ID: 973143678

View in Genome Browser
Species Human (GRCh38)
Location 4:46798576-46798598
Sequence AGCTTTCTGCAGATCATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 2, 2: 0, 3: 21, 4: 359}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973143678_973143680 4 Left 973143678 4:46798576-46798598 CCTGCCATGATCTGCAGAAAGCT 0: 1
1: 2
2: 0
3: 21
4: 359
Right 973143680 4:46798603-46798625 TCCTTTTGAAAAATAGCTCTTGG 0: 2
1: 6
2: 50
3: 326
4: 706
973143678_973143682 15 Left 973143678 4:46798576-46798598 CCTGCCATGATCTGCAGAAAGCT 0: 1
1: 2
2: 0
3: 21
4: 359
Right 973143682 4:46798614-46798636 AATAGCTCTTGGCCTGCTACTGG 0: 3
1: 12
2: 50
3: 260
4: 350
973143678_973143683 16 Left 973143678 4:46798576-46798598 CCTGCCATGATCTGCAGAAAGCT 0: 1
1: 2
2: 0
3: 21
4: 359
Right 973143683 4:46798615-46798637 ATAGCTCTTGGCCTGCTACTGGG 0: 5
1: 25
2: 225
3: 263
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973143678 Original CRISPR AGCTTTCTGCAGATCATGGC AGG (reversed) Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
901923754 1:12553257-12553279 AGCTTTCAGCAGATTGTGGAGGG - Intergenic
903347761 1:22698200-22698222 ACCTTTGAGCAGATCCTGGCTGG - Intergenic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
911252851 1:95597884-95597906 TTCTGTCTGCAGATCATGGCTGG + Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911375675 1:97047849-97047871 TGCTCTCTGCTGTTCATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912754791 1:112315015-112315037 AGCTTTCTGCGCACCTTGGCTGG - Intergenic
916607781 1:166359910-166359932 AGCTTTTTACAGACCCTGGCAGG - Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918477724 1:184943070-184943092 AGCTTTCAGCAGATCATTAAAGG - Intronic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
922099276 1:222468689-222468711 CGCTTGCTGAAGATCATGACCGG - Intergenic
923434485 1:233955408-233955430 AGCTCTCTGCTCATCTTGGCCGG + Intronic
924800064 1:247322902-247322924 AGCTTTGTGCAGACGATAGCAGG - Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063593212 10:7411339-7411361 AACTTTCTGCAGATCATGTATGG - Exonic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067437954 10:46292151-46292173 AGCTCTCTGCAGCTCAGGGGAGG - Intronic
1068034016 10:51737645-51737667 AGATTTCTTGAGATCAGGGCAGG - Intronic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069328795 10:67265236-67265258 AGCCTTCAACTGATCATGGCTGG - Intronic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073064697 10:100751072-100751094 GGCTGTCTGCAGTTCAGGGCTGG + Intronic
1073096593 10:100983868-100983890 AGCTGTCTCCAGATCATCCCTGG + Exonic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1076565048 10:131392937-131392959 AGCTTTCTGATGAACAGGGCTGG + Intergenic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081072774 11:38631093-38631115 AGATGTCTGCAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1086960018 11:92971792-92971814 AGGTTTCTGCAGACCCTGCCAGG - Intronic
1086960569 11:92976143-92976165 AGCTTTCTGGAGATAAAGACAGG - Intronic
1087272405 11:96124838-96124860 TTCTTTTTGCAAATCATGGCAGG - Intronic
1087936259 11:104037249-104037271 AGCATGCTGCGGATCAGGGCGGG - Exonic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090436205 11:126688567-126688589 AGCTTTCTGCAGAGAATGATTGG + Intronic
1090616943 11:128522995-128523017 AGCTTACGGAAGCTCATGGCTGG - Intronic
1091554527 12:1562482-1562504 AGCTTTCTGAAGAGCACGGAGGG - Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1092533837 12:9367707-9367729 AGCTTTCTGTAGATTATCGGGGG - Intergenic
1092922543 12:13245519-13245541 AGCTGTCTACAGATGACGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094819396 12:34212699-34212721 GGTTATCTGCAGATAATGGCAGG - Intergenic
1095095414 12:38145375-38145397 GGTTATCTGCAGATAATGGCAGG + Intergenic
1095121508 12:38424871-38424893 AGTTTTCTGCAGAAAATGCCAGG + Intergenic
1095190258 12:39250137-39250159 AGCTATCTACAGAGGATGGCAGG - Intergenic
1095308052 12:40661646-40661668 ATCCTTCTTCATATCATGGCAGG - Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1096911787 12:54991181-54991203 ATCGTTCTGCAGTTCATTGCTGG - Intergenic
