ID: 973113958

View in Genome Browser
Species Human (GRCh38)
Location 4:46431591-46431613
Sequence AAGTGATGCTAGGAGTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973113958_973113960 19 Left 973113958 4:46431591-46431613 CCAGAAAACTCCTAGCATCACTT 0: 1
1: 0
2: 0
3: 7
4: 132
Right 973113960 4:46431633-46431655 GTAGCTGATATCTACAATTTTGG 0: 1
1: 0
2: 1
3: 15
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973113958 Original CRISPR AAGTGATGCTAGGAGTTTTC TGG (reversed) Intronic
909213504 1:72854579-72854601 AAGCAATGATAGAAGTTTTCAGG + Intergenic
909235733 1:73151164-73151186 AAGTGATGTTAAATGTTTTCTGG - Intergenic
910834745 1:91497351-91497373 AAGTGATTCTAAGAGTTGTCTGG - Intergenic
910914926 1:92278481-92278503 AAGGGATGCTAGAAGTTTATGGG - Intronic
911057543 1:93721378-93721400 AAGGGATGCCAGGATTCTTCTGG - Intronic
913491766 1:119386642-119386664 AAGTGCTGATAGGAGTCATCTGG - Exonic
915077827 1:153325728-153325750 AAGAGATGCTAGGAGCCTACAGG + Intergenic
915139003 1:153754672-153754694 ACGACATGCTAGGAATTTTCGGG - Exonic
916071139 1:161170618-161170640 AGGTGATGCTGGGAGGTTCCTGG + Exonic
919370915 1:196724514-196724536 AAGTGTAGGTAGGAGTCTTCTGG - Intronic
920539160 1:206764503-206764525 AAGTGATGGTGTGAGATTTCTGG + Intergenic
922325421 1:224524066-224524088 TAATCATGCTGGGAGTTTTCTGG - Intronic
922482570 1:225949334-225949356 AAGTGTTTCTAGGAGGTGTCAGG - Intergenic
1063553353 10:7054153-7054175 AAGTAATTGTAGAAGTTTTCTGG - Intergenic
1080258288 11:30318167-30318189 AAGTGACGCTATGTGTTTCCAGG + Intergenic
1086009459 11:82082257-82082279 AAGTGATGATAATAATTTTCAGG - Intergenic
1087300297 11:96425719-96425741 AAGTGATTATAGAAGGTTTCAGG - Intronic
1088213241 11:107479745-107479767 AAGTGATTTGAGAAGTTTTCTGG - Intergenic
1089524964 11:119091021-119091043 AAGTGAAGTTGGGAATTTTCTGG + Intronic
1092035586 12:5331987-5332009 CTGTGATGATAGGAGATTTCAGG + Intergenic
1093715243 12:22374507-22374529 TAGGGATGTTTGGAGTTTTCAGG + Intronic
1095136914 12:38615823-38615845 AAGTGGGCCTAGGACTTTTCAGG - Intergenic
1095666020 12:44799323-44799345 AACTGATGCCTTGAGTTTTCAGG - Intronic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1097709109 12:62899169-62899191 AAGTGCACCTAGGAGTTTTAAGG - Intronic
1101366914 12:104080897-104080919 AAGTAATGCTAGTAGTTTCTTGG + Intronic
1108810359 13:54215586-54215608 AAGAGATGCTAGGGATCTTCTGG + Intergenic
1110362098 13:74638219-74638241 CAGTGATGCTTGGACTTTTAGGG + Intergenic
1112162685 13:96885348-96885370 CAGTGAGCCTGGGAGTTTTCCGG - Intergenic
1113322685 13:109251103-109251125 AAGTAATATTGGGAGTTTTCTGG + Intergenic
1114816483 14:25964880-25964902 AAGTGATGCTATGACTTCTGAGG + Intergenic
1122014424 14:98782107-98782129 AAGTGTTTCTAGGAGTTCTGTGG + Intergenic
1123798192 15:23794746-23794768 AAGGGATGCTAAGAGTTCTGTGG + Intergenic
1124255080 15:28134324-28134346 AAGTGAGGCTAGCAGTGTTGCGG - Intronic
1126069781 15:44856069-44856091 AAGGGATTCTAGCAGTTTTTAGG + Intergenic
1126088748 15:45033093-45033115 AAGGGATTCTAGCAGTTTTTAGG - Intronic
1126363523 15:47870663-47870685 CAGTGATGATAGGAGTATTAGGG - Intergenic
1127311628 15:57756795-57756817 AAGTGAAGCCAGGATTTTTCAGG - Intronic
1128293183 15:66495192-66495214 AAGTGCTGATAACAGTTTTCTGG - Intronic
1129759819 15:78122945-78122967 AAGTGATCCTGGGACTTTGCTGG + Intronic
1131675992 15:94671119-94671141 AAGTGTTGCTAGAAGTGTTTTGG - Intergenic
1131746628 15:95455712-95455734 AAGTGATGATAGGACCTTTAAGG + Intergenic
1137235422 16:46613052-46613074 AAGTGCTGCTTTGTGTTTTCAGG - Intronic
1140462629 16:75152839-75152861 AAGTCATTCTAGGAGTTGTAAGG + Intronic
1142679565 17:1538560-1538582 AAGTGGTGCTCCGATTTTTCAGG + Intronic
1143365098 17:6402395-6402417 AAGTGATGATGTGAGGTTTCAGG + Intronic
1146076446 17:29734529-29734551 AAGAGATGTTAGGAGGTTTAGGG - Intronic
1147050730 17:37792718-37792740 AAGAGATGGCAGGAGTTTTGAGG - Intergenic
1147370111 17:39986749-39986771 AAGTGATGCAAGGGGTTTGGCGG + Intronic
1148921958 17:51044709-51044731 AAGTGATGCTCAGAGATTTTAGG + Intronic
1156968753 18:43129714-43129736 TAATGATTCTAGGAGGTTTCTGG - Intergenic
1157147770 18:45182879-45182901 AAGTGATTCTAGAATTTATCTGG + Intergenic
1157333218 18:46718566-46718588 TAGTGCTGTTTGGAGTTTTCCGG + Intronic
1159156569 18:64590799-64590821 AAGTGATGCTATAAATCTTCGGG - Intergenic
1159957147 18:74526821-74526843 AAGTCATGCTAGAAATGTTCAGG + Intergenic
1160045140 18:75379524-75379546 AAGGGATGGTAAGAGATTTCTGG - Intergenic
1162619555 19:11830371-11830393 AAGTGATGCTGGAAACTTTCAGG + Exonic
1162623789 19:11866293-11866315 AAGTGATGCTGGAAACTTTCTGG + Exonic
1162628287 19:11903661-11903683 AAGTGATGCTGGAAACTTTCAGG + Exonic
1162633544 19:11947269-11947291 AAGTGATGCTGGAAACTTTCAGG + Exonic
1162637058 19:11977126-11977148 AAGTGATGCTGGAAACTTTCAGG + Exonic
1162669648 19:12244708-12244730 AAGTCATATTAGGAGATTTCTGG - Intronic
1163924263 19:20323996-20324018 AAGTGTTGTTGGAAGTTTTCAGG + Intergenic
1165455180 19:35906642-35906664 AAGTCAGGCCAGGAATTTTCTGG - Intronic
927451558 2:23213437-23213459 AAGTAATGCTGGGAATTTGCTGG + Intergenic
928285631 2:29987847-29987869 AAGGGAGGCTAGAAGTTTTAGGG + Intergenic
