ID: 973112670

View in Genome Browser
Species Human (GRCh38)
Location 4:46414601-46414623
Sequence AGCCAGTTTGAAGACCTCTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973112670_973112672 -10 Left 973112670 4:46414601-46414623 CCGTAGAGGTCTTCAAACTGGCT 0: 1
1: 0
2: 2
3: 11
4: 119
Right 973112672 4:46414614-46414636 CAAACTGGCTAGTGGAATTCTGG 0: 1
1: 1
2: 0
3: 20
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973112670 Original CRISPR AGCCAGTTTGAAGACCTCTA CGG (reversed) Intronic