ID: 973108733

View in Genome Browser
Species Human (GRCh38)
Location 4:46373956-46373978
Sequence AATTAAGATGTCCTCTCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 180}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973108731_973108733 -1 Left 973108731 4:46373934-46373956 CCTTGCAATTCCGTTTTCTTTTA 0: 1
1: 0
2: 2
3: 27
4: 394
Right 973108733 4:46373956-46373978 AATTAAGATGTCCTCTCTTGTGG 0: 1
1: 0
2: 0
3: 18
4: 180
973108727_973108733 20 Left 973108727 4:46373913-46373935 CCTACCTGACCTGAACACCAGCC 0: 1
1: 0
2: 0
3: 16
4: 218
Right 973108733 4:46373956-46373978 AATTAAGATGTCCTCTCTTGTGG 0: 1
1: 0
2: 0
3: 18
4: 180
973108725_973108733 22 Left 973108725 4:46373911-46373933 CCCCTACCTGACCTGAACACCAG 0: 1
1: 0
2: 0
3: 8
4: 130
Right 973108733 4:46373956-46373978 AATTAAGATGTCCTCTCTTGTGG 0: 1
1: 0
2: 0
3: 18
4: 180
973108730_973108733 3 Left 973108730 4:46373930-46373952 CCAGCCTTGCAATTCCGTTTTCT 0: 1
1: 0
2: 1
3: 17
4: 222
Right 973108733 4:46373956-46373978 AATTAAGATGTCCTCTCTTGTGG 0: 1
1: 0
2: 0
3: 18
4: 180
973108724_973108733 23 Left 973108724 4:46373910-46373932 CCCCCTACCTGACCTGAACACCA 0: 1
1: 0
2: 0
3: 13
4: 220
Right 973108733 4:46373956-46373978 AATTAAGATGTCCTCTCTTGTGG 0: 1
1: 0
2: 0
3: 18
4: 180
973108728_973108733 16 Left 973108728 4:46373917-46373939 CCTGACCTGAACACCAGCCTTGC 0: 1
1: 0
2: 3
3: 23
4: 276
Right 973108733 4:46373956-46373978 AATTAAGATGTCCTCTCTTGTGG 0: 1
1: 0
2: 0
3: 18
4: 180
973108723_973108733 24 Left 973108723 4:46373909-46373931 CCCCCCTACCTGACCTGAACACC 0: 1
1: 0
2: 2
3: 29
4: 263
Right 973108733 4:46373956-46373978 AATTAAGATGTCCTCTCTTGTGG 0: 1
1: 0
2: 0
3: 18
4: 180
973108729_973108733 11 Left 973108729 4:46373922-46373944 CCTGAACACCAGCCTTGCAATTC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 973108733 4:46373956-46373978 AATTAAGATGTCCTCTCTTGTGG 0: 1
1: 0
2: 0
3: 18
4: 180
973108726_973108733 21 Left 973108726 4:46373912-46373934 CCCTACCTGACCTGAACACCAGC 0: 1
1: 0
2: 4
3: 8
4: 155
Right 973108733 4:46373956-46373978 AATTAAGATGTCCTCTCTTGTGG 0: 1
1: 0
2: 0
3: 18
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973108733 Original CRISPR AATTAAGATGTCCTCTCTTG TGG Intronic
904495893 1:30886400-30886422 AATTAGGAAGTCCTTTCTTGGGG + Intronic
905810472 1:40909073-40909095 AATTAATATGTCTTGTTTTGTGG - Intergenic
906357434 1:45119055-45119077 AGTTAAAATGTCATCTCTTTAGG - Intronic
908161727 1:61415713-61415735 AACTAAAATGTCCTCTGTAGAGG - Intronic
908285547 1:62594890-62594912 AATTAAGCTGTCAGCTTTTGTGG - Intronic
908526700 1:64994701-64994723 AATTAAAATGTGTTCTGTTGCGG - Intergenic
908900860 1:68954920-68954942 AATTAAAAAGTCCTCTCTTCAGG + Intergenic