1097051689 12:56227018-56227040 AGATATCTGCAGCCCATGGCTGG - Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1101973049 12:109330726-109330748 AGTTTCATGCAGATCATGCCTGG + Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1107175744 13:37395738-37395760 TGCTGGCTGCAGATCTTGGCTGG - Intergenic
1107200470 13:37709950-37709972 AGATTGCTGCATATCATGGAAGG + Intronic
1108132474 13:47317644-47317666 AGCTTTCTTTAGAGAATGGCAGG + Intergenic
1109712683 13:66180849-66180871 AGTTTTCTACAGAAGATGGCAGG + Intergenic
1109955392 13:69558836-69558858 AGCTGACTGGAGATCAGGGCAGG - Intergenic
1110866949 13:80407159-80407181 TGCTGGCTGTAGATCATGGCTGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117219398 14:53587077-53587099 AGCTTCCTGAAGATGATGTCTGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118325707 14:64779064-64779086 AGCCTTCTGCAGGTCAGGGCTGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119480501 14:74955196-74955218 TGCTTCCTGCAGCTCCTGGCCGG - Exonic
1119867849 14:77989065-77989087 CCCTTTCTGCAGATCTGGGCTGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120522789 14:85544214-85544236 AGCTTGCTGCTGATCAAGGTTGG - Intronic
1121310013 14:92930622-92930644 ACCTTTCTGCAGATCATTTTGGG + Intronic
1122141613 14:99666414-99666436 AGCTCCCAGCAGATCACGGCTGG + Intronic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1127217326 15:56837253-56837275 AACTTCCTGGAGATCATGTCTGG - Intronic
1127299388 15:57637955-57637977 CACATCCTGCAGATCATGGCTGG + Intronic
1127329783 15:57927474-57927496 AGCTTTCCTCAGATCAGGGTGGG + Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127914622 15:63445293-63445315 AGCTTTCTGGAGCTCACGGCTGG + Intergenic
1130091622 15:80825810-80825832 AGCTATCTGCAGATCTTAGTTGG - Intronic
1130952134 15:88600664-88600686 AGGTTGCTGCAGATCTTGCCTGG - Intergenic
1131398714 15:92107682-92107704 TGCTGTCTGCAGAGCATGGCAGG - Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1132048695 15:98588825-98588847 AAGTTTCTGTAAATCATGGCAGG - Intergenic
1133095653 16:3443391-3443413 CGCTTTCTGCAGCTCCTGTCAGG - Exonic
1134250198 16:12568911-12568933 ACCTTTCTGTAGTTCAGGGCTGG + Exonic
1135625999 16:23995469-23995491 AGCTATCTGTGGATTATGGCAGG - Intronic
1136020947 16:27439753-27439775 GGCTAGCTGCAGATCCTGGCAGG - Intronic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1142696604 17:1637400-1637422 AGCTTTTTGCAGGACCTGGCAGG + Intronic
1145282915 17:21480754-21480776 AGCTTTCTGTAGGTCACGCCAGG - Intergenic
1145394562 17:22485036-22485058 AGATTTCTGTAGGTCATGCCAGG + Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146401691 17:32504764-32504786 AGCTGTCTGCAGAGCATTCCGGG - Intronic
1146634951 17:34496993-34497015 ATCTGCCTGCAGATCTTGGCTGG - Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151064687 17:71136095-71136117 CCCTCTCTGCAGACCATGGCTGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155543864 18:26894173-26894195 GGCTTTCTTCTGTTCATGGCTGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1158409132 18:57188994-57189016 AGCTTTTTGCAGAGGATGTCTGG - Intergenic
1159259883 18:66000736-66000758 AGCATTCTGCATTTCATGTCAGG + Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1162043402 19:7983892-7983914 AGCTTTCGGCAGCTCAGGGTAGG + Intronic
1162283867 19:9723206-9723228 GGGATCCTGCAGATCATGGCAGG - Intergenic
1162567205 19:11451040-11451062 AGCTTTCTGCAGATCCCACCCGG + Intergenic
1163170074 19:15525179-15525201 AGCTGGTTGGAGATCATGGCTGG + Intronic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164100066 19:22046863-22046885 AGCTTCCTGCAGCTCATAGGCGG - Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164930830 19:32174556-32174578 TGCTTTCTGCAGCTCCAGGCTGG + Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
927442355 2:23128154-23128176 AGATTCCTGCAGACCCTGGCTGG - Intergenic
930219145 2:48727972-48727994 AGCTTGCTTTAGACCATGGCAGG - Intronic
932026077 2:68134255-68134277 TGCTTTCTGCATATCTAGGCAGG - Intronic
933540644 2:83637623-83637645 AGCTTTCTGCAGCATATGGTTGG - Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935633400 2:105231063-105231085 AGCTATCTGCAGATCACATCTGG + Intergenic
937300617 2:120837896-120837918 AGCTTTCTGTTAAGCATGGCAGG + Intronic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
942987905 2:182163965-182163987 AGTTATCTGCAGATGATGCCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943840802 2:192577897-192577919 AGCTTTCTCCAGATGTTGCCAGG - Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945642175 2:212443808-212443830 ACTTATCTGCAGAACATGGCAGG - Intronic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946790918 2:223299731-223299753 AGTTATCTGCAAATGATGGCAGG - Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948583585 2:239004451-239004473 GGCTCTCTGCAGCTCCTGGCAGG - Intergenic
1174483821 20:50849082-50849104 AGCTTCCTGCTGACCATGCCAGG + Intronic
1176273489 20:64248612-64248634 AGCTTTCTGCTCAGCATGGGGGG + Intergenic
1176422631 21:6528195-6528217 AGCTTTCTGCAGACCATGGCAGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176870521 21:14080129-14080151 GGTTATCTGCAGATAATGGCAGG - Intergenic
1177470044 21:21548709-21548731 AGCTATCTTCAGATAATGCCAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1179698124 21:43136511-43136533 AGCTTTCTGCAGACCATGGCAGG - Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181367439 22:22388973-22388995 AGCTACCTGCAGAAGATGGCAGG + Intergenic
1184382383 22:44153277-44153299 AGCTAACTGCAGTTCATGGTTGG + Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
950004128 3:9680547-9680569 ATCTTCCTGCAGCCCATGGCCGG + Intronic
950978320 3:17274539-17274561 GGATTTCTCCAGATAATGGCTGG + Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952976739 3:38703000-38703022 AGATATGTGCAGATCAAGGCAGG - Intronic
954532581 3:51333580-51333602 AGCTGTCTCCAGAGCAGGGCAGG + Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957368789 3:79263350-79263372 AGCTTTCTCAAGATCAGGGCTGG + Intronic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959814328 3:110657899-110657921 AGCTTTCAGCAGATCCAGCCAGG + Intergenic
960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG + Intergenic
961869017 3:129974917-129974939 AGCTTCCTGGAGAACAGGGCCGG + Intronic
964297669 3:155251891-155251913 AGTTATCTGCAGATGATGGGAGG - Intergenic
964669586 3:159210090-159210112 TGCTTCCTTCAGATCATGGCAGG - Intronic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
964723565 3:159791540-159791562 AGCTTTCTGCAGCTGCTGGAGGG + Intronic
965076436 3:163983540-163983562 AGCTATCTGTAGATCATGCAAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966548688 3:181181074-181181096 AACTTTCTGCACAGCAAGGCTGG - Intergenic
966627469 3:182033805-182033827 AGCTTTCTGTAGACCATGGTAGG - Intergenic
966661310 3:182417979-182418001 AGTTATCTGCAAATGATGGCAGG - Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972805913 4:42529297-42529319 AGTTACCTGCAGATTATGGCAGG - Intronic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973143678 4:46798576-46798598 AGCTTTCTGCAGATCATGGCAGG - Intronic
974986838 4:69037917-69037939 AGCTTTTTGCATATGATGGTTGG + Intronic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
976088177 4:81427714-81427736 TGCTTCCTGCAGATCATGGAGGG - Exonic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977847096 4:101779251-101779273 AGCAATCTGCAGATGATGTCAGG + Intronic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
979062938 4:116089033-116089055 AGCATTCTGCAAATGTTGGCTGG - Intergenic
979404636 4:120294688-120294710 AGCCTTCTGCAGATGATGGAGGG + Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
981990928 4:150920135-150920157 ATCTTTCTGCAGATACTGCCAGG + Intronic
982354484 4:154451268-154451290 AGTTGTCTGCAGAGAATGGCAGG - Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983071848 4:163277168-163277190 AGCTTTCAGAACATTATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986913657 5:12588895-12588917 AGCTATCTGCAGCTCATGTAGGG - Intergenic
987010562 5:13758924-13758946 GGCTTTCTGCAGATCCTGCATGG + Exonic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG + Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG + Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG + Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
999108590 5:149095248-149095270 AGCTCTATGGAGAGCATGGCGGG + Intergenic
999321743 5:150619524-150619546 TGCTGTCTGCAGAGCAGGGCGGG + Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001820043 5:174703385-174703407 AGCTCCCTGCAGATCATGGTGGG + Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1004532989 6:16471641-16471663 AGCTTTCAGTAGAGCATGTCAGG + Intronic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1007246528 6:40467310-40467332 AGCTTTCTCCAGATCCTGTCTGG + Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009305825 6:62088626-62088648 AGCTTTCTGTAGACCACTGCTGG + Intronic
1009442537 6:63698304-63698326 AGCCTTCTGCAGATCAGATCAGG + Exonic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1014066297 6:117130410-117130432 AGAGTTCTGCTGATCCTGGCTGG - Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014538833 6:122649790-122649812 AGCTGTCTTCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1019787890 7:2990407-2990429 TGTTTTCTGCAAATAATGGCAGG - Intronic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024633906 7:51271158-51271180 TGCTTTCTCCATATAATGGCAGG + Intronic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028202970 7:87984255-87984277 AGCTGTCTGCAGGTCACTGCAGG - Intronic
1029276889 7:99410880-99410902 ACCTTTCTGAAGATCACAGCGGG + Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030382474 7:108828127-108828149 ACCTTTCTGCAGCACTTGGCAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1038926353 8:32144176-32144198 AGCTTCCAGCAGATCATGGTCGG - Intronic
1039362918 8:36899767-36899789 AGTTTTCTGCACAACATGGAAGG + Intronic
1040480395 8:47820909-47820931 AGCTTGCTGCGGATCATGTAAGG + Exonic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042060712 8:64814131-64814153 TATTTTCTGCAGATCATGACTGG - Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042700760 8:71611191-71611213 ATATTTCTGCAGATCTTAGCAGG - Intergenic
1042949831 8:74189492-74189514 AACTTCCTGCAGAACAGGGCTGG + Intergenic
1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG + Intergenic
1043931540 8:86097119-86097141 AGCTTGCAGCAGACCATGGCAGG - Intronic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046746346 8:117880401-117880423 AGATTTCTGAAGTTCATGACAGG + Intronic
1046831818 8:118754628-118754650 ATCTTTCTGCACATGGTGGCTGG + Intergenic
1048662641 8:136622841-136622863 AGCCTTCTGCAAATCATAGCTGG + Intergenic
1049584498 8:143426660-143426682 AGCTTTCTCCGCAGCATGGCCGG - Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051486397 9:17613333-17613355 AGTTTTCAGCAGAGCATGGATGG - Intronic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1052658013 9:31390208-31390230 AGCCATTTGCAGATCATTGCAGG + Intergenic
1053455470 9:38230313-38230335 GGCTTGCTCCAGATCAGGGCAGG + Intergenic
1055553896 9:77456382-77456404 AGTTTTCTGCACATCTTGCCTGG + Intronic
1055608615 9:77997685-77997707 AGCAGTCTGCAGCTCAAGGCTGG + Intronic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056937393 9:90926757-90926779 ATCTTTCAGCAAATCAAGGCTGG - Intergenic
1057791257 9:98126678-98126700 AGCTGGCTGCAGAAGATGGCTGG - Exonic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058629280 9:106969881-106969903 AGCTATCTGGGGATCCTGGCTGG + Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188250939 X:27893550-27893572 AGTGTTCTGCAGATCAGGACTGG - Intergenic
1190527882 X:51346279-51346301 AGTTATATGCAGAGCATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194649419 X:96497840-96497862 AGTTATCTGTAGATAATGGCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG + Intronic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1198741516 X:139848063-139848085 AGATTTCATCAGATGATGGCAGG - Intronic
1198946918 X:142026079-142026101 ATCTTTCTTCATATCATGACAGG + Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1201765801 Y:17572653-17572675 GGTTATCTGCAGATAATGGCAGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1201835751 Y:18333336-18333358 GGTTATCTGCAGATAATGGCAGG + Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic