ID: 973142685

View in Genome Browser
Species Human (GRCh38)
Location 4:46788012-46788034
Sequence GTTTAGGACTTCAGGGACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973142678_973142685 11 Left 973142678 4:46787978-46788000 CCCAACTCCTTCCTCTATAGCTT 0: 1
1: 0
2: 3
3: 31
4: 279
Right 973142685 4:46788012-46788034 GTTTAGGACTTCAGGGACGAAGG 0: 1
1: 0
2: 0
3: 6
4: 93
973142676_973142685 20 Left 973142676 4:46787969-46787991 CCTCTGATCCCCAACTCCTTCCT 0: 1
1: 1
2: 3
3: 56
4: 535
Right 973142685 4:46788012-46788034 GTTTAGGACTTCAGGGACGAAGG 0: 1
1: 0
2: 0
3: 6
4: 93
973142677_973142685 12 Left 973142677 4:46787977-46787999 CCCCAACTCCTTCCTCTATAGCT 0: 1
1: 0
2: 4
3: 22
4: 280
Right 973142685 4:46788012-46788034 GTTTAGGACTTCAGGGACGAAGG 0: 1
1: 0
2: 0
3: 6
4: 93
973142681_973142685 0 Left 973142681 4:46787989-46788011 CCTCTATAGCTTTCTTGTATGTA 0: 1
1: 0
2: 0
3: 9
4: 185
Right 973142685 4:46788012-46788034 GTTTAGGACTTCAGGGACGAAGG 0: 1
1: 0
2: 0
3: 6
4: 93
973142679_973142685 10 Left 973142679 4:46787979-46788001 CCAACTCCTTCCTCTATAGCTTT 0: 1
1: 0
2: 1
3: 33
4: 328
Right 973142685 4:46788012-46788034 GTTTAGGACTTCAGGGACGAAGG 0: 1
1: 0
2: 0
3: 6
4: 93
973142680_973142685 4 Left 973142680 4:46787985-46788007 CCTTCCTCTATAGCTTTCTTGTA 0: 1
1: 0
2: 1
3: 27
4: 280
Right 973142685 4:46788012-46788034 GTTTAGGACTTCAGGGACGAAGG 0: 1
1: 0
2: 0
3: 6
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973142685 Original CRISPR GTTTAGGACTTCAGGGACGA AGG Intronic
901459446 1:9382987-9383009 GGTGAGGACTGCAGGGATGAGGG - Intergenic
903461545 1:23524429-23524451 GGTTGGGAACTCAGGGACGACGG + Exonic
911041551 1:93594847-93594869 TGTTAGGACATCAGGGAGGAAGG - Intronic
918475040 1:184915489-184915511 GTTTAGTACTTCTGGGGTGATGG + Intronic
919472985 1:198001653-198001675 GTTTAGCACTACAGGGAAGTGGG - Intergenic
919973957 1:202598965-202598987 GTTTAGGACTTGAAGGACCATGG - Intronic
1063202634 10:3799089-3799111 GGTTAGGACTTCCAGGACTATGG + Intergenic
1069171989 10:65243036-65243058 GTTTAAGAATTCAGGTACTATGG - Intergenic
1070665963 10:78343650-78343672 GTTCAGGATTTCAGGGAAGAAGG - Intergenic
1074505364 10:114065323-114065345 GTATAGGACTTCAGGAACCCAGG + Intergenic
1074920366 10:118002656-118002678 GCCCAGGACTTCAGGGATGATGG - Intergenic
1075523491 10:123161159-123161181 TTTAAGGACTTGAGGGAGGAGGG - Intronic
1079175336 11:18135068-18135090 GTGCAGGACTCCAGGGACCAGGG + Intronic
1080956989 11:37109460-37109482 GTTTAGGAGTTCAGGAGGGAAGG - Intergenic
1082784079 11:57307312-57307334 ATTGAGGACTGCAGGGACGAGGG - Intronic
1084690050 11:70719890-70719912 TTTAAGGACTTCAGGGAAGGTGG - Intronic
1089849231 11:121482129-121482151 GTTTTGGACTTGAAGGAGGAGGG + Intronic
1090571701 11:128054152-128054174 GTTTAAGAATTCAGGAAAGAGGG + Intergenic
1090935263 11:131335859-131335881 GTTAAGGGCTTCAGGGATGTTGG + Intergenic
1091062569 11:132477406-132477428 GATGAGGACTTCAGGAAAGAGGG + Intronic
1092522464 12:9288802-9288824 GTTTAAGACTTTAGGCACGGTGG - Intergenic
1097534384 12:60847979-60848001 CTGTGGGACTTCAGGGACAAGGG + Intergenic
1101661092 12:106766264-106766286 GTTTAGAACTTGAGGGTGGAAGG - Intronic
1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG + Intergenic
1120766066 14:88327164-88327186 CTTCTGGACTTCAGGGAAGAAGG - Intergenic
1122837906 14:104439545-104439567 GTTCAAGACTTCAGGGAAGCAGG - Intergenic
1124009372 15:25824606-25824628 GTTTAGGAAGTCAGTGAAGATGG + Intronic
1124036649 15:26059303-26059325 GTTCAGGACTTCAGTGAAGGTGG + Intergenic
1125626772 15:41115785-41115807 GGTTGGGACCTCAGGGACTAGGG - Intronic
1127183988 15:56458613-56458635 TTTTAGGATTTTAGGGAGGAAGG - Intronic
1129187040 15:73914580-73914602 CCTTAGGGCTTCAGGGACAATGG - Intergenic
1129607843 15:77033479-77033501 GTTCAGGCCTTGAGTGACGAAGG + Intronic
1131449507 15:92527706-92527728 GGTTAGGACTTCAGAGGTGAAGG - Intergenic
1132282997 15:100636138-100636160 GTTTATGGCTTCAGTGACTACGG + Intronic
1134345225 16:13384417-13384439 CTTGAGGACTTCAGGGGCCATGG + Intergenic
1138932584 16:61678494-61678516 CTTTAGGGCGTCAGGGACAAAGG - Intronic
1141287594 16:82687102-82687124 GTTTAGGATTTCAGGGCTGCAGG + Intronic
1141992481 16:87618448-87618470 CTGTAGGACAGCAGGGACGATGG - Intronic
1142194685 16:88733950-88733972 GAGGAGGACTCCAGGGACGAGGG - Exonic
1144154344 17:12484382-12484404 TTTGAGGACTTCAGGGACCACGG - Intergenic
1148579812 17:48735789-48735811 GTTTAGGACTTGAGGGGCCAGGG - Intergenic
1150301615 17:64051934-64051956 GCTGAGGTCTTCAGGGATGAAGG + Intronic
1150645035 17:66972549-66972571 GTTTAGGGTTGCAGGGACAAAGG + Intronic
1152230761 17:79112921-79112943 GGGTAGGACTTCAGGGATGGTGG + Intronic
1156245438 18:35293476-35293498 CTGTAGGTCTTCAGGGACCAGGG + Intergenic
1159908212 18:74117873-74117895 GTCTAGAACTTCAGAGAAGAGGG - Intronic
1160831069 19:1105058-1105080 GTTCAGGTCTTCAGGGCCGCAGG + Intronic
1162892903 19:13746940-13746962 GTTTGGGGCTTCTGGGAGGATGG + Intronic
1163187920 19:15652731-15652753 ATTGAGGACCTCAGGGAGGATGG - Intronic
1167724506 19:51201178-51201200 GCCTAGGACCTGAGGGACGAGGG - Intergenic
1168617455 19:57850106-57850128 GTTTAGGACCTGGGTGACGATGG - Intronic
1168625706 19:57916322-57916344 GTTTAGGACCTGGGTGACGATGG + Intronic
1168642965 19:58041955-58041977 GTTCAGGAGTTCAAGGAAGAAGG + Intronic
926631634 2:15141956-15141978 GTTTATGACTTCAGAGTCAATGG - Intergenic
932165956 2:69507223-69507245 GATGAGGACTTCAGGGCCCATGG + Intronic
940397663 2:153210191-153210213 GTTTAGGACCTCTGGTACAATGG + Intergenic
948763871 2:240209625-240209647 GTTTAGGCCTCGAGGGACGCTGG - Intergenic
1170085916 20:12531385-12531407 GTTTTGAACTTGAGGGAAGAAGG + Intergenic
1170985823 20:21257306-21257328 GGGAAGGACTTCAGGGAAGAGGG + Intergenic
1173180042 20:40799394-40799416 ATTTTGGACTTCATGGACCAGGG - Intergenic
1179071946 21:38079820-38079842 GTCTAGGTCTTCAGAGACAAGGG + Intronic
951036705 3:17940270-17940292 GATTAGGATTTTAGGGAAGAGGG + Intronic
951322185 3:21258549-21258571 GTTTATGACTTGAAGGAGGATGG + Intergenic
951935296 3:28016310-28016332 GCTTATGACTTCAGGGTCTAGGG - Intergenic
952181591 3:30922072-30922094 GGTTAGAACTTCTGGAACGAAGG - Intergenic
958471291 3:94524040-94524062 GTTTAGGATATCGGGGATGAGGG + Intergenic
962015774 3:131438873-131438895 GTTTAGGACTTGAGGAGAGAAGG + Intergenic
966893511 3:184425496-184425518 GTTGTGGACTTCAGGGAGGGAGG + Intronic
968986457 4:3877942-3877964 GCTGAGCACTTCAGGGACAAAGG + Intergenic
972908521 4:43783846-43783868 GATTGGGACTTCAGGGCTGAAGG + Intergenic
973142685 4:46788012-46788034 GTTTAGGACTTCAGGGACGAAGG + Intronic
973302964 4:48609776-48609798 GTTTAGAACTTCATGAACTAAGG + Exonic
978993419 4:115117671-115117693 GTTTATGCCTTCAGGGAGCAGGG + Intergenic
981285862 4:143018984-143019006 GTTAAGGTCTTCAGTGACAAAGG + Intergenic
987550998 5:19381436-19381458 GTTTATGTCTTCAGAGAGGATGG + Intergenic
994597113 5:101853601-101853623 GGTTAGGACTTCTGGTACTATGG - Intergenic
996622292 5:125521842-125521864 AGTTAGGACTTAAGGGACTAAGG - Intergenic
997639425 5:135438950-135438972 CTTAAGGCCTTCAGGGAAGATGG + Intergenic
997703354 5:135922816-135922838 GTTTAAGACATCATGGAGGAAGG - Intronic
998491359 5:142550008-142550030 GTTCAGGAATTCAGTGACTAAGG + Intergenic
1003831394 6:10016024-10016046 TTTTAGGACAGCAGGGAGGATGG - Intronic
1007237229 6:40399374-40399396 GGTTTGGATTTCAGGGATGATGG - Intronic
1008966607 6:57319167-57319189 GTTCAGGAATTCAGGGTGGATGG + Intronic
1009598150 6:65763156-65763178 CTTTAGGACTTTAGGAACCAAGG + Intergenic
1020250407 7:6463669-6463691 GTTTGGGACTGCAGTGAGGAAGG + Intronic
1020955625 7:14737069-14737091 GTTTTGGACTGCAGGAACAATGG + Intronic
1023213444 7:37833047-37833069 GTTTAGGTCCTCAGGGGCCATGG + Intronic
1023981812 7:45074784-45074806 GTGTAGGACTTCAAGGCGGAAGG + Intronic
1031419195 7:121529405-121529427 ATTTAGTACATCAGGGACTAAGG - Intergenic
1031506049 7:122585009-122585031 GTTTAGGACTTCTGAGTCAAGGG + Intronic
1033107403 7:138540611-138540633 GTTCAAGACTTCAGTGAAGAAGG - Intronic
1033282933 7:140018457-140018479 GTCTAGGACCTCAGGAATGAAGG - Intronic
1034026616 7:147711540-147711562 ATTTAGGAGGTCAGGAACGATGG + Intronic
1036156531 8:6347390-6347412 GGTTGGGACTTCACGGAGGAAGG - Intergenic
1043612362 8:82080641-82080663 GTTTAGAAGTGCAGGGACGCAGG + Intergenic
1052327735 9:27233507-27233529 GTTGAGGTCTTCAGAGACAATGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1058732520 9:107863830-107863852 GTTTAAGACTTAAGGGACCAGGG + Intergenic
1195618914 X:106934033-106934055 GAATAGGACTTCAGAGAGGACGG - Intronic
1196898360 X:120359864-120359886 GGTTAGGTCTTCAGGGACTCTGG - Intergenic