ID: 973135494

View in Genome Browser
Species Human (GRCh38)
Location 4:46700809-46700831
Sequence TTTCTGCTTCATCATGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973135494_973135497 20 Left 973135494 4:46700809-46700831 CCTCCCTCATGATGAAGCAGAAA No data
Right 973135497 4:46700852-46700874 TTCATTTTCTTAATATGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973135494 Original CRISPR TTTCTGCTTCATCATGAGGG AGG (reversed) Intergenic
No off target data available for this crispr