCCCAAATAAACAAGG - Intronic
1177767905 21:25479600-25479622 CAGAAGACCCCAAATAACCAAGG - Intergenic
1178781785 21:35610347-35610369 CAGCAAACCCCAGATAATGAGGG - Intronic
1183168782 22:36168608-36168630 TAGGAACCCCCAAGTTATCTTGG - Intergenic
952590030 3:34941210-34941232 CAGTTACCTCCAAATAACCAGGG + Intergenic
953917559 3:46930426-46930448 CAGAAAGCCCCAAAAAAGCATGG - Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
957397083 3:79655559-79655581 CAGGAACCTCAAAAGAATCAAGG + Intronic
958483208 3:94671473-94671495 CATGAACCCCAAAGTAATCTTGG - Intergenic
962377818 3:134873408-134873430 CAGGAATCCCCAAACCATCTAGG - Intronic
963270648 3:143282834-143282856 CAGGAAAATCCAAATAACCATGG - Intronic
965032833 3:163395516-163395538 TACAAACCCCAAAATAATCAAGG + Intergenic
966298073 3:178446876-178446898 CAGGAACCCTCAAAGAATTAAGG + Intronic
972888259 4:43520161-43520183 CAGTAACCCAAAAATACTCATGG - Intergenic
973107256 4:46355672-46355694 CAGGAACCCCCAAATAATCAGGG + Intronic
973261183 4:48165486-48165508 AATGAACCCCCAAATCATCAGGG + Intronic
974232701 4:59137368-59137390 CAGGACCCCCCTAATAATGCAGG + Intergenic
974348901 4:60718711-60718733 CAGGAACCTCAAAATAATATGGG - Intergenic
980978587 4:139634380-139634402 CTGGAACCTCCAAATGCTCAAGG + Intergenic
991215272 5:64152582-64152604 CAGGAACATCCAAATATGCAGGG + Intergenic
992585995 5:78240485-78240507 CAAAAAGCCCCAAATCATCAAGG + Intronic
994975631 5:106800852-106800874 TAGGGTACCCCAAATAATCAGGG - Intergenic
995021222 5:107369406-107369428 CAGGATGCCTCAAATAATGAGGG + Intergenic
996243806 5:121235176-121235198 CAGGCATCACCAAGTAATCAAGG + Intergenic
997339152 5:133129031-133129053 TAGGATTCTCCAAATAATCAAGG + Intergenic
998371733 5:141666339-141666361 TAAGAACCCCCAAATAATAAAGG + Intronic
1005218521 6:23559937-23559959 CAGGAACACTCAACTAATAAGGG + Intergenic
1005338676 6:24822458-24822480 CAGTAACCCCAAAATTAACAGGG - Intronic
1014772806 6:125476137-125476159 AATGAACCCCCAAAGAAACAGGG + Intergenic
1017348490 6:153412417-153412439 CAGGAACCCCCAGGTTATCTTGG - Intergenic
1018138192 6:160799148-160799170 CAGGAGCCCCCAAGTTATCTTGG + Intergenic
1024928315 7:54641763-54641785 CAGGAACACTCAAAAAATGATGG - Intergenic
1029499760 7:100921480-100921502 CAATAGCCCCCAAATAATCAAGG + Intergenic
1030221904 7:107106773-107106795 CAGGACCCCCCTCAGAATCAAGG + Intronic
1033498021 7:141919108-141919130 CAGCAATCCCCAAAGCATCACGG - Exonic
1034854786 7:154533152-154533174 CAGGAACATCCAAAGAAACAGGG - Intronic
1037711373 8:21358105-21358127 CAGGAACCACAAAAATATCAGGG + Intergenic
1038549217 8:28451158-28451180 CAGGAAACCCCAAAGATCCAAGG + Intronic
1041005223 8:53491610-53491632 TAGGGTCCCCCAAATAATCTAGG + Intergenic
1044591899 8:93921265-93921287 CACCAACTCCCAAATAATCTTGG - Intronic
1045459483 8:102413087-102413109 AAGGATCCGCCAAATAATTAGGG - Intergenic
1046528044 8:115406872-115406894 CAGGAAGCCCAACAGAATCACGG - Intergenic
1046760965 8:118019991-118020013 GAGCAACCCCAAAATAACCAGGG - Intronic
1047983218 8:130204800-130204822 CATGAACCCCCAAATCTCCATGG - Intronic
1052687360 9:31772787-31772809 CTGGAACCTCCAAATGCTCATGG + Intergenic
1055111923 9:72568116-72568138 CAGGAATCCCCAGATAAACATGG + Intronic
1057548102 9:96032918-96032940 CAGGAACCCCCACAGAGGCATGG + Intergenic
1186326228 X:8479682-8479704 CAAGAGCTCCCAAATGATCAAGG + Intergenic
1186771616 X:12823811-12823833 CTGGAAACACCAAATAGTCAAGG - Intronic
1190280778 X:48928144-48928166 CAGGAACTTCCAAATCATTATGG + Intronic
1192611771 X:72573803-72573825 CAGGAACCTCCAAATGCTGATGG - Intergenic
1195711945 X:107780046-107780068 CAGGGACCCCTAAAAATTCAGGG - Intronic
1197862257 X:130983473-130983495 AAGGAACCCACAGATAATGAAGG - Intergenic
1199395233 X:147329718-147329740 CAGAAAACCCCAAAATATCATGG + Intergenic
1199666402 X:150099669-150099691 CAGGAACCCCAAAACTAACAAGG - Intergenic
1201400945 Y:13603167-13603189 CAGTAACCCCAAAATCATCTGGG + Intergenic
1202025957 Y:20524162-20524184 CAGGAACTCCCAGAGAAACAGGG + Intergenic