ID: 973117259

View in Genome Browser
Species Human (GRCh38)
Location 4:46477198-46477220
Sequence CATGGTTAACAGCTTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973117259_973117264 11 Left 973117259 4:46477198-46477220 CCAAGCTCAAGCTGTTAACCATG No data
Right 973117264 4:46477232-46477254 CTCTTTCTTAGAAGAAGCTGCGG No data
973117259_973117265 22 Left 973117259 4:46477198-46477220 CCAAGCTCAAGCTGTTAACCATG No data
Right 973117265 4:46477243-46477265 AAGAAGCTGCGGTAGATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973117259 Original CRISPR CATGGTTAACAGCTTGAGCT TGG (reversed) Intergenic
No off target data available for this crispr