ID: 973117911

View in Genome Browser
Species Human (GRCh38)
Location 4:46484320-46484342
Sequence CTCCCAAGAATTCTGTAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973117911_973117913 -3 Left 973117911 4:46484320-46484342 CCCTGCTACAGAATTCTTGGGAG No data
Right 973117913 4:46484340-46484362 GAGTTTAAATGCCCTTTACTTGG No data
973117911_973117914 -2 Left 973117911 4:46484320-46484342 CCCTGCTACAGAATTCTTGGGAG No data
Right 973117914 4:46484341-46484363 AGTTTAAATGCCCTTTACTTGGG No data
973117911_973117918 21 Left 973117911 4:46484320-46484342 CCCTGCTACAGAATTCTTGGGAG No data
Right 973117918 4:46484364-46484386 GTACACCTATGTAAATGAAGAGG No data
973117911_973117915 -1 Left 973117911 4:46484320-46484342 CCCTGCTACAGAATTCTTGGGAG No data
Right 973117915 4:46484342-46484364 GTTTAAATGCCCTTTACTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973117911 Original CRISPR CTCCCAAGAATTCTGTAGCA GGG (reversed) Intergenic
No off target data available for this crispr