ID: 973110543

View in Genome Browser
Species Human (GRCh38)
Location 4:46391414-46391436
Sequence TTAGAAAAACTGCACCATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973110543_973110546 28 Left 973110543 4:46391414-46391436 CCTAGATGGTGCAGTTTTTCTAA 0: 1
1: 0
2: 0
3: 18
4: 208
Right 973110546 4:46391465-46391487 AGCTTTGCTTTGAAGATTATGGG 0: 1
1: 0
2: 0
3: 20
4: 254
973110543_973110545 27 Left 973110543 4:46391414-46391436 CCTAGATGGTGCAGTTTTTCTAA 0: 1
1: 0
2: 0
3: 18
4: 208
Right 973110545 4:46391464-46391486 TAGCTTTGCTTTGAAGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973110543 Original CRISPR TTAGAAAAACTGCACCATCT AGG (reversed) Intronic
901149462 1:7091379-7091401 TTTGAAAAACTGCAAGATCTGGG - Intronic
903097018 1:20986532-20986554 TTAGAAAACCTGACCCATCCTGG + Intronic
904105466 1:28077978-28078000 TTAGAAGAACTGTAAAATCTAGG + Intronic
905852231 1:41282875-41282897 CTGGGAAAACTGCACCACCTAGG - Intergenic
908145631 1:61238769-61238791 TCAGAAAAACTCCAGCATGTAGG - Intronic
910894304 1:92051692-92051714 TTAGTAAAACTGGACCAAGTAGG - Intronic
911953284 1:104204392-104204414 TTAGAATATCTTAACCATCTGGG + Intergenic
914379353 1:147102641-147102663 TGAGATAAAGAGCACCATCTGGG - Intergenic
917230583 1:172833154-172833176 TTAGAAAAACTACATGATATGGG + Intergenic
917441266 1:175071090-175071112 TTAGAAAAAGTGTATCATCATGG - Intronic
921242692 1:213202313-213202335 TTAAAAAAACTACAGCAGCTGGG + Intronic
921725343 1:218517150-218517172 TTAGTAAATCTGAACCACCTGGG + Intergenic
923944048 1:238862550-238862572 TTAGAGAAAATTCACCAGCTGGG - Intergenic
924668059 1:246094147-246094169 TCACAAACACTGCATCATCTTGG - Intronic
1064210124 10:13354570-13354592 TTAGAATGACTTAACCATCTGGG + Intergenic
1064333712 10:14418524-14418546 TTAGAAGACCTTAACCATCTGGG - Intronic
1064929734 10:20611917-20611939 TAAAAACAAATGCACCATCTTGG + Intergenic
1067472762 10:46548397-46548419 TTCCACAAACTGCACCAGCTGGG + Intergenic
1070274598 10:74993473-74993495 GTAGAAAAACTGCAATATTTAGG - Intronic
1070415847 10:76188544-76188566 TTAGACACATTCCACCATCTGGG - Intronic
1071411607 10:85402524-85402546 TTAGAAAAAAAGCAGCATGTTGG + Intergenic
1072755076 10:98014331-98014353 TGAGAAACACTGCTCAATCTTGG + Intronic
1078730308 11:13967691-13967713 TTTTAAAAACTCCACCATCCAGG - Intronic
1080397031 11:31899558-31899580 TTACAAAGGCTGCACAATCTGGG + Intronic
1080697434 11:34615024-34615046 TTAGAAAAACTCCATCAGATAGG - Intergenic
1082284882 11:50307491-50307513 TTAGAAAGCCTTAACCATCTGGG + Intergenic
1085218520 11:74852764-74852786 CTGGAAAAGCTGGACCATCTTGG + Intronic
1086232618 11:84588752-84588774 CTAGAAAAAGTTTACCATCTTGG - Intronic
1088102498 11:106170733-106170755 TTAGAAAACCTTAACGATCTGGG - Intergenic
1089883462 11:121796890-121796912 TTAGAACACCTTAACCATCTGGG - Intergenic
1090342301 11:126034988-126035010 TTTGAAAAAGTGCCCCATATAGG + Intronic
1092354913 12:7786787-7786809 TTAGAACACCTTAACCATCTGGG + Intergenic
1092367622 12:7890115-7890137 TTAGAACATCTTAACCATCTGGG + Intronic
1092719475 12:11426542-11426564 TTAGAAAAACTGAACCAGAGAGG - Intronic
1092815594 12:12310007-12310029 TTAAAAAAACTCCACCAGCCGGG - Intergenic
1093134282 12:15431736-15431758 TTAGAAAAACTGCAAAATTTTGG + Intronic
1093190836 12:16073327-16073349 TTAAATAAACTGCCCCATTTTGG - Intergenic
1093274740 12:17110635-17110657 GTACAAAAACTGTATCATCTTGG - Intergenic
1093857271 12:24121015-24121037 AGAGAAAAACAGCACCAACTAGG + Intergenic
1094100464 12:26756871-26756893 TTAGAATGCCTGAACCATCTGGG - Intronic
1097754138 12:63390254-63390276 GTGGAAAAATCGCACCATCTGGG + Intergenic
1098154719 12:67585875-67585897 TTAGAATAACCACACCTTCTAGG + Intergenic
1101257015 12:102988701-102988723 TTAGAGAACCAGCACCATCTGGG - Intergenic
1101364740 12:104061408-104061430 TTAGAAAAAAACTACCATCTAGG + Intronic
1102167613 12:110819270-110819292 TTAGAATACCTTAACCATCTAGG + Intergenic
1102777775 12:115535491-115535513 TGAGAAATCCTGCTCCATCTAGG - Intergenic
1104640480 12:130463772-130463794 TTAGAATGCCTTCACCATCTGGG - Intronic
1104671485 12:130683550-130683572 TTAGAATGCCTTCACCATCTGGG - Intronic
1108127547 13:47260984-47261006 TTAGAAAAACAGCCCCATACAGG + Intergenic
1108161285 13:47642521-47642543 TTAGAAAACCTGTAACAACTTGG - Intergenic
1112716433 13:102191385-102191407 TTACAAAAACTTCACCATGCTGG - Intronic
1114584258 14:23795394-23795416 TTAGAATGACTTAACCATCTGGG + Intergenic
1115672268 14:35627416-35627438 TTAGAGAAACTGTACCAACTTGG - Exonic
1117385642 14:55209497-55209519 TTAGAATAATTGCAGAATCTGGG - Intergenic
1118497585 14:66324066-66324088 TTAGAAATAATGCAAAATCTTGG - Intergenic
1119915848 14:78401029-78401051 TTAGCAAGAAGGCACCATCTTGG - Intronic
1120660396 14:87241552-87241574 CTAGAATAACTGCTTCATCTTGG - Intergenic
1120865838 14:89294527-89294549 TTAGAATGCCTTCACCATCTGGG - Intronic
1120933218 14:89869283-89869305 TTAGAAAATATTAACCATCTTGG + Intronic
1122015605 14:98793099-98793121 AAAGAAAAACTCCACCAGCTTGG + Intergenic
1125657919 15:41373391-41373413 TAAAAAAAACTACACCATCCTGG + Intronic
1126329622 15:47518088-47518110 TTAGGACAACTGCAGCTTCTAGG + Intronic
1126640858 15:50825319-50825341 TTAGAAAGAGAGCAGCATCTAGG - Intergenic
1130106680 15:80933668-80933690 TTAGAAAAAAAGAACCCTCTGGG + Intronic
1130891894 15:88140414-88140436 TTAGAAAAGATGCCCCATCTGGG - Intronic
1132336814 15:101053100-101053122 TGAGAAAAACAGCACCAACCTGG - Intronic
1133447062 16:5870596-5870618 TAAAAAAAACTGTTCCATCTGGG - Intergenic
1135243948 16:20838060-20838082 TTAAAAAAACAGCAACAGCTGGG - Intronic
1138783911 16:59822823-59822845 TAATAAAAACTTTACCATCTTGG + Intergenic
1138851624 16:60636300-60636322 TTAGAATGACTTAACCATCTGGG - Intergenic
1140335153 16:74098048-74098070 TTAGAATACCTTAACCATCTGGG - Intergenic
1140973780 16:80039756-80039778 TAACAGAAACTCCACCATCTTGG + Intergenic
1141917612 16:87110578-87110600 TTAGAATATCTTAACCATCTGGG + Intronic
1142519115 17:492752-492774 TTAGAATGCCTTCACCATCTGGG + Intergenic
1143063610 17:4224431-4224453 TTAAAAAAACTTCACCATCCTGG - Intronic
1145104541 17:20104152-20104174 TCAGAAAAACTGCACCATTAAGG - Intronic
1148257854 17:46151973-46151995 TGAGAAAAAATACACCCTCTGGG - Intronic
1148527210 17:48351056-48351078 TTAGCAAAACTGCAGCTTATTGG + Intronic
1149078583 17:52627562-52627584 TTAAAAAAACTTCATGATCTTGG - Intergenic
1149980831 17:61309950-61309972 TTTGAAAAACTACAGCATTTAGG + Intronic
1150579262 17:66457360-66457382 TTAGAAGAACTGAGCCATCTAGG - Intronic
1150652493 17:67019029-67019051 ATAGAAAAATTGCACCATTTTGG + Intronic
1156362990 18:36400652-36400674 TGAGAAGAACTCCACCCTCTTGG - Intronic
1156447900 18:37250459-37250481 TTAGAAAGCCTGCACCACCATGG + Intronic
1156670992 18:39469446-39469468 TGTGAAAAACTTCACCATCCTGG - Intergenic
1158066874 18:53420949-53420971 GTAGAAAGACTGCACACTCTAGG - Intronic
1159306531 18:66650472-66650494 GTAGCAACACGGCACCATCTTGG + Intergenic
1159602899 18:70445665-70445687 TTAGAATACCTTAACCATCTGGG - Intergenic
1160090700 18:75824133-75824155 TTAGAAAATCAACACCATGTTGG + Intergenic
1160185305 18:76671984-76672006 TTAGAATACCTTAACCATCTGGG - Intergenic
1164860648 19:31559649-31559671 TTAGAACAATTTCTCCATCTTGG - Intergenic
1165528649 19:36378359-36378381 TTACAACTACTGCACCACCTGGG + Intronic
1167832689 19:52038955-52038977 TTGGAAAAACTGGACACTCTAGG + Intronic
1168656208 19:58130371-58130393 TTATAAAAACTGGATCATGTCGG + Intronic
926998759 2:18769950-18769972 TTAGAAAAATTACACCAACATGG - Intergenic
927662181 2:25002339-25002361 TAAGATAAACTGCACCCTCCAGG - Intergenic
928459537 2:31457773-31457795 TCAGAAAAAGTGAAGCATCTTGG + Intergenic
928729929 2:34219909-34219931 AAAGAAAAACTTCCCCATCTAGG - Intergenic
929355563 2:41019600-41019622 TTAGAAAACATGGACCATCTAGG + Intergenic
930050640 2:47213426-47213448 TTAGAAAGACTATACCAGCTGGG + Intergenic
930891492 2:56393405-56393427 TTTAAAAAACTCCACCAACTAGG - Intergenic
931054429 2:58453113-58453135 TTAGAAAAACTGCTCCTCCCTGG + Intergenic
934029593 2:88030763-88030785 GTAGAATAACTGCATCATATGGG - Intronic
936665469 2:114589816-114589838 TGAGAAAAACTCCAACCTCTTGG + Intronic
939787077 2:146528655-146528677 TAACCAAAACTGTACCATCTAGG - Intergenic
942811210 2:180003319-180003341 TTAAAAGAACTGCACCTTCAGGG - Intronic
943283248 2:185964503-185964525 TTCTAAAAACTGCACTATCTTGG - Intergenic
943311594 2:186332551-186332573 AAAGATAAACTGCAGCATCTTGG - Intergenic
943799806 2:192043822-192043844 CTGGAAAGACTGCACCATCAAGG + Intronic
943907657 2:193520071-193520093 TTAGGAAAACTGTTCAATCTAGG + Intergenic
944529554 2:200653715-200653737 TTGTAAAAAATGCAGCATCTAGG - Intronic
944903003 2:204234912-204234934 GTAGAAAACCTGCATCATGTTGG + Intergenic
945878971 2:215307194-215307216 TTAATAAAGCTGCATCATCTTGG - Intergenic
945896561 2:215489193-215489215 TAAGGAAAACTGAACTATCTTGG - Intergenic
946911635 2:224467409-224467431 GTAGAAACACTGCATCATCTAGG + Intergenic
1169736480 20:8843166-8843188 TTAGAAAACCTACAAAATCTGGG + Intronic
1173861204 20:46284849-46284871 CTAGTAAAGCTGCACTATCTCGG - Intronic
1174309266 20:49637882-49637904 TGAGCAAAATTGCACCAGCTTGG + Intronic
1174373448 20:50110028-50110050 TTATAAAAACTTAACCATGTGGG - Intronic
1174884576 20:54318492-54318514 TTCCAAAATCTGGACCATCTTGG - Intergenic
1175097351 20:56552105-56552127 TTAGAATGCCTTCACCATCTGGG - Intergenic
1177247561 21:18549068-18549090 TTAGAAAAACTACTACATTTAGG + Intergenic
1177584335 21:23070195-23070217 TTAGAGAAACTGCACATGCTAGG + Intergenic
1178823962 21:35999771-35999793 TTGTTAAAACTGCACCATCTAGG + Intronic
1184611938 22:45609666-45609688 TTAGAGAAACAGCAGCAACTTGG + Intergenic
1185296104 22:50055901-50055923 TTAGAATGCCTTCACCATCTGGG - Intronic
949904334 3:8846049-8846071 TTAGAAAAACCTCACTTTCTTGG - Intronic
955804164 3:62716843-62716865 GTAGAAAAACTGTTCCATTTGGG - Intronic
956020520 3:64928693-64928715 TTAGAAAAACTCCCCCACGTTGG - Intergenic
956950837 3:74280414-74280436 TGAGAAAAACTGGACCAGCCTGG - Intronic
958990602 3:100839703-100839725 TCAGAAAAAATGCATCATTTAGG - Intronic
959548468 3:107625733-107625755 ATATAAAAACTTCACCATATAGG + Intronic
959882684 3:111463551-111463573 TTATAAAAACTGAAAGATCTTGG + Intronic
960729167 3:120705738-120705760 AGAGAAAACCTGCATCATCTAGG + Intronic
961310526 3:125996517-125996539 TTAGGAAAAGTGCAGTATCTGGG - Intergenic
961993570 3:131217580-131217602 TTAGCATAAATGTACCATCTAGG - Intronic
963810205 3:149768841-149768863 TCAGAAAACCTGCCCCATGTTGG - Intronic
965010719 3:163085908-163085930 TTAGAATTGCTACACCATCTTGG + Intergenic
966009542 3:175057536-175057558 TTATAAGCCCTGCACCATCTGGG + Intronic
967012509 3:185449756-185449778 TAAGAAAAACAGAAACATCTGGG - Intronic
967619540 3:191616312-191616334 TTAGAAAAACAGCTGGATCTCGG + Intergenic
968081403 3:195849100-195849122 TTAGAATGCCTTCACCATCTGGG + Intergenic
971763902 4:30804611-30804633 GCAGAAACAATGCACCATCTTGG + Intronic
971969764 4:33606042-33606064 GTAGCAACACTGCACCTTCTTGG + Intergenic
972968375 4:44541470-44541492 TTAGAGAAAATGAACCATCATGG + Intergenic
973110543 4:46391414-46391436 TTAGAAAAACTGCACCATCTAGG - Intronic
975528330 4:75375299-75375321 TTAGAATACCTTAACCATCTGGG - Intergenic
976800135 4:88980976-88980998 TAAGAAAAAATGTAACATCTTGG + Intronic
977041239 4:92022055-92022077 TTAAAAAAACAGAACCATATTGG - Intergenic
977500211 4:97828355-97828377 TTAGAAAAAGTGCAGTGTCTGGG - Intronic
979841810 4:125451319-125451341 TAAGAAAACCTGCTCCAGCTGGG - Exonic
981522131 4:145673954-145673976 TAAGAAATGCTGCACAATCTAGG + Intergenic
982649665 4:158072014-158072036 TTAGAAAAAGAGGAGCATCTTGG + Intergenic
982675729 4:158373859-158373881 TTAGAAAGACATCACCATATCGG + Intronic
983274505 4:165601174-165601196 TTTGAACATCTGCACCATCACGG + Intergenic
983818709 4:172166743-172166765 TTTGAAATAACGCACCATCTTGG - Intronic
983934250 4:173489229-173489251 TTAGAAAGACTGCACAGTTTTGG - Intergenic
984524538 4:180842526-180842548 TTATAAAAATTATACCATCTCGG + Intergenic
985946571 5:3189327-3189349 AGAGAAACACTGCACCTTCTAGG + Intergenic
986974112 5:13375612-13375634 AAAGAAAAACTGCACAATATTGG + Intergenic
988078454 5:26383253-26383275 GTAGAAACAAGGCACCATCTTGG + Intergenic
991108912 5:62875307-62875329 TTTGAAAAACTGCAAAAACTTGG + Intergenic
992024657 5:72658374-72658396 TTAGAATTACTGAACCACCTAGG + Intergenic
992560401 5:77946696-77946718 TTAGAAAAACTCCATCTTCTTGG - Intergenic
992644125 5:78796607-78796629 ATAGAGAAAATGCTCCATCTGGG + Intronic
994982749 5:106897992-106898014 TCAGAAAAACTGAACCATAAAGG + Intergenic
996456432 5:123688719-123688741 TGAGAAAAACTTCAGAATCTCGG + Intergenic
996626306 5:125574030-125574052 TTAGAAAAACTGGTCAACCTAGG - Intergenic
999965441 5:156804571-156804593 TTAGAATACCTTAACCATCTGGG + Intergenic
1000287131 5:159836552-159836574 TGAGAAACACTGCCCCATCTGGG + Intergenic
1000387817 5:160691924-160691946 TTATAAAAAATGCACCTTCATGG + Intronic
1000835661 5:166150629-166150651 TTAGAAACACTGAACTCTCTTGG - Intergenic
1000853614 5:166371213-166371235 TTAGAAAAACTGGAACACTTAGG + Intergenic
1003207702 6:4028525-4028547 TTGGAAAAAGTGCAGTATCTTGG - Intronic
1005423170 6:25673621-25673643 ATAGAATAACAGGACCATCTTGG - Intronic
1006081033 6:31566754-31566776 GTAGAGAAAGTACACCATCTTGG - Intergenic
1009493503 6:64322254-64322276 TTAGAAAAAGTAAACCCTCTAGG - Intronic
1010518453 6:76803188-76803210 GTAGAGAAAGTGCACCATGTGGG + Intergenic
1013962775 6:115920610-115920632 TTACAAAAACTGCAGCATTCAGG + Intergenic
1018357291 6:163030956-163030978 TTAGAATGCCTGAACCATCTAGG + Intronic
1018655216 6:166027565-166027587 TCACTAAAACTGCACCATTTAGG - Intergenic
1019007294 6:168809683-168809705 TTAGAATGCCTTCACCATCTGGG + Intergenic
1020907522 7:14082494-14082516 GTTGAGAAACTGCACCATCTGGG - Intergenic
1022216669 7:28269850-28269872 GTAGAATCAGTGCACCATCTTGG + Intergenic
1022437268 7:30400836-30400858 TTAGAGTAACTGCACATTCTTGG - Intronic
1026222252 7:68410447-68410469 TGAGAAAAAGTGCACAAACTTGG + Intergenic
1026808332 7:73442051-73442073 TTAGAAAAACAGCATAAGCTTGG + Intronic
1028470328 7:91198987-91199009 TGAGAAAAAATGCACACTCTGGG + Intronic
1030889048 7:114974834-114974856 TAAGAAATACTGCACTTTCTAGG - Intronic
1033129350 7:138732454-138732476 TTTGTAAAACTGAGCCATCTTGG - Intronic
1033577902 7:142703878-142703900 TTAGAATGCCTTCACCATCTGGG - Intergenic
1035872676 8:3153029-3153051 TTAGAAAGCCTTCACCATCTGGG - Intronic
1037367645 8:18139979-18140001 TTAGAACACCTTAACCATCTGGG + Intergenic
1038119785 8:24600107-24600129 TTAGAACAACTTCAGCTTCTAGG + Intergenic
1039103852 8:33969698-33969720 TAAGAACAAATGCATCATCTGGG - Intergenic
1040980098 8:53238289-53238311 TAAGCAAAATGGCACCATCTGGG + Intronic
1041742180 8:61167659-61167681 TTAGAATACCTTAACCATCTGGG - Intronic
1042666385 8:71211124-71211146 TGAGACAAGATGCACCATCTAGG + Intronic
1043777823 8:84292505-84292527 TTAGAATACCTTAACCATCTGGG - Intronic
1043984503 8:86678008-86678030 TTAAAAAAATTGAACCAACTGGG - Intronic
1044152060 8:88792495-88792517 TTAGAATTACTACATCATCTTGG - Intergenic
1045317568 8:101056574-101056596 TTGGAAAATATGTACCATCTGGG - Intergenic
1046494382 8:114994941-114994963 TTAGAATACCTCAACCATCTGGG + Intergenic
1047315258 8:123727253-123727275 TGAGAAAAACTGCTGCCTCTTGG + Intronic
1047377494 8:124315619-124315641 TTAGAAAAACTGTAGGATGTGGG - Intronic
1047526681 8:125640019-125640041 TTAGAATGCCTTCACCATCTGGG - Intergenic
1052039892 9:23726413-23726435 ATAGAAAAACTGCCCGATTTTGG - Intronic
1055166540 9:73202123-73202145 ATAGGAAAGCTGCAGCATCTTGG - Intergenic
1058095769 9:100858698-100858720 TGAGAAAATTTGCAGCATCTGGG - Intergenic
1058493240 9:105525239-105525261 TTAGAGAAACTGTACCAACTTGG + Intronic
1058822403 9:108744729-108744751 TTATAAAAAATGTACCATTTTGG - Intergenic
1058980954 9:110169947-110169969 TTACAAATACTGCATCAGCTCGG - Exonic
1061704642 9:132443591-132443613 TTAGGTAAAATGGACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1186179976 X:6963838-6963860 TTAGAACAACTGCAAAATGTTGG - Intergenic
1187042608 X:15612625-15612647 TTAGAACAATCTCACCATCTAGG - Intergenic
1187146388 X:16641237-16641259 TCAGACAACCTGAACCATCTAGG + Intronic
1187304006 X:18078627-18078649 TTTTAAAAACTGCACCTGCTGGG - Intergenic
1188599893 X:31949160-31949182 ATTGAAAAATTGCACAATCTTGG - Intronic
1188978898 X:36708446-36708468 TTAGAAAAACTGTAGTATTTTGG + Intergenic
1189152689 X:38724467-38724489 TTTGAAAAGTTGCACCATTTGGG - Intergenic
1194637123 X:96359841-96359863 TTAAAATAACTGCTCCTTCTTGG - Intergenic
1196305455 X:114096979-114097001 TAAGAAAAACTGCTGAATCTTGG - Intergenic
1196709846 X:118751582-118751604 TCAGAGAAACTCCCCCATCTAGG - Intronic
1196718920 X:118835740-118835762 TTAGAAAAACTGTATCATAATGG + Intergenic
1196803583 X:119564870-119564892 TAAGAGCAACTGCAGCATCTTGG + Intronic