ID: 973121938

View in Genome Browser
Species Human (GRCh38)
Location 4:46531952-46531974
Sequence CTCTGATTCTTAGTGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973121938_973121944 9 Left 973121938 4:46531952-46531974 CCAGCACCCACTAAGAATCAGAG No data
Right 973121944 4:46531984-46532006 AACATCTTAAGTTCGGATTCAGG No data
973121938_973121943 2 Left 973121938 4:46531952-46531974 CCAGCACCCACTAAGAATCAGAG No data
Right 973121943 4:46531977-46531999 TGTGGTAAACATCTTAAGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973121938 Original CRISPR CTCTGATTCTTAGTGGGTGC TGG (reversed) Intergenic
No off target data available for this crispr