930391871 2:50771710-50771732 AAAGGATGCTACGAGTTTCCAGG + Intronic
932169406 2:69539842-69539864 CAGTGATGATTGGAATTTTCTGG - Intronic
933095725 2:78177366-78177388 GTGTAATGCTAGGATTTTTCAGG - Intergenic
937636796 2:124165115-124165137 CAGTGGTGTTAGGAGTTATCAGG + Intronic
944050529 2:195463403-195463425 AAATGATTCAGGGAGTTTTCAGG + Intergenic
946366410 2:219251892-219251914 AAGTACGGCTAGGAATTTTCAGG + Intronic
946715378 2:222549381-222549403 AATAAATGCTGGGAGTTTTCAGG + Intronic
1170633791 20:18087405-18087427 CAGTGATTCTAGAAGTATTCTGG - Intergenic
1172919597 20:38470087-38470109 AAGTGATGCTATGTGATTTCTGG - Intergenic
1177945460 21:27463754-27463776 AAGGGATGCTATGAATTTTTTGG + Intergenic
1184270984 22:43383585-43383607 AAGTGATTATAGGACCTTTCAGG - Intergenic
950019475 3:9777004-9777026 AAGTGATGGCAGGAGCTTTGTGG - Intronic
952140729 3:30475958-30475980 AAGCAATGTTAGGAGTTTCCTGG + Intergenic
952520074 3:34147981-34148003 AATTGTTGCTAGGTGTTTTATGG + Intergenic
953757215 3:45657045-45657067 CAGTGATTCCAGGAATTTTCAGG + Intronic
954009516 3:47623053-47623075 AAATGGTGCTGGGAGTTTGCTGG - Intronic
954871896 3:53773620-53773642 AAGTGATTCTATGATTTTTGGGG + Intronic
957125443 3:76153821-76153843 AAGTGATGCAAGTCATTTTCAGG - Intronic
957253172 3:77801215-77801237 AAGTGATGGAAGGATTCTTCAGG - Intergenic
960384150 3:117000473-117000495 TAATGATGCTTGGAATTTTCTGG + Intronic
962918932 3:139934663-139934685 TAGTGGTGCTAGGGGTTGTCGGG - Intergenic
964994807 3:162865945-162865967 AAGTGGTGAGATGAGTTTTCTGG - Intergenic
967245366 3:187481283-187481305 ATGTGAGGCTTGGGGTTTTCAGG - Intergenic
971461874 4:26908090-26908112 AAGTGTTGCTATGTGTTTACTGG - Intronic
973113958 4:46431591-46431613 AAGTGATGCTAGGAGTTTTCTGG - Intronic
973237751 4:47924069-47924091 AAGTGATGCTGGTAGTTTGATGG - Intronic
977974624 4:103250136-103250158 AAGTGATTTGAGAAGTTTTCTGG - Intergenic
981860361 4:149348210-149348232 CATTGATGCTAGCTGTTTTCAGG + Intergenic
982597967 4:157408907-157408929 AAGAAATGTTAGGAGTTTTGGGG + Intergenic
986454614 5:7903844-7903866 CAGTGATGCTAGGACTTTATAGG + Intronic
986547212 5:8911430-8911452 AAGTGATGCTACGACTTACCTGG - Intergenic
987644833 5:20655811-20655833 TAGTGATGCTAGTATTTTACAGG - Intergenic
993083750 5:83337392-83337414 AAGTGATGCTGCGTGATTTCTGG + Intronic
994554456 5:101280392-101280414 AAGTGATGGTAGGTGTTTTGAGG - Intergenic
999921260 5:156323604-156323626 AAGTGAAGATTGAAGTTTTCTGG + Intronic
1000970393 5:167707957-167707979 GTGTGGTGCTCGGAGTTTTCTGG + Intronic
1001410045 5:171505035-171505057 AAGTGATGCCTGGTGTGTTCTGG + Intergenic
1007027117 6:38587441-38587463 TAATGATGCAACGAGTTTTCAGG + Intronic
1007859967 6:44898427-44898449 GAGTAATGCTAGGAGTTGGCTGG - Intronic
1012248504 6:96954049-96954071 AAGAGATGATAGGAATTCTCAGG - Intronic
1013881355 6:114905341-114905363 TAGTGATGCTAGGACTTGTCAGG + Intergenic
1015036145 6:128657084-128657106 AAGTGATGAGAGGAGTAGTCAGG - Intergenic
1019163227 6:170082667-170082689 GAGTGAGGCCAGGAGTGTTCAGG - Intergenic
1021790078 7:24195957-24195979 AAGTGATGCTCTGAGGCTTCTGG - Intergenic
1022609407 7:31854175-31854197 CAGTGAGGCTAGGAGTGTTGAGG - Intronic
1022795332 7:33727349-33727371 AAGTGATGGGAGGAGTGTTTGGG + Intronic
1024297535 7:47857391-47857413 TAGTTTTGCCAGGAGTTTTCTGG + Intronic
1025964959 7:66261013-66261035 AAGTCCTGGTTGGAGTTTTCAGG - Intronic
1027428476 7:78085601-78085623 AAGAGATGCTGGGACTTTTTTGG - Intronic
1028368107 7:90058418-90058440 TAGAGATGGTAGGAGCTTTCAGG + Intergenic
1029504950 7:100957686-100957708 AAGTGAGGCTGGGAGTATTGTGG - Exonic
1033914051 7:146301751-146301773 CAGTGGTGCAAGGAATTTTCTGG + Intronic
1035415752 7:158684142-158684164 AAGTGATGCTAAGTGACTTCAGG - Intronic
1038255250 8:25945325-25945347 AAGAAATGCTAGAAATTTTCTGG - Intronic
1040698759 8:50035682-50035704 CTGTGATGCTGGGAGTTTTGGGG - Intronic
1041625284 8:60018690-60018712 AATTGATGTTAGGGTTTTTCTGG + Intergenic
1043787170 8:84417801-84417823 GAGAAGTGCTAGGAGTTTTCTGG - Intronic
1050504435 9:6332668-6332690 GAGTGATGCTAGTATTTTTCTGG - Intergenic
1051163307 9:14233322-14233344 AAGTGATCCTAAAAATTTTCAGG + Intronic
1051609232 9:18945239-18945261 AGGTGATGCTTGGAGTATCCAGG - Intronic
1054825416 9:69567975-69567997 GAGTGGTGATGGGAGTTTTCTGG - Intronic
1055069175 9:72149164-72149186 AAGTGATCCTAGGAGTTGAAGGG + Intronic
1055229204 9:74041191-74041213 AAGAGACACTAGGAGTTTTACGG + Intergenic
1057500821 9:95595606-95595628 AATTCAGGCTAGGAGTTTTGTGG - Intergenic
1058663615 9:107288931-107288953 GAGTTAGGCTAGGGGTTTTCAGG + Intronic
1060439296 9:123623957-123623979 ACATGCTGCTAGGAGTTTTCAGG - Intronic
1062214706 9:135383011-135383033 GAGGGAAGTTAGGAGTTTTCAGG - Intergenic
1186641543 X:11460971-11460993 CAGTGATGCTGTGGGTTTTCGGG + Intronic
1187360288 X:18619911-18619933 AAGAGAAGCAAGGATTTTTCAGG + Exonic
1189143496 X:38631618-38631640 AAGTGAATTTAGGGGTTTTCTGG + Intronic
1189705065 X:43751401-43751423 AAGTTTGGCTAGGAGTTTTGTGG + Intergenic
1192683028 X:73272753-73272775 AATTGAATCTAGGAGTTTTTTGG - Intergenic
1197589239 X:128388050-128388072 TATTGGTTCTAGGAGTTTTCTGG - Intergenic
1199754599 X:150852416-150852438 AAGAGATGGGAGGAGTCTTCCGG - Intronic