ID: 973120983

View in Genome Browser
Species Human (GRCh38)
Location 4:46520928-46520950
Sequence TGTTATTTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973120978_973120983 22 Left 973120978 4:46520883-46520905 CCACAGCCCAGTAACAGGCCAAG No data
Right 973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG No data
973120981_973120983 4 Left 973120981 4:46520901-46520923 CCAAGAGCTGTATTTCAAAAGAA No data
Right 973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG No data
973120980_973120983 15 Left 973120980 4:46520890-46520912 CCAGTAACAGGCCAAGAGCTGTA No data
Right 973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG No data
973120979_973120983 16 Left 973120979 4:46520889-46520911 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973120983 Original CRISPR TGTTATTTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr