ID: 973112670

View in Genome Browser
Species Human (GRCh38)
Location 4:46414601-46414623
Sequence AGCCAGTTTGAAGACCTCTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973112670_973112672 -10 Left 973112670 4:46414601-46414623 CCGTAGAGGTCTTCAAACTGGCT 0: 1
1: 0
2: 2
3: 11
4: 119
Right 973112672 4:46414614-46414636 CAAACTGGCTAGTGGAATTCTGG 0: 1
1: 1
2: 0
3: 20
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973112670 Original CRISPR AGCCAGTTTGAAGACCTCTA CGG (reversed) Intronic
900493755 1:2966762-2966784 AGCCAGCTTGGAGACCTCCCTGG - Intergenic
900906176 1:5560829-5560851 AGCCACTTTGAAAAACACTATGG + Intergenic
902253065 1:15168610-15168632 GGCAAGGTTGAAGAACTCTATGG - Exonic
903758716 1:25683084-25683106 AGGCAGTTCTAAGACCTCAAAGG - Intronic
908983400 1:69986039-69986061 AGCCACTTTGAAGAACTGTTTGG - Intronic
911110011 1:94173891-94173913 CAACAGTTTGAAGACCTCGAAGG - Exonic
912079573 1:105918435-105918457 AGCCAGTTGGAAGACCCAGAGGG + Intergenic
912501602 1:110126359-110126381 AGTCAGTTGGAAGCCCTTTAAGG + Intergenic
913149574 1:116027313-116027335 ATCCAGTCTGAAGACCTTTAAGG - Intronic
920426499 1:205880898-205880920 AGCCACTATGAAGAGCACTATGG - Intergenic
920511928 1:206557903-206557925 AGCCATTTTGAAGAGATCTGTGG - Intronic
922980886 1:229825859-229825881 AGCCAGTTTAAAGTCCTCTAGGG - Intergenic
923275927 1:232396326-232396348 AGAAAGTTTGAAGACCTACATGG + Intergenic
924163685 1:241260433-241260455 TGCCAGTTTGAAGACAGGTATGG - Intronic
1065170304 10:23020431-23020453 AGCCAGTTTTAATTTCTCTAGGG + Intronic
1065850518 10:29783885-29783907 AGCCAATCTGAAGACCTCCCAGG + Intergenic
1066616836 10:37303330-37303352 AGCCACTTTGGAGAACTCTTTGG + Intronic
1067273248 10:44810727-44810749 AGCCATTTTGAACAGCTGTAAGG - Intergenic
1071827060 10:89335973-89335995 AGCCAAATTGAAAACCCCTAGGG + Intronic
1072468789 10:95693024-95693046 ACCCAGCTTGAAGACCTGTGAGG + Exonic
1073759762 10:106616753-106616775 AGCAACTTTGAACACATCTAAGG - Intronic
1077591637 11:3496591-3496613 AGCCTCTTTGTAGGCCTCTAAGG + Intergenic
1083121062 11:60512170-60512192 AGGCTGTTTGAACACCTCCAGGG + Intergenic
1085630383 11:78110707-78110729 AGACAGTTTGAGCACCTATAGGG + Intronic
1086342159 11:85857641-85857663 AGCAAGTTTGACAACCTCTCCGG + Intronic
1087157379 11:94918722-94918744 AGCCATTTTCAAGACCTCTAAGG + Intergenic
1088011327 11:105004838-105004860 TGCCAATGTGAAGACATCTAGGG + Intronic
1089844281 11:121446299-121446321 AGCAAGTTTCAGGGCCTCTAGGG + Intergenic
1090189614 11:124759615-124759637 AGCCAGGCTGAAGGCCTCTAAGG + Intronic
1092373414 12:7935664-7935686 AGCCAGTGTGAAGACTTCTCTGG - Intronic
1092520258 12:9264830-9264852 AGCCAGTGTGATGACAGCTAAGG - Intergenic
1095350283 12:41202194-41202216 AGCCTCTTTGAAGTCCTCTTGGG + Intronic
1096385711 12:51193971-51193993 AGGCAGTTTAAACAGCTCTAGGG - Intronic
1103247044 12:119466721-119466743 AGGCAGTTTGAAGACCTGCTTGG + Intronic
1105587268 13:21756795-21756817 AACCAATTTGAGGACCTCCACGG + Intergenic
1105892403 13:24690905-24690927 AGCCAGCTTGCAGCCCTCTCTGG - Intronic
1106025411 13:25951045-25951067 AGCCACTTTGGAGATCTCTTTGG + Intronic
1112528663 13:100179283-100179305 AGTCATTTTGAGCACCTCTAAGG - Intronic
1112932388 13:104758123-104758145 AGCCACTTTGAAAAACGCTATGG + Intergenic
1114434574 14:22694331-22694353 TGCCAGTTTGCTGACCTTTATGG + Intergenic
1118334059 14:64836741-64836763 AGGCACTTTTAAGACCTCCAGGG - Intronic
1118690416 14:68333458-68333480 AGCCACTTTGAAGAACTATCTGG + Intronic
1119012848 14:71014115-71014137 AGCCAGATTGGAGACATTTATGG + Intronic
1126599878 15:50417941-50417963 AGCAAGTTTGACAACCTCTATGG + Intergenic
1134742702 16:16561896-16561918 AGCCTGTCTCATGACCTCTAAGG + Intergenic
1134924856 16:18150568-18150590 AGCCTGTCTCATGACCTCTAAGG - Intergenic
1140214126 16:72993821-72993843 ATGAAGTTTGAAGACGTCTAGGG - Intronic
1140830001 16:78742258-78742280 AGGCAGTTTGGAGACCACTCAGG + Intronic
1144400675 17:14896306-14896328 AACCTGTATGGAGACCTCTATGG - Intergenic
1152663395 17:81553207-81553229 AGCCAATCTGAAGAGCGCTAAGG + Intronic
1152942003 17:83177731-83177753 AGCCAGTTTCAAGCCGTCTCTGG + Intergenic
1162831728 19:13288820-13288842 AGCCAGTGGGAAGCCCTCTGGGG - Intronic
1166553062 19:43679612-43679634 AGCCAGGTAGGAGTCCTCTATGG + Intergenic
925894272 2:8459340-8459362 ATCCAGATTGAAGAGCTGTAAGG - Intergenic
926692790 2:15748711-15748733 AGACTTTTTGAAGACCTCTTTGG - Intergenic
931370597 2:61659007-61659029 CCCCAGTTTGAAGACCACTGGGG + Intergenic
932787366 2:74618765-74618787 AGGCATTTTGAAGACTTCTTTGG - Intronic
937551027 2:123092000-123092022 AGCCACCTTGAATACCTCTTAGG - Intergenic
937570461 2:123351947-123351969 AGCCAGTTTGAATATCTGTTAGG + Intergenic
938248315 2:129795769-129795791 AGCCTGTTCTGAGACCTCTAAGG - Intergenic
939189728 2:138902150-138902172 AGCAAGTTTGACAACCTCTATGG - Intergenic
940083578 2:149832497-149832519 AGCCAGTGTGCAGTTCTCTAAGG - Intergenic
941361458 2:164556965-164556987 ACGGAGTTTGAAAACCTCTATGG + Intronic
942530363 2:176903387-176903409 AGCCAGTTTGAAGAAATAGAGGG + Intergenic
942646732 2:178119619-178119641 AGCCAGTTTGAATTCTTCTCTGG - Intronic
946877337 2:224142465-224142487 AAACAGATTGAAGATCTCTAAGG - Intergenic
1169310116 20:4530548-4530570 AGCCACTATGGAGAACTCTACGG + Intergenic
1169742628 20:8911808-8911830 AACCATTTTGAAAACCTCTTTGG + Intronic
1171410073 20:24940554-24940576 AGCATCTTTGAAGACCTCTGTGG - Intergenic
1172357605 20:34290916-34290938 AGCAAGTTTGACAACCTCTATGG - Exonic
1173488185 20:43457023-43457045 AACCAGATTGAAAACCTCAAAGG - Intergenic
1174017867 20:47502840-47502862 AGGCAGTTTGAGGGCATCTAGGG + Intronic
1176071952 20:63231605-63231627 AACCAGTTTGAAGACCCTCATGG - Intergenic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1182028940 22:27142349-27142371 AGGCAGTTTGAAAATCTCCAGGG - Intergenic
1184020780 22:41819892-41819914 AGCCCTTGTGAAGACCTCTGAGG - Intronic
1185329290 22:50245015-50245037 CGCCAGTGTGAAGAGCACTAGGG + Intergenic
949821237 3:8117623-8117645 AGCCAATTTGAAAAACTATATGG - Intergenic
950391623 3:12701273-12701295 AATCAGTTTGAAGACCCCCACGG - Intergenic
951130457 3:19036523-19036545 AGCCACTTTGAAGAACTGTATGG + Intergenic
953281492 3:41562497-41562519 AGTCTGTTTGTAGATCTCTAAGG + Intronic
953308603 3:41854315-41854337 AGCATCTTTGAAGAGCTCTAAGG + Intronic
953731374 3:45451898-45451920 AGCAAGGTTAAAGATCTCTAAGG - Intronic
955522496 3:59788421-59788443 AGCCAGTCTGAAGACCTAAAAGG - Intronic
960163401 3:114374956-114374978 AGCAAGTTTGAAGGTCTCTTTGG - Intronic
961705270 3:128780061-128780083 AACCAGTTTGAAGACCCCCATGG - Intronic
963809390 3:149760062-149760084 AGCCACTTTGGAGAACTCTTAGG + Intergenic
964795559 3:160493013-160493035 AGCCATTTTGGAGAACTTTAGGG + Intergenic
966459256 3:180157213-180157235 AGCCACTATGAAGAACACTATGG - Intergenic
967357852 3:188593284-188593306 AGCAAGAGTGAACACCTCTATGG - Intronic
967425642 3:189324191-189324213 AGCCAGTTTGTAGAGTTCTGGGG + Exonic
968055907 3:195691477-195691499 ACACAGTTTGAAAACCTCCACGG + Intergenic
969163137 4:5279323-5279345 AGCCAGTTTGAAACCCAGTAAGG + Intronic
970377747 4:15475978-15476000 GGCCACTTTGATGTCCTCTAGGG + Intronic
970422852 4:15921206-15921228 AGGCTGAATGAAGACCTCTATGG - Intergenic
973112670 4:46414601-46414623 AGCCAGTTTGAAGACCTCTACGG - Intronic
973998858 4:56489437-56489459 AGCTTGTGTGAAGACCTCAATGG - Exonic
974567644 4:63598692-63598714 AGCCAATTTCAAAACCTCTCAGG - Intergenic
975890646 4:79023133-79023155 AGACAGTTTGAAGAACTGAATGG + Intergenic
977525969 4:98145288-98145310 AGCTCATTTGCAGACCTCTATGG + Intergenic
981796830 4:148605334-148605356 AGGCACTTTGAAGATATCTAAGG + Intergenic
984287420 4:177749973-177749995 AGCCATTTTGAAAACCAGTATGG - Intronic
986513120 5:8529714-8529736 AGCAAGTTTGAAGCCATCTCTGG - Intergenic
988087841 5:26494881-26494903 AGACAGTTTCATGCCCTCTATGG + Intergenic
989250732 5:39311602-39311624 AGCCACTTTGAAGAACTGTGTGG + Intronic
996205450 5:120729672-120729694 ATCCAGTTTTAAGACTTATATGG - Intergenic
996356680 5:122603224-122603246 AGCCAGGTTGAGGACTTCCAAGG - Intergenic
1002969977 6:2005699-2005721 TGCCAGTTGGCAGACCTCTGTGG - Intronic
1004521857 6:16368632-16368654 TGCCAGTTGGAAGACCTCAGAGG - Intronic
1009749835 6:67869191-67869213 AGCCCATTTGAACACCTGTATGG - Intergenic
1016616231 6:146051691-146051713 GGCCAGTTGGAAGACATCAAAGG + Intronic
1017931535 6:158959542-158959564 AGCCATTTTAAAGACCTTTGAGG - Intergenic
1020392935 7:7678160-7678182 AGCCAGTATGAAGACCAGTATGG - Intronic
1020619806 7:10503443-10503465 AGTCTGTTTGTAGGCCTCTAAGG - Intergenic
1021308751 7:19064925-19064947 AGCCAGTTTCATAACCTCTGTGG + Intronic
1021537746 7:21724440-21724462 AGCAAGTTTAAAAACTTCTATGG + Intronic
1024144011 7:46492562-46492584 AACCAGTTTGGTGACTTCTATGG - Intergenic
1024686631 7:51752815-51752837 AGCCAGGTGGAAAACCTCCAAGG + Intergenic
1030641276 7:112009589-112009611 AACCAGTCTGAAGACCTCAGAGG - Intronic
1031360733 7:120845353-120845375 AGCCAGTTTGAATTCCTTTCCGG + Intronic
1039577280 8:38633691-38633713 AACCATTTTGAAGGCCTCCAAGG + Intergenic
1050096829 9:2075855-2075877 AGCCAGATTGTAGAGCTCTTAGG - Intronic
1053070747 9:35100491-35100513 AGGCACTCTGAAGACCTTTATGG + Intronic
1053834246 9:42117030-42117052 AGTCTGTTTGTACACCTCTAAGG - Intronic
1058935008 9:109762204-109762226 AAACACTTTGAAGACCTCTTTGG - Intronic
1059785469 9:117578254-117578276 AGGCATTTTGAAGATCTCTAGGG + Intergenic
1061839839 9:133352225-133352247 GGCCAGTTGGAAGTCCTGTATGG + Intronic
1186924491 X:14317923-14317945 AGCCAGTATGAAAACCAGTACGG + Intergenic
1192161168 X:68788978-68789000 AACCAGTTTGAAGACCCACAAGG - Intergenic
1194799457 X:98253918-98253940 ACTCAGTTTGAAGAGCTCTGTGG - Intergenic
1200024372 X:153243729-153243751 AGCAAGTTTGAAGGTCTCTTTGG - Intergenic
1201775238 Y:17655550-17655572 AGCCATTTTGCAGCCCACTAAGG - Intergenic
1201826318 Y:18250439-18250461 AGCCATTTTGCAGCCCACTAAGG + Intergenic