ID: 973120980

View in Genome Browser
Species Human (GRCh38)
Location 4:46520890-46520912
Sequence TACAGCTCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973120980_973120982 11 Left 973120980 4:46520890-46520912 CCAGTAACAGGCCAAGAGCTGTA No data
Right 973120982 4:46520924-46520946 GAGTTGTTATTTGCAGAAGATGG No data
973120980_973120983 15 Left 973120980 4:46520890-46520912 CCAGTAACAGGCCAAGAGCTGTA No data
Right 973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG No data
973120980_973120984 16 Left 973120980 4:46520890-46520912 CCAGTAACAGGCCAAGAGCTGTA No data
Right 973120984 4:46520929-46520951 GTTATTTGCAGAAGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973120980 Original CRISPR TACAGCTCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr