ID: 973130193

View in Genome Browser
Species Human (GRCh38)
Location 4:46639725-46639747
Sequence AGTTATATTCAGAACATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973130191_973130193 4 Left 973130191 4:46639698-46639720 CCAAGGGCTATCTCTCAAAAGGA No data
Right 973130193 4:46639725-46639747 AGTTATATTCAGAACATGGCAGG No data
973130187_973130193 25 Left 973130187 4:46639677-46639699 CCAGTAAAGCGCAGTAATAGGCC No data
Right 973130193 4:46639725-46639747 AGTTATATTCAGAACATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973130193 Original CRISPR AGTTATATTCAGAACATGGC AGG Intergenic
No off target data available for this crispr