910073557 1:83248424-83248446 AACTTAAATGTCCTCTCTGGAGG + Intergenic
913938411 1:125079055-125079077 TATTAATATGACCTCTCTTAGGG - Intergenic
913944424 1:125144996-125145018 TATTAATATGACCTCTCTTAAGG + Intergenic
918546068 1:185685350-185685372 AATTAGGATTTGCACTCTTGGGG - Intergenic
919492293 1:198219911-198219933 AATTAATATGTGCTTTTTTGGGG + Intronic
920027724 1:203013018-203013040 TATTAAAATTTCCTCTATTGTGG - Intronic
920801294 1:209190267-209190289 TATTACGATGTCCTATCTTCTGG - Intergenic
921303689 1:213774206-213774228 AATTAATATAACCTCTGTTGTGG + Intergenic
1064574742 10:16733039-16733061 ATTTAAGATGACCTATCTTAGGG + Intronic
1065488304 10:26255571-26255593 AATTCACATTTCCTCTCTAGTGG - Intronic
1066950039 10:42108531-42108553 TATTAATATGACCTCTCTTAGGG - Intergenic
1068336306 10:55636331-55636353 AATTAAGATGTCCTTTCATTGGG + Intergenic
1068763181 10:60734214-60734236 AAGTGAGATGTCCTCCCTTTAGG - Intergenic
1070309437 10:75262707-75262729 AATTAGGCTGTCCCCTTTTGAGG + Intergenic
1072231107 10:93414689-93414711 AAAAAAGATGGCCTCTCTAGTGG - Intronic
1073538793 10:104301267-104301289 AATGAAGGTGTTCTCTTTTGGGG + Intronic
1075456663 10:122589281-122589303 AATTTTGGTTTCCTCTCTTGGGG + Intronic
1076200153 10:128551585-128551607 CATTCAGAAGTCCTCTCTTGTGG + Intergenic
1079302368 11:19289581-19289603 AATAATGATGTCCTCTCTTAGGG - Intergenic
1081160739 11:39744690-39744712 AATTAAGATGTCCACTATTTAGG + Intergenic
1081816987 11:45951779-45951801 AAAAAAAATGTCCTCTCTTGTGG + Intronic
1086856833 11:91875693-91875715 TATTAAGATATACTCTCTTATGG - Intergenic
1087949020 11:104197260-104197282 AATAAAAATGTTTTCTCTTGAGG + Intergenic
1090126913 11:124095977-124095999 ATTTAAAATGTCCTGTATTGAGG - Intergenic
1092508297 12:9126797-9126819 AATTAAGGCGTCCTCACTGGTGG - Intergenic
1094229997 12:28092115-28092137 ATAAAAGATGTCCTCTCTTGAGG - Intergenic
1095276182 12:40285487-40285509 ATTTAAATTGTCCTCTTTTGAGG + Intronic
1095547986 12:43395057-43395079 ATTTAAAATGGCCTTTCTTGGGG - Intronic
1096738013 12:53671291-53671313 AATCAAAATATCATCTCTTGGGG + Intronic
1098507926 12:71276230-71276252 AATAAATATGTTCTCTCTTAAGG + Intronic
1099797868 12:87421560-87421582 AATTAGGGTGTCCTGTTTTGAGG - Intergenic
1100688654 12:97014471-97014493 AACTAAGATGTCTTCATTTGGGG - Intergenic
1103059835 12:117849574-117849596 AGTTAAGATTTCCTATCTTCGGG + Intronic
1106150976 13:27101832-27101854 AACTAAAATTTCCTCACTTGAGG + Intronic
1111023711 13:82490295-82490317 AATAAGGATATCATCTCTTGAGG - Intergenic
1111343700 13:86921723-86921745 AATAAACATGTCCTGTGTTGTGG - Intergenic
1112361969 13:98726691-98726713 ATGTGAGATGTCCTCTCCTGAGG - Intronic
1115226567 14:31109156-31109178 AAAGAAGATCTCCACTCTTGAGG - Intronic
1115749727 14:36477343-36477365 AATCTAGATGGGCTCTCTTGTGG + Intronic
1115756444 14:36531011-36531033 CATGAAGATGTACTCTTTTGAGG + Intergenic
1117838163 14:59829210-59829232 GAATAAGATGTACTCTCTTAGGG + Intronic
1120421760 14:84295617-84295639 AATTTAAATATCCTCTCTTCAGG - Intergenic
1121995814 14:98602135-98602157 ACTTCAGATGTCATCTCTTCTGG + Intergenic
1124185399 15:27522118-27522140 AATAAAAATGTCCTGTCATGTGG + Intronic
1124501976 15:30236479-30236501 AAAGGAGATGCCCTCTCTTGGGG - Intergenic
1124741588 15:32302173-32302195 AAAGGAGATGCCCTCTCTTGGGG + Intergenic
1124839522 15:33228829-33228851 GATGAAGATATCCCCTCTTGGGG - Intergenic
1126205360 15:46038970-46038992 AATTGAGATGTCCTGGCTTCTGG + Intergenic
1128137616 15:65275638-65275660 ATTTGAGATGACCTCACTTGAGG - Intronic
1128913891 15:71542320-71542342 AATTAAGATCTCCTTCCTGGAGG - Intronic
1129273203 15:74430147-74430169 AATGAATATGTCCACCCTTGAGG + Intronic
1130832338 15:87614164-87614186 AATTATGATTTCTTCTTTTGTGG - Intergenic
1131794083 15:95995449-95995471 AATTGAGATGGCCTCTTTTCGGG - Intergenic
1136935434 16:34459035-34459057 TATTAATATGACCTCTCTTAGGG - Intergenic
1136938269 16:34496670-34496692 TATTAATATGACCTCTCTTAGGG - Intergenic
1136946256 16:34654908-34654930 TATTAATATGACCTCTCTTAGGG + Intergenic
1136949103 16:34693468-34693490 TATTAATATGACCTCTCTTAGGG + Intergenic
1136961549 16:34851887-34851909 TATTAATATGACCTCTCTTAGGG + Intergenic
1136964384 16:34889535-34889557 TATTAATATGACCTCTCTTAGGG + Intergenic
1136968528 16:34944229-34944251 TATTAATATGACCTCTCTTACGG + Intergenic
1137093522 16:36224001-36224023 TATTAATATGACCTCTCTTAGGG + Intergenic
1137218513 16:46424575-46424597 TATTAATATGACCTCTCTTAGGG - Intergenic
1137581144 16:49634361-49634383 ATTCAAGTTGTCCTCTCTTCAGG + Intronic
1138226854 16:55303306-55303328 AATTAAGCAGATCTCTCTTGTGG + Intergenic
1138331222 16:56217028-56217050 AATAAAGATGTCCTCTCTCAAGG - Intronic
1138609019 16:58108325-58108347 AATAAAAATGTTATCTCTTGGGG + Intergenic
1139394456 16:66629442-66629464 AAATAACAAGTCCTGTCTTGTGG - Intronic
1139528947 16:67532560-67532582 AAATGAGATCTCCTCTCATGAGG - Intronic
1141982606 16:87559824-87559846 AATCCAGATGTTCTCTCCTGGGG - Intergenic
1148150255 17:45392845-45392867 ATTTATGATGTTCTCTCTAGAGG + Intergenic
1152036445 17:77876027-77876049 TCTTAAAATGTGCTCTCTTGGGG + Intergenic
1154515667 18:15162601-15162623 TATTAATATGACCTCTCTTAGGG - Intergenic
1154950361 18:21203837-21203859 AAATAAGATATACTTTCTTGAGG - Intergenic
1155712995 18:28905637-28905659 AAGGAAGATATCCTCTCTGGTGG - Intergenic
1158065964 18:53408694-53408716 AATCAACATATCCTGTCTTGGGG + Intronic
1158458707 18:57629526-57629548 AATTCAGGAGGCCTCTCTTGGGG + Intergenic
1158865488 18:61634436-61634458 GATCAAGATGTTCTCTCTTAGGG + Intergenic
1164740572 19:30572644-30572666 AATCAAGATGACATCTCTCGTGG + Intronic
1164908857 19:31989396-31989418 CATTGAGATGTCCTCTCTGGAGG - Intergenic
1165124193 19:33582355-33582377 AATTGAGAAGTCCCTTCTTGGGG - Intergenic
1165541610 19:36496737-36496759 ACTGAAGATGTCGTCTCTTATGG - Intergenic
926490012 2:13513741-13513763 AAATAAAATGTCCTCTATTGAGG + Intergenic
930814726 2:55583252-55583274 AATTAATTTATCTTCTCTTGTGG + Intronic
931238621 2:60433057-60433079 AATTCAGATGCCCTCTTTTGAGG - Intergenic
932890157 2:75587845-75587867 AATTAAAATGTTCTCTTTAGGGG - Intergenic
933630502 2:84651133-84651155 AATAAAGCTGTCTTCCCTTGTGG - Intronic
934332045 2:92077581-92077603 TATTAATATGACCTCTCTTAGGG + Intergenic
936839057 2:116747738-116747760 AATTAACAGTTCCTCTCTTATGG + Intergenic
941014674 2:160341598-160341620 AATTAAGATTTATTTTCTTGTGG - Intronic
941808305 2:169732273-169732295 AATTAAGATGATCTGACTTGTGG + Intronic
942244083 2:173991245-173991267 AATAAAGAAGTCCCCTCTTGGGG + Intergenic
946453026 2:219797529-219797551 ATTTAACATGTCCTCTGTTGGGG + Intergenic
946636793 2:221737915-221737937 AGTAAAAATGTCTTCTCTTGGGG + Intergenic
1170541484 20:17392906-17392928 AATTTAGATGTCCTCTGTCTTGG + Intronic
1173476142 20:43361142-43361164 TTTTAAGATGACCTCTGTTGAGG - Intergenic
1175186650 20:57183551-57183573 AATTAAGATGTCCTGTGTAGGGG + Intronic
1177026061 21:15923184-15923206 AATTAGGATGTCATATCTTTGGG - Intergenic
1177035294 21:16035443-16035465 AATAAACATGTCCTCTTTTAAGG - Intergenic
1177975474 21:27844558-27844580 TATTAATATGACCTCTCTTAGGG + Intergenic
1178689070 21:34736112-34736134 AATAAAGATGTCTTGTCTTTGGG + Intergenic
1180525638 22:16256978-16257000 TATTAATATGACCTCTCTTAGGG + Intergenic
1180527221 22:16303716-16303738 TATTAATATGACCTCTCTTAGGG + Intergenic
1203322733 22_KI270737v1_random:83937-83959 TATTAATATGACCTCTCTTAGGG - Intergenic
949812425 3:8020539-8020561 AATTAAGCTTTTCTCTCTGGTGG - Intergenic
952155873 3:30643010-30643032 ATTTAAGATTTGCTTTCTTGTGG - Intronic
953590696 3:44250185-44250207 ACTCTAGAAGTCCTCTCTTGGGG - Intronic
959311061 3:104738055-104738077 AATTAAGATCTTTTCTCTTCTGG - Intergenic
964553582 3:157911525-157911547 AATCAAGATGCCCTCTCATTTGG + Intergenic
966237090 3:177713904-177713926 AAATTAGATGTCATATCTTGAGG - Intergenic
966854976 3:184187589-184187611 ACTCGAGATGTTCTCTCTTGGGG + Intronic
967690663 3:192470078-192470100 AATTCCAATGTCCTCTCTGGAGG + Intronic
971904229 4:32705108-32705130 AATTTTGATGTCCTCCCTTAAGG - Intergenic
972076564 4:35096837-35096859 CAGTAAGATGTCATCTCTTGCGG - Intergenic
973020367 4:45198236-45198258 AATTATTTTGTCCTCTCTTTAGG - Intergenic
973108733 4:46373956-46373978 AATTAAGATGTCCTCTCTTGTGG + Intronic
976983589 4:91264181-91264203 AATTAATTTGTGCTCTCCTGAGG - Intronic
978336990 4:107679786-107679808 AGTTAAAAAGTCCTATCTTGAGG - Intronic
979211213 4:118106090-118106112 TATTTGGATATCCTCTCTTGAGG + Intronic
980386562 4:132092987-132093009 AACAGAGATGGCCTCTCTTGAGG - Intergenic
983029488 4:162781750-162781772 AATTAAAATGTCCTTTCCTTTGG - Intergenic
984385405 4:179049471-179049493 AATTAAGAAGTCATCATTTGAGG + Intergenic
984602954 4:181750238-181750260 AATTCTGCTCTCCTCTCTTGAGG - Intergenic
985539444 5:481292-481314 AATAGAGATGCCCTCTCATGTGG - Intronic
985668612 5:1195077-1195099 CAGAAAGATGTCCTCCCTTGAGG - Intergenic
988632610 5:32946970-32946992 AATTCAGATGTCCTTTCTGGAGG - Intergenic
989815206 5:45728228-45728250 GATCAAAATGTCCTCTTTTGAGG + Intergenic
989992829 5:50788705-50788727 CATGATGATTTCCTCTCTTGAGG - Intronic
991945217 5:71892879-71892901 ATTTATGATCTCCTCTCTTTGGG + Intergenic
993640219 5:90393650-90393672 ATTTAAGAAATCCACTCTTGAGG + Exonic
996742365 5:126812662-126812684 AAACAAGATTTCCTCCCTTGAGG - Intronic
997203312 5:132026026-132026048 AGTTCAGATGTCCTCTCCTCAGG + Intergenic
998757695 5:145398859-145398881 AGCTAAAATGTCCCCTCTTGAGG - Intergenic
1000377805 5:160599742-160599764 ACTCAAGATCTCCTCTCTTGTGG + Intronic
1003319857 6:5041406-5041428 AAATAAGATGTTCTCTCTAAAGG + Intergenic
1010011157 6:71050067-71050089 AGTTAACATTTCCTATCTTGGGG + Intergenic
1012500921 6:99887316-99887338 TTTTCAAATGTCCTCTCTTGTGG + Intergenic
1012574590 6:100777602-100777624 AACTCAGATCACCTCTCTTGAGG - Intronic
1014859319 6:126445135-126445157 AAATAAAGTGTCCTCTCTAGTGG - Intergenic
1015594684 6:134855187-134855209 AATCAGGATTTTCTCTCTTGGGG + Intergenic
1015921748 6:138273391-138273413 AATTAAGATGTGCTTTACTGTGG - Intronic
1016177189 6:141095632-141095654 AATTAAGATATGCTTTATTGAGG + Intergenic
1016752371 6:147645156-147645178 CAGTAAGATGTCCTGTCGTGTGG - Intronic
1017715885 6:157212824-157212846 AATTAAGATGTCCTCATGGGAGG + Intergenic
1018085228 6:160295733-160295755 AACTAATATGTGCTCTCTTTTGG - Intergenic
1018266749 6:162032515-162032537 AATTATTTTGTCCTCTCTAGAGG - Intronic
1019115669 6:169760040-169760062 CATTAAGAGGTGCACTCTTGAGG + Intronic
1022185788 7:27967136-27967158 AATAAAGCTGTCCTCATTTGAGG + Intronic
1022302113 7:29111522-29111544 AAATAAGAAGCCCTCTCTAGGGG + Intronic
1024465151 7:49704227-49704249 AATTAAGGTTTCCTCTGTTATGG - Intergenic
1025321825 7:58102602-58102624 TATTAACATGACCTCTCTTAGGG + Intergenic
1025474965 7:60907885-60907907 TATTAATATGACCTCTCTTAGGG + Intergenic
1025487935 7:61075106-61075128 TATTAATATGACCTCTCTTAGGG - Intergenic
1025512038 7:61581989-61582011 TATTAATATGACCTCTCTTAGGG - Intergenic
1025556588 7:62317020-62317042 TATTAATATGACCTCTCTTAGGG - Intergenic
1025563335 7:62399251-62399273 TATTAATATGTACTCTCTTAGGG + Intergenic
1027291241 7:76713298-76713320 AACTCAAATGTCCTCTCTGGAGG + Intergenic
1027799848 7:82737166-82737188 AAATGAGATGTCCTCTTCTGTGG + Intergenic
1030933458 7:115554759-115554781 ACTTAAGGTGGACTCTCTTGTGG + Intergenic
1037443119 8:18937716-18937738 AATTAATATTTCCTCTCTATTGG - Intronic
1038017019 8:23523956-23523978 AATGCAGATGTCAGCTCTTGCGG + Intergenic
1038709786 8:29932918-29932940 AATAAAGATGTCCTTTCCAGTGG + Intergenic
1039419396 8:37423190-37423212 ATTTAAGATCTACTCTCTTAGGG - Intergenic
1039944763 8:42119732-42119754 CACTAAAATGGCCTCTCTTGGGG - Intergenic
1041669046 8:60474935-60474957 CATGAAGTTGTCCTGTCTTGAGG - Intergenic
1042762225 8:72283315-72283337 AATTAGGATTTCCACTCCTGAGG + Intergenic
1044285343 8:90405453-90405475 TATTTAGATATCCTCTTTTGTGG - Intergenic
1044607644 8:94061129-94061151 TACTAAGATCTCCTCTATTGTGG + Intergenic
1046009647 8:108530594-108530616 AATTATGATGTTCTCACATGAGG - Intergenic
1046101618 8:109620933-109620955 AATTAAGAGAGGCTCTCTTGAGG - Intronic
1048046598 8:130778717-130778739 AGTGAAGCTGTCTTCTCTTGAGG - Intergenic
1051634448 9:19168892-19168914 ATTTAAGAAGACCTCTCTTTTGG - Intergenic
1052494343 9:29208909-29208931 AACTAGGATCTTCTCTCTTGAGG + Intergenic
1052655032 9:31348011-31348033 ACATAATATGTCATCTCTTGAGG - Intergenic
1053650994 9:40169688-40169710 ACCTAAAATGTCCTCTTTTGGGG + Intergenic
1053833212 9:42106548-42106570 AATCAAGAAAGCCTCTCTTGTGG - Intronic
1053901381 9:42799041-42799063 ACCTAAAATGTCCTCTTTTGGGG + Intergenic
1053946557 9:43315004-43315026 TATTAATATGACCTCTCTTAGGG + Intergenic
1054533586 9:66206515-66206537 ACCTAAAATGTCCTCTTTTGGGG - Intergenic
1054597339 9:67080861-67080883 AATCAAGAAAGCCTCTCTTGTGG + Intergenic
1055031593 9:71775735-71775757 GATTAAGATTTCCTGTGTTGAGG + Intronic
1058732110 9:107860280-107860302 AATGAAGAGCTCCTCTCTTAAGG - Intergenic
1058849108 9:108993323-108993345 ATTGAAGATGTCATCCCTTGGGG - Intronic
1060029325 9:120200802-120200824 AATGCAGATGTCCTCTACTGGGG - Intergenic
1061498161 9:130987340-130987362 AGTTAAAATGTCCCATCTTGAGG - Intergenic
1203589687 Un_KI270747v1:43562-43584 TATTAATATGACCTCTCTTAGGG + Intergenic
1187452813 X:19413659-19413681 TATTGAGATGCCATCTCTTGGGG + Intronic
1187470355 X:19564147-19564169 AATTCAGATCTCCTGACTTGGGG - Intronic
1190757468 X:53413383-53413405 AATAGAGCTGTCCTCTCTTTGGG + Exonic
1191724129 X:64260906-64260928 AATTATGATGTCTTCTTTTTTGG + Intergenic
1194583865 X:95709479-95709501 CATGAAGATGTTCTCTCTTTAGG + Intergenic
1200294706 X:154907663-154907685 CATTTGGATGTCCTCTTTTGTGG + Intronic
1200312538 X:155093273-155093295 AAATAAGATTTCCTCTCTCCAGG - Intronic