ID: 973140579

View in Genome Browser
Species Human (GRCh38)
Location 4:46763505-46763527
Sequence ATGGTCAGAAGCAGAATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 266}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973140579 Original CRISPR ATGGTCAGAAGCAGAATGGG AGG (reversed) Intronic
900372665 1:2339155-2339177 ATGGTGAAAAGCGGAAGGGGAGG + Intronic
902284911 1:15401438-15401460 AAGATCAGAAGAAGATTGGGAGG - Intergenic
904259386 1:29279717-29279739 ATGGGCAGAAGGGAAATGGGGGG + Intronic
904478298 1:30778246-30778268 ATTATCAGAAGCAGAAGGGAAGG - Intergenic
904625744 1:31800934-31800956 GTGGTCAGAAGAAGAGTGAGAGG - Intronic
905626387 1:39492512-39492534 GTGGTCAGGAGCAGAGTGTGGGG + Intronic
905635537 1:39548928-39548950 TTGGTCAGATGAAGACTGGGTGG - Intergenic
905670509 1:39787943-39787965 GTGGTCAGGAGCAGAGTGTGGGG - Intronic
906299287 1:44670473-44670495 ATGGTGAGCAGCAGAAAGTGTGG - Intronic
907377104 1:54053118-54053140 ATGGTCAGCAGCAGCAGCGGCGG + Exonic
907554163 1:55330458-55330480 ATGGTCAGAGGCAGTGTGGCAGG + Intergenic
907700774 1:56785898-56785920 AAGCCCAGAAGCAGAGTGGGAGG - Intronic
910543125 1:88383754-88383776 ATAGGCAGAAGCAAAATGGGAGG - Intergenic
911788512 1:101981191-101981213 ATGGTCAGCAGCTGAGAGGGAGG - Intronic
913133030 1:115859790-115859812 ATGGGCACAAGCAGCATGTGGGG + Intergenic
913599751 1:120411930-120411952 AGGCTCAGCAGCAGAATGGATGG + Intergenic
914087521 1:144466539-144466561 AGGCTCAGCAGCAGAATGGATGG + Intergenic
914193298 1:145429518-145429540 AGGCTCAGCAGCAGAATGGATGG + Intergenic
914311090 1:146467668-146467690 AGGCTCAGCAGCAGAATGGATGG - Intergenic
914591118 1:149106628-149106650 AGGCTCAGCAGCAGAATGGATGG - Intergenic
917511082 1:175669847-175669869 ATGCTCAGAAGCAGTAAAGGTGG - Intronic
918963981 1:191317324-191317346 ATAATCAGAAGCAAAATGTGTGG + Intergenic
919112604 1:193239808-193239830 ATGTTCAAAAGCAGAGTAGGAGG - Intronic
919185416 1:194141213-194141235 ATAGCAAGAAGCAGAATGTGTGG + Intergenic
920839516 1:209542380-209542402 ATAGTAAGAAGCAGAATGATTGG - Intergenic
921704335 1:218304421-218304443 CTGTACAGAAGCAGAAGGGGAGG - Intronic
922034425 1:221834622-221834644 ATGGTGGGAAGCAGAATGCCAGG + Intergenic
922913244 1:229234741-229234763 ATTTTCAGGAGTAGAATGGGAGG - Intergenic
1063074548 10:2701606-2701628 ATTGTCAAAAGAAGAATTGGAGG + Intergenic
1063215356 10:3920470-3920492 ATAGTCAGAAGCTGATTGAGGGG + Intergenic
1064201017 10:13284948-13284970 CTGCTCAGATGCAGAGTGGGAGG - Intronic
1065764825 10:29018658-29018680 ATGCCCAGAAGCAGAATTGCTGG - Intergenic
1066598523 10:37078405-37078427 ATGTTTAGAGGTAGAATGGGAGG + Intergenic
1066648576 10:37634933-37634955 AGGGTCAGCAGAAGAATGAGGGG + Intergenic
1067309224 10:45096486-45096508 ATGGACAAAAGGAGAGTGGGAGG - Intergenic
1070479014 10:76862908-76862930 ATTAACAGAAGCAAAATGGGTGG - Intergenic
1071324606 10:84500336-84500358 ATGGACAGATGCATAATGTGTGG + Intronic
1072462707 10:95634617-95634639 TTGGTCACAAGCTGAAAGGGGGG + Intronic
1072914107 10:99526698-99526720 AGGGTCAGAAGCAGAGGGGTGGG + Intergenic
1074301242 10:112234970-112234992 CCGGTCAGGAGCAGAGTGGGCGG + Intergenic
1074798805 10:116977931-116977953 ATGGTAAGAAGCACTTTGGGAGG - Intronic
1076731649 10:132442424-132442446 AGGGACAGCAGCAGAATGGAGGG + Intergenic
1076991645 11:279013-279035 AAGGACAGAAGCAGAAAGGGAGG + Intronic
1077280617 11:1743490-1743512 ATGGACAGATGGAGAATGGATGG + Intronic
1077608586 11:3628822-3628844 AGGGGCAGAGGCAGGATGGGAGG + Intergenic
1078612842 11:12836734-12836756 ATAGTCAGCACAAGAATGGGTGG - Intronic
1079049371 11:17139795-17139817 TTGGTCAGAATCAGAGTGTGAGG - Intronic
1080567225 11:33521829-33521851 TTGGTCTGAAGGAGAATGGAAGG + Intergenic
1080690025 11:34548765-34548787 ATGGCCTGAAGCAGAGTGTGCGG - Intergenic
1083829251 11:65220913-65220935 GTGGTCAGAATCATAAGGGGGGG + Intergenic
1083858250 11:65404570-65404592 ATGGGCAGAAGCAGGTGGGGAGG - Intronic
1086251795 11:84824750-84824772 ATGGTCATAGGCAAAATGTGTGG + Intronic
1086647029 11:89235303-89235325 ATAGTCAGAAGTGGAATGAGTGG - Intronic
1087733795 11:101809089-101809111 AAGGTAAGCAGCAGAATGGAGGG + Intronic
1088415992 11:109589590-109589612 GTCTTCAGAAGCAGAATTGGTGG + Intergenic
1088617060 11:111641414-111641436 AGGGTCAGAAGAAGAATGAATGG - Intronic
1089610981 11:119668680-119668702 ATTGTCACAACCAGAATGAGAGG - Intronic
1090314110 11:125769894-125769916 ATGCTCAGAGGCAAAATGGGTGG + Intergenic
1090924027 11:131234058-131234080 GTGGTCAGAAGCAGAATGGCAGG - Intergenic
1091287171 11:134413859-134413881 AGGTGCAGAAGCAGGATGGGCGG + Intergenic
1091591398 12:1845046-1845068 TCGGCCAGAAGCAGAGTGGGAGG + Intronic
1091873401 12:3913789-3913811 ATGGTAAGGAGGAGAAAGGGAGG - Intergenic
1093767372 12:22980466-22980488 AAGCTCAGAAGCAGTGTGGGAGG + Intergenic
1095748220 12:45683054-45683076 ATAGCCAGAAGTAGAATTGGTGG - Intergenic
1098203193 12:68078969-68078991 ATGGCCTGAGGCAGAATGAGGGG + Intergenic
1098798954 12:74928578-74928600 ATGTTCAGAAGTAGAATTGTTGG - Intergenic
1102248243 12:111368660-111368682 GTGATCAGCGGCAGAATGGGGGG + Intronic
1102509048 12:113402041-113402063 TTGGTCAGAGGGAGAATGAGGGG + Intronic
1103714996 12:122940059-122940081 ACGGTTAGATGCAGAAAGGGCGG + Intronic
1104067390 12:125317021-125317043 AGGGCTGGAAGCAGAATGGGGGG + Intronic
1106910373 13:34456773-34456795 ATACTCAGAAGCAGAATTGCTGG - Intergenic
1107014947 13:35700815-35700837 ATGTTCAGAAGGAGAAAGAGAGG + Intergenic
1109266063 13:60201684-60201706 AGAGTCAGAAGCAGAAAAGGAGG - Intergenic
1110145897 13:72189579-72189601 AAAATCAGGAGCAGAATGGGTGG + Intergenic
1111905949 13:94256321-94256343 ATGGGCTGGAGCAGAATGAGGGG + Intronic
1113344025 13:109456111-109456133 ATGATTAGAAGGAGAATGGAGGG + Intergenic
1113352492 13:109542969-109542991 CTGGTGAGAAGAAGAAAGGGAGG - Intergenic
1113454897 13:110441368-110441390 ATGGTCAAAAGCAGAATGCTGGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114273096 14:21116370-21116392 ATTCTTAGAAGCAGAATGGCTGG - Intergenic
1114416312 14:22547045-22547067 CTGGGCATTAGCAGAATGGGAGG - Intergenic
1114615761 14:24067532-24067554 AGGGGCAGATGCAGAATGGGTGG - Intronic
1114718457 14:24853866-24853888 ATGGACAGAAGCAGTGTGGTGGG + Intronic
1115082216 14:29468694-29468716 ATATTCAGAAGCAGAATTGCTGG + Intergenic
1115870692 14:37799406-37799428 GTGGTGAGCAGCAGAATGAGTGG - Intronic
1120188160 14:81415968-81415990 AAGGTCAGAAGCAGGGTGTGGGG + Intronic
1123420357 15:20125759-20125781 CTGGTCAGCAGTAGGATGGGAGG - Intergenic
1123445502 15:20327765-20327787 CTGGTCAGCAGTAGGATGGGAGG + Intergenic
1123529581 15:21132295-21132317 CTGGTCAGCAGTAGGATGGGAGG - Intergenic
1123940986 15:25216595-25216617 AGGCTCAGAAGCAGCCTGGGTGG - Intergenic
1124025210 15:25959501-25959523 ATGGCCAGATGCTGACTGGGAGG - Intergenic
1128494554 15:68187228-68187250 ATGCTCAGAAGCAGCAGGAGGGG - Intronic
1128993486 15:72279753-72279775 CTGGTCAAAAGCAGAAAAGGCGG - Intronic
1131735948 15:95332482-95332504 ATGCTAAGAAGAAGAATGGGAGG - Intergenic
1132608692 16:804419-804441 AAGGACAGAAGCAGGCTGGGCGG + Intergenic
1133959458 16:10480354-10480376 ATGGTGAGAAGAAGAAAGGAAGG - Intronic
1134741849 16:16554793-16554815 ATTGTGAGAAGCAGATTGTGTGG - Intergenic
1135564481 16:23500825-23500847 ATGGTCAGAAGCAAAATATTTGG - Intronic
1136721245 16:32320833-32320855 CTGGTCAGGAGTAGGATGGGAGG - Intergenic
1136839628 16:33527119-33527141 CTGGTCAGGAGTAGGATGGGAGG - Intergenic
1137043506 16:35636537-35636559 AGGGTCAGCAGCAGAATGACTGG + Intergenic
1137562081 16:49509386-49509408 AACTTCAGAAGCAGAATGAGTGG + Intronic
1138221849 16:55258411-55258433 ATTGCCAGATGCAGAATGAGAGG + Intergenic
1138869497 16:60864814-60864836 ATGCTCAGAAGCACAATGCCAGG - Intergenic
1203005187 16_KI270728v1_random:196937-196959 CTGGTCAGGAGTAGGATGGGAGG + Intergenic
1203136737 16_KI270728v1_random:1733058-1733080 CTGGTCAGGAGTAGGATGGGAGG + Intergenic
1203149794 16_KI270728v1_random:1827404-1827426 CTGGTCAGGAGTAGGATGGGAGG - Intergenic
1143883518 17:10048957-10048979 ATGGACAGGAGCAGAAAAGGAGG - Intronic
1143912767 17:10265568-10265590 ATGGTTAGAAGCAGAATTGGGGG - Intergenic
1144626435 17:16846545-16846567 AGGGTCAGAAGCTGACTGGATGG - Intergenic
1144879998 17:18426166-18426188 AGGGTCAGAAGCTGACTGGATGG + Intergenic
1145065902 17:19761151-19761173 ATAATCAGAAGCAGAATTGCTGG + Intergenic
1145152235 17:20518218-20518240 AGGGTCAGAAGCTGACTGGATGG - Intergenic
1146414488 17:32619463-32619485 ATAATCAGAAGGAAAATGGGAGG - Intronic
1146929384 17:36766954-36766976 ACTCTCAGAAGCAGCATGGGTGG + Intergenic
1147173317 17:38634690-38634712 AGACTAAGAAGCAGAATGGGTGG - Intergenic
1147534163 17:41307900-41307922 ATGGGCGGAAGTAGACTGGGCGG + Exonic
1147580582 17:41625253-41625275 AGGGTCAGAAGCTGACTGGATGG - Intergenic
1148102960 17:45103874-45103896 ATGGTGAGGAGCAGACGGGGGGG + Exonic
1149141267 17:53435936-53435958 GTGGTGGCAAGCAGAATGGGAGG - Intergenic
1149495961 17:57117688-57117710 ATGGACAGAAGCAGAGAGGAAGG - Intronic
1149829803 17:59861984-59862006 ATGGTCACATGCAGGATGGCTGG + Intronic
1150584139 17:66502157-66502179 ATGCACAGATGCATAATGGGAGG - Intronic
1151910063 17:77076661-77076683 AAGGCTAGAAGCAGCATGGGAGG + Intergenic
1152619375 17:81354344-81354366 ATGGTCACAGCCAGGATGGGTGG + Intergenic
1155448239 18:25935396-25935418 GAGCTCAGAATCAGAATGGGAGG - Intergenic
1155737026 18:29236837-29236859 AAGCTCAGAGCCAGAATGGGAGG + Intergenic
1156052946 18:32960341-32960363 ATGGTTAGAAACAGAGTGAGTGG + Intronic
1158447343 18:57532834-57532856 ATGGAGAGAGGCAGAATGGGAGG - Intergenic
1158769500 18:60498017-60498039 ATGATCAGCAACAGAATGGAGGG - Intergenic
1159069220 18:63604907-63604929 CTGGTCAGAAGCAGAAGAGCTGG - Intergenic
1160421707 18:78752105-78752127 ATGTGCGGAAGCAGAATGGACGG - Intergenic
1161777456 19:6271386-6271408 AGTTTCAAAAGCAGAATGGGAGG + Intronic
1162865668 19:13544788-13544810 AGGTTTAGAAGCAGAATTGGAGG - Intronic
1163001661 19:14372108-14372130 ATACTCAGGAGCAGAATGGCTGG + Intergenic
1163183363 19:15619340-15619362 ATGGGCAGAAGAAGAAAGGAGGG - Intronic
1163654299 19:18536900-18536922 ATGGAGAGAAGCAGAAAGTGAGG + Intronic
1164597843 19:29541825-29541847 ATGGGTAGAAGGAGAATGAGTGG + Intronic
1165548085 19:36559260-36559282 ATAGCCAGAAGCAGAATTGCTGG - Intronic
1166590315 19:43991975-43991997 ATGGACAGAAGCACAACAGGTGG - Intronic
1167458623 19:49612375-49612397 ATGATGAGAGGCAGGATGGGTGG + Intronic
1167647979 19:50716084-50716106 CTGGTCAGAAGCAGAACAGATGG + Intronic
925579044 2:5391517-5391539 ACTGTCAGAAGCAGAGTGAGTGG + Intergenic
926269259 2:11352827-11352849 GTGGTCAGAAAGAGGATGGGGGG + Intergenic
927473990 2:23398088-23398110 AGGCTCAGAAGCAGAATTGCTGG - Intronic
927845143 2:26467502-26467524 CTGGCCAGAAGCAGAAAAGGAGG + Intronic
928799165 2:35066200-35066222 AAGCTCAACAGCAGAATGGGAGG + Intergenic
928970664 2:37025133-37025155 CTGTTCAGAATCAGAATGGCAGG + Intronic
929956256 2:46460807-46460829 TAGGTCAGAAGAAAAATGGGAGG + Intronic
933956526 2:87376934-87376956 CTGGTCAGCAGTAGGATGGGAGG + Intergenic
934240670 2:90268961-90268983 CTGGTCAGCAGTAGGATGGGAGG + Intergenic
934272522 2:91547798-91547820 CTGGTCAGCAGTAGGATGGGAGG - Intergenic
935167283 2:100580566-100580588 GTGGTCAAAAGCAGAGAGGGAGG - Intergenic
936148565 2:109997709-109997731 CTGGTCAGAAGTAGGATGGGAGG - Intergenic
936196113 2:110373659-110373681 CTGGTCAGCAGTAGGATGGGAGG + Intergenic
937038018 2:118797816-118797838 ATGGTCAGGAACAGAAACGGTGG - Intergenic
939156718 2:138534226-138534248 ATCCTCAGATGCAGAATCGGTGG - Intronic
939787760 2:146538066-146538088 ATGGTCAGAGGTAGAATGTGAGG + Intergenic
943631161 2:190253957-190253979 CTGGAAAGAAGCAGAATTGGGGG - Intronic
943984531 2:194603249-194603271 AGGATCAGAACCAGAATGGAAGG + Intergenic
946394476 2:219436214-219436236 AGGGTCTGAGGCAGAAGGGGAGG + Intronic
946544931 2:220729763-220729785 ATGGCAAGAAGTAGCATGGGAGG + Intergenic
946859463 2:223986855-223986877 GTGGTCAGAAGCAGAAGGAGTGG - Intronic
948503743 2:238413591-238413613 ATGCTCAGAAGTAGAATTGCTGG + Intergenic
1168796293 20:611995-612017 AGGGTCAGAAGCAGAGAGGAGGG - Intergenic
1170791210 20:19511050-19511072 AGGGTCAGCAGCAGGGTGGGGGG - Intronic
1172128341 20:32638804-32638826 CTGGAGAGAAGCAGAAAGGGGGG + Intergenic
1172130028 20:32649504-32649526 ATGGGCAGTACCAGAGTGGGTGG + Intergenic
1173469180 20:43309426-43309448 GTGGCCAGAAGCAGACTGGATGG - Intergenic
1174707189 20:52669072-52669094 ATGCTCAGAAGCACAAAGGTTGG - Intergenic
1174716122 20:52760903-52760925 CTGGTCAGAGGGAGAATTGGTGG + Intergenic
1176133607 20:63508479-63508501 ATGCTCAGAAGCGGAATTGCTGG + Intergenic
1178147805 21:29759597-29759619 ATGATCAGAAAGAGAATGGAAGG + Intronic
1178463708 21:32826699-32826721 ATGGTTTGAAGCAGAATCTGAGG - Intergenic
1178526096 21:33330732-33330754 ATGGCCACATGGAGAATGGGAGG + Intronic
1179227813 21:39471085-39471107 ATGGACAGAAGAAGAAAGGGAGG - Intronic
1179423391 21:41253716-41253738 AAGCTCAGGAGCAGAATGAGAGG + Intronic
1180551525 22:16545475-16545497 CTGGTCAGCAGTAGGATGGGAGG + Intergenic
1181778043 22:25174010-25174032 CTGGCCAGGTGCAGAATGGGAGG - Intronic
1182013500 22:27020278-27020300 ATGGAGAGAAGCAGAAAGAGAGG + Intergenic
1182918332 22:34056069-34056091 ATGGTCAGAGGTAATATGGGCGG + Intergenic
1183134220 22:35871338-35871360 ATGGTCCGAAGCAGAAGGAAAGG + Intronic
1183244812 22:36685526-36685548 ATGGCCAGAGGCAGAACGTGTGG - Intronic
1183354642 22:37351585-37351607 ATGGTCAGAAGTCGAGAGGGTGG - Intergenic
1183758152 22:39790077-39790099 ATGTGCAGAAGGAGAAGGGGTGG + Intronic
1183984657 22:41562746-41562768 ATGCTGAGCAGCAAAATGGGAGG + Intronic
1184744761 22:46449811-46449833 AGGGTCAGGACCAGAAAGGGTGG + Intronic
1184973914 22:48047489-48047511 ATGGGGAGAAGCACAAGGGGAGG + Intergenic
949832504 3:8230545-8230567 ATGGTCAGAAGCAGGTTAGCTGG - Intergenic
950969068 3:17168441-17168463 ATGGTCAGAAGCTGGCTTGGTGG - Intronic
953447676 3:42981344-42981366 CTGGCTAGAAGCAGCATGGGAGG + Intronic
953586906 3:44209934-44209956 AGAGCCAGGAGCAGAATGGGTGG + Intergenic
954537765 3:51374194-51374216 ATGCTCAGAAGCAGAGGGTGAGG - Intronic
956033204 3:65061701-65061723 AGATTCAGAAGCAAAATGGGAGG + Intergenic
956077293 3:65519110-65519132 ACAGTAAGAAGCAGAGTGGGTGG + Intronic
956489678 3:69757518-69757540 TTGGTCAGAAGTGGAATGGTGGG + Intronic
957184409 3:76923245-76923267 GTGTTCAGAAGCAGAATGGCGGG - Intronic
961005167 3:123400403-123400425 ATTCTCAGAAGCAGAATTAGTGG - Intronic
961557693 3:127707903-127707925 AATGTCAGAAGCAGAATGTTTGG - Intronic
963306119 3:143655139-143655161 AAGCTCAGCAGCAGAGTGGGTGG - Intronic
965833406 3:172824366-172824388 ATGGCCAGAAGCAGGAGGGAGGG + Intergenic
967147866 3:186621092-186621114 CAGGACAGAAGCAGAGTGGGTGG + Exonic
967773486 3:193359918-193359940 AGGGACAGAAGCAGGGTGGGTGG + Intronic
968276425 3:197443918-197443940 ATGGGGGGAAGGAGAATGGGAGG + Intergenic
968385908 4:137371-137393 ATGCTCAGAAGTAGAATTAGTGG + Intronic
969423194 4:7109000-7109022 ATGGACAGAGGCAGATTGGAGGG - Intergenic
970302543 4:14696588-14696610 ATTATCAGGAGCAGAATGGCAGG + Intergenic
970357954 4:15276641-15276663 AAGGTCACCTGCAGAATGGGGGG + Intergenic
970410866 4:15806719-15806741 ATTGGCAGGAGCAGAATGGTAGG + Intronic
971376530 4:26060050-26060072 ATGCTCAAAAGCAGAAAGAGTGG - Intergenic
973140579 4:46763505-46763527 ATGGTCAGAAGCAGAATGGGAGG - Intronic
973602724 4:52557979-52558001 GTGGCCAGTAGCATAATGGGAGG + Intergenic
974018449 4:56671551-56671573 ATGGCAACAAGCAGCATGGGTGG - Intronic
974676626 4:65098633-65098655 ATGCCTAAAAGCAGAATGGGTGG + Intergenic
974740611 4:66001879-66001901 AAGTTCAGAAGTAGGATGGGTGG + Intergenic
977029803 4:91867764-91867786 ATGCTCAGAATCAGTATGGAGGG - Intergenic
977361176 4:96008093-96008115 ATGGAGATAAGCAGTATGGGGGG - Intergenic
982232135 4:153218997-153219019 ATAATCCAAAGCAGAATGGGGGG - Intronic
983194850 4:164795906-164795928 GTGATCAGAAGCCGAATGGAGGG - Intergenic
984683439 4:182638490-182638512 ATGGGAAGATGCACAATGGGGGG - Intronic
988354482 5:30155588-30155610 AAGGTCAGAAACAGAAGGAGTGG - Intergenic
988613672 5:32752281-32752303 TTGCACAGAAGCAGTATGGGAGG + Intronic
990203045 5:53399184-53399206 GTGGTCAGAAGGAGAATTGAGGG + Intergenic
990832448 5:59974813-59974835 ATGGAAAGAATGAGAATGGGAGG - Intronic
991201202 5:63995875-63995897 AGGGTCAGAAGAAGTATGGTTGG - Intergenic
993043446 5:82841149-82841171 AAGGTGATAAGCATAATGGGAGG + Intergenic
993453610 5:88101827-88101849 ATAGGCATAAGCAGAATGGGAGG - Intergenic
993677079 5:90829499-90829521 AAGGCCAGAAGCAGAAAGTGAGG + Intronic
995651226 5:114370738-114370760 ATGGTACCAAACAGAATGGGAGG + Intronic
996402772 5:123081157-123081179 ATTGCCAGATACAGAATGGGTGG - Intergenic
999611605 5:153376034-153376056 ATGGCTAGGAGGAGAATGGGAGG - Intergenic
1000489265 5:161889329-161889351 ATAGTCAGAAGCACAATATGGGG - Intronic
1001656578 5:173355350-173355372 ATGGTCAGAGGGAGAAGGAGTGG + Intergenic
1003514191 6:6804626-6804648 ATGGGCATGAGCAGGATGGGAGG - Intergenic
1003532784 6:6951996-6952018 ATGGTCAGAAGCTGCAGGGTAGG - Intergenic
1004469230 6:15914150-15914172 ATACCCAGAAGCAGAATGGCTGG - Intergenic
1004835767 6:19529814-19529836 ACGTTTAGAAGCTGAATGGGTGG + Intergenic
1007164696 6:39821178-39821200 ACTGTCAGGAGCAGAATGTGTGG - Intronic
1008589718 6:52981921-52981943 ATTCTCAGAAGGAGAATGGTAGG + Intronic
1009697612 6:67129493-67129515 ATGTTCAGAAGCAGATTGAGAGG + Intergenic
1011571651 6:88743803-88743825 ATTTTCAGAAGCAGAATTGCTGG + Intronic
1015096789 6:129424835-129424857 ATACACAGAAGCAGAATGGCTGG - Intronic
1017908450 6:158772747-158772769 ATGGTCAGAAGCTGGATGCTGGG - Intronic
1020711216 7:11607915-11607937 CTGGTCAGCAGCTGAATGTGAGG + Intronic
1020731137 7:11882438-11882460 ATGGAGAGAAGGAGAAGGGGAGG - Intergenic
1021733307 7:23618354-23618376 ATGGGAAGACCCAGAATGGGGGG - Intronic
1022119175 7:27290662-27290684 ATGGTAAGAAGCAGATTTGGTGG + Intergenic
1022256159 7:28660719-28660741 ATGGGAAGAAGAAGAAAGGGAGG - Intronic
1028007283 7:85590833-85590855 ATTGTCATAATCTGAATGGGAGG - Intergenic
1029906457 7:104098373-104098395 ATTGTCAGATACAGAATAGGTGG + Intergenic
1031839476 7:126720062-126720084 AAGGTAAGAAGCAGAAGGAGAGG - Intronic
1033845644 7:145428588-145428610 GGGTTCAGAAGCAGAATGGAGGG + Intergenic
1034503481 7:151467412-151467434 AGGGTCAAAAGCACAATCGGAGG - Intronic
1035268354 7:157704708-157704730 GGAGTCAGAAGCAGAATGAGGGG + Intronic
1035655851 8:1304055-1304077 AAGGTCAGCAGCAGAATTGGGGG + Intergenic
1038780346 8:30564608-30564630 ATGGGCAGGAGCAGGTTGGGGGG - Intronic
1041215508 8:55596280-55596302 ATGGACAGAAGCAGCCTTGGAGG + Intergenic
1042711321 8:71720527-71720549 ATGGGAAGAAGCACAGTGGGTGG - Intergenic
1044071498 8:87766181-87766203 ATGTTCAGAAGTGGAATTGGTGG + Intergenic
1044267561 8:90201396-90201418 ATGGTGGCAACCAGAATGGGTGG - Intergenic
1044816923 8:96122997-96123019 ATACTCAGAAGCAGAATTGCTGG + Intergenic
1048687947 8:136925413-136925435 ATGGACAAAAACAGTATGGGAGG + Intergenic
1049364274 8:142229179-142229201 ATGGACAGATGGTGAATGGGTGG + Intronic
1051532139 9:18116296-18116318 ATGGTAAGAAGCAGAAAGTCAGG + Intergenic
1053043189 9:34891929-34891951 ATGGTCAGATGGAGAATGTGGGG + Intergenic
1053124282 9:35567077-35567099 ATGGTGAGAAACAAAAGGGGTGG + Intergenic
1058609605 9:106761405-106761427 ATGGACATAAACAGAATGGAGGG - Intergenic
1059126846 9:111697116-111697138 ACTGTCAGCAGGAGAATGGGAGG + Intronic
1060133363 9:121127330-121127352 ATGCTCAGAAGCAGAACTGTGGG + Intronic
1203791202 EBV:152646-152668 CTGGTCAGAGCCAGACTGGGTGG + Intergenic
1186144545 X:6611626-6611648 ATGGCCAGAAAAAGACTGGGAGG - Intergenic
1187021617 X:15388363-15388385 ATGGTAAGAGGCAGAAGGGCAGG + Intronic
1187380751 X:18799444-18799466 ATGGTCAAAAGCTGGAAGGGAGG + Intronic
1187678018 X:21737313-21737335 ATGATCAGAAAGAGAATGGCAGG + Intronic
1188037882 X:25338700-25338722 ATGTTTAGAAGCAGATTGGCTGG - Intergenic
1188713665 X:33433643-33433665 AAGTTCAGAGTCAGAATGGGAGG + Intergenic
1189259261 X:39666555-39666577 AGGGTCTTGAGCAGAATGGGAGG + Intergenic
1192090352 X:68148519-68148541 ATGGTAACAAGCAGAATATGAGG + Intronic
1192313612 X:70035613-70035635 ACGGACAGAGGCAAAATGGGGGG - Exonic
1192962180 X:76142944-76142966 AAGGTCAGAGGCTGAATGTGAGG + Intergenic
1192963353 X:76152143-76152165 AAGGTCAGAGGCTGAATGTGAGG - Intergenic
1193069920 X:77296483-77296505 ATGGTCAGAATGACAGTGGGGGG + Intergenic
1193966854 X:87998271-87998293 TTGGTCTGAAGCAGGATGTGAGG + Intergenic
1195255334 X:103084293-103084315 ATGTTCAGAAGGAGAACAGGGGG - Intronic
1195289685 X:103420196-103420218 ATGGTGAAAGGCAGAGTGGGAGG + Intergenic
1202051049 Y:20781183-20781205 AGGGTCAGAGGAAGAACGGGTGG - Intergenic