ID: 973145731

View in Genome Browser
Species Human (GRCh38)
Location 4:46823165-46823187
Sequence CCCACCCAGCAGAACCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973145731_973145735 8 Left 973145731 4:46823165-46823187 CCTCCAAGGTTCTGCTGGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 184
Right 973145735 4:46823196-46823218 ACTATTTCCAAAATTCCATCCGG 0: 1
1: 0
2: 0
3: 21
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973145731 Original CRISPR CCCACCCAGCAGAACCTTGG AGG (reversed) Intronic
900179074 1:1303484-1303506 CCCTCCCAGCCGAGCCGTGGCGG - Intronic
900516171 1:3083255-3083277 CCCACCAAGCAGCAACCTGGCGG + Intronic
902614465 1:17616280-17616302 CCCACCCAGCATGACCTCTGGGG - Intronic
903806469 1:26009310-26009332 CACACCCAGCAGAGCCTCAGGGG - Intergenic
904699213 1:32348336-32348358 CCCACCCATGAGCTCCTTGGGGG - Intergenic
912457641 1:109808499-109808521 CCCACCCAGCAGAGCATTCCTGG + Intergenic
916838994 1:168580190-168580212 CCCACCCAGCACAACTTCTGAGG - Intronic
920122123 1:203666542-203666564 TCCACCCAACAAAACCTAGGAGG - Intronic
921075200 1:211695059-211695081 CCCACCCTACAGATTCTTGGAGG + Intergenic
921609637 1:217195742-217195764 CTGACGCAGCAGAACCCTGGAGG + Intergenic
1063025495 10:2174722-2174744 CTCAACCAGCATAACCTTGAAGG - Intergenic
1063594444 10:7421124-7421146 TGCATCCAGCAGAACCATGGGGG - Intergenic
1063702583 10:8400092-8400114 CACACCCAGCAGAACCAAAGAGG - Intergenic
1064220856 10:13439460-13439482 CCCACCCGGCAGAACAGTGCAGG + Exonic
1065663051 10:28026053-28026075 TCCACCCAGCAGAGCCAAGGAGG - Intergenic
1065663063 10:28026106-28026128 ACCACCCTGTAGAACCTTGGGGG - Intergenic
1065966379 10:30774410-30774432 CCCAGTCAGCAGACACTTGGTGG + Intergenic
1072410360 10:95196240-95196262 CCTACCCAGCAGAAGCTTCCAGG + Intronic
1076007024 10:126956025-126956047 CCATCCCAGCACAGCCTTGGAGG - Intronic
1076711842 10:132340393-132340415 CCCACCCAGCAGCACGTGAGTGG + Intronic
1077193438 11:1266015-1266037 CCCTCCCATCAGAAACCTGGAGG - Intergenic
1077382447 11:2250446-2250468 CCCACCCAGGAGGACCTAGCAGG + Intergenic
1079695561 11:23478010-23478032 CCCACCCATCAGGACCTGGGAGG - Intergenic
1082159955 11:48880106-48880128 CCCAGCCAGCAGCACCATGCCGG - Intergenic
1082162825 11:48902164-48902186 CCCAGCCAGCAGCACCATGCTGG + Intergenic
1082175214 11:49050142-49050164 CCCAGCCAGCAGCACCATGCCGG + Intergenic
1082658040 11:55874567-55874589 CCCAGCCAGCAGTACCATGCCGG + Intergenic
1085469519 11:76748347-76748369 CCCTCTCACCAGAACCTGGGAGG - Intergenic
1085768888 11:79307797-79307819 CCCACCTGGAAGATCCTTGGTGG - Intronic
1086690550 11:89785941-89785963 CCCAGCCAGCAGCACCATGCCGG - Intergenic
1086715248 11:90053718-90053740 CCCAGCCAGCAGCACCATGCCGG + Intergenic
1086964940 11:93017943-93017965 TGCACCCAGCAAAACCATGGGGG - Intergenic
1089630948 11:119783767-119783789 CCCTCCCAACAGCACCTGGGAGG - Intergenic
1090837048 11:130461477-130461499 CCCACCCGGCAGGACCTGTGTGG + Exonic
1091590803 12:1842063-1842085 CCCAGCCAGCAGAGGCTTGTAGG + Intronic
1092284846 12:7122752-7122774 GCCACCCAGCAGAAGCTCTGAGG - Intergenic
1094836236 12:34323404-34323426 CCTTCCCAGCAGCACCTTCGTGG - Intergenic
1095477075 12:42596458-42596480 CCCACCCATCAGACCCTTCGAGG - Intergenic
1095676802 12:44929288-44929310 TTCACCCAGTAGAACCTAGGTGG + Intergenic
1096487991 12:51996514-51996536 GCCCTGCAGCAGAACCTTGGCGG + Intronic
1103561990 12:121797628-121797650 CCCTCCCAGCTGCACCCTGGAGG - Intronic
1104598533 12:130136755-130136777 CACAACCAGCAGAAACTAGGAGG + Intergenic
1105045908 12:133002989-133003011 CCCACCCTGGAGACCCTAGGTGG + Intronic
1107092139 13:36493344-36493366 CTCAGCCTGCTGAACCTTGGGGG - Intergenic
1108485226 13:50917022-50917044 CCCTCCCAGCAGACACTGGGGGG - Intronic
1112644821 13:101318235-101318257 CCCACCTGGCTCAACCTTGGTGG - Intronic
1113861379 13:113489979-113490001 CACACCCAGCAGCACCTTGCTGG + Intronic
1114227576 14:20753005-20753027 ACCAACCAGCAGCAGCTTGGTGG + Intergenic
1118388722 14:65279242-65279264 CACACACAGCAGACCCGTGGGGG - Intergenic
1119167156 14:72503930-72503952 TGCACCCAGCAGAGCCATGGTGG - Intronic
1120415817 14:84216838-84216860 AACACCCAGCAAAGCCTTGGGGG + Intergenic
1121314807 14:92954553-92954575 CCCTCCCTGTAGAACGTTGGTGG - Intronic
1122480619 14:102044812-102044834 CACACCCAGCATAACCAGGGAGG - Intronic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1125031043 15:35076474-35076496 TCCACCCAGCAGGAGCGTGGTGG - Intergenic
1126792332 15:52232401-52232423 CCCACCCAGCAGAAGCTTTATGG + Intronic
1126859205 15:52868085-52868107 TCCAGCAAGCAGAACCTTGATGG - Intergenic
1128108722 15:65062867-65062889 CCCTCCTAGCAGAACCTTCGAGG + Intronic
1128864301 15:71102393-71102415 GAAACCCAGCAGAACCTTAGGGG - Intronic
1132146771 15:99433808-99433830 CCCGCTGAGCAGAACCTGGGGGG + Intergenic
1132353411 15:101154563-101154585 CCCACCCAGCCCAACCCTGATGG - Intergenic
1133113861 16:3564935-3564957 CCCAGCCAGCAGATCCATGAGGG + Exonic
1134205317 16:12232884-12232906 CCCACCCAGCATGGGCTTGGAGG + Intronic
1135669351 16:24361885-24361907 CACGCCCAGCACAGCCTTGGGGG + Exonic
1136144165 16:28306025-28306047 CCCTCCCTGCAAAACCATGGTGG - Intronic
1136873093 16:33825453-33825475 GCTTCCCAGTAGAACCTTGGTGG + Intergenic
1137909371 16:52360916-52360938 CCCACCCAGCAGAGCTGTGGAGG + Intergenic
1138234964 16:55374418-55374440 CCCACCCAACAGATCCCTTGTGG + Intergenic
1140241845 16:73209357-73209379 CCCACCCTCCAGACCCATGGGGG - Intergenic
1140899914 16:79358033-79358055 GCCACCAAGCAGTACCTTGCAGG + Intergenic
1142005881 16:87689431-87689453 CCCACCCCACAGACACTTGGAGG - Intronic
1142102818 16:88284668-88284690 CCCACCCTGCAGAGTGTTGGTGG - Intergenic
1203099079 16_KI270728v1_random:1290602-1290624 GCTTCCCAGTAGAACCTTGGTGG - Intergenic
1145043265 17:19592576-19592598 ACCTCCCAGGAGAACCTGGGTGG - Intergenic
1148490171 17:48018340-48018362 ACCACAGAGGAGAACCTTGGGGG - Intergenic
1151310709 17:73291001-73291023 ACCACCCAGCACATCCTTGCGGG + Intronic
1151558857 17:74860444-74860466 CTCACCCAGCAGCTCCTTGCAGG + Intronic
1151975001 17:77479740-77479762 CCTCCCCAGCAGGACCTGGGGGG - Intronic
1152206478 17:78977163-78977185 CACACCCAGAAGAGCCTCGGAGG + Exonic
1153199564 18:2634650-2634672 TCCACCCACCAGAAACTTGCAGG + Intergenic
1153951086 18:10058299-10058321 ACCACCCAACTGAGCCTTGGTGG - Intergenic
1156252571 18:35365086-35365108 CCAACCCTGCAGAATTTTGGAGG - Intergenic
1157294987 18:46435822-46435844 CCCACCCAGCACTGCCTTGCTGG - Intronic
1157761575 18:50269168-50269190 CCCACCCAGAAAAAACTTGCTGG - Exonic
1160826603 19:1083131-1083153 CCCACCCCGCAGGATCGTGGAGG + Exonic
1162923877 19:13919853-13919875 CCCACCCAGCAGAGTCTGGTGGG + Exonic
1164720153 19:30426009-30426031 CCCTCCCAGCAGAGCAGTGGTGG + Intronic
1165063877 19:33218171-33218193 CCCACCAAGCAGAAGCATGGTGG - Intronic
1166068557 19:40374613-40374635 CACACCCAGCAGTACCTGTGAGG - Exonic
1167870605 19:52366794-52366816 CACACCTAGCACAACATTGGAGG + Exonic
1168160002 19:54503778-54503800 CCCACCCAGCACTGCCTTTGGGG - Intronic
925542960 2:4986103-4986125 CCCTGCCAGCAGAACTTTTGTGG - Intergenic
926122847 2:10254239-10254261 CCAGGCCAGCAGAACCTGGGAGG - Intergenic
926619329 2:15033026-15033048 ACTATCCAGCAGAACCCTGGGGG + Intergenic
927906642 2:26863205-26863227 TCCACACAGCTGAACATTGGAGG - Intronic
928768889 2:34681606-34681628 CCCACCCACCAGAGCCTTAGTGG + Intergenic
929799112 2:45084169-45084191 TGGACACAGCAGAACCTTGGTGG - Intergenic
930714200 2:54577329-54577351 TCTACCCAGAAGAGCCTTGGGGG - Intronic
932701788 2:73997183-73997205 CCCACCCAGCAGTAATTAGGAGG - Intronic
933667507 2:84975504-84975526 CCCACCCTACAGACCCTTAGTGG + Intronic
934711977 2:96522363-96522385 CACACCCAGCAGAAGCTGGAGGG - Intergenic
936341571 2:111638319-111638341 CCAAGCCAGCAGAGCCCTGGTGG + Intergenic
942903781 2:181156538-181156560 CTCAGCCAGGAGAATCTTGGAGG - Intergenic
948084605 2:235236873-235236895 ACCACCCAGTAGACCCTTGAGGG + Intergenic
948175200 2:235937796-235937818 CACACTCAGCAGCACCCTGGTGG - Intronic
1169430408 20:5531303-5531325 CCCACACAGCTGAACCTGGCTGG - Intergenic
1170418437 20:16168966-16168988 CCCAGCCAGCAGAGCCTCTGTGG - Intergenic
1171132394 20:22665752-22665774 CCCACCCAGCAAAGCCATAGAGG - Intergenic
1172294469 20:33798812-33798834 CCAACCCAGCAGAACTTGAGGGG - Intergenic
1172791705 20:37510386-37510408 CCCACCCACCCAAACCTGGGAGG - Intronic
1173069796 20:39752339-39752361 CTCAACTAGCAGAACCTAGGTGG - Intergenic
1173815874 20:45987701-45987723 TCCTCCCAGCAGAACCTTCTGGG + Intergenic
1175769770 20:61616338-61616360 CCCTTCCTGCAGCACCTTGGGGG + Intronic
1175851033 20:62093095-62093117 CCTGCCCAGCAGAGCCCTGGGGG + Intergenic
1176022002 20:62966785-62966807 CCCACCCTGCAGCACCTCGGTGG - Intronic
1179536202 21:42054435-42054457 CCCAGGCAGAAGACCCTTGGAGG + Intergenic
1180002289 21:45000726-45000748 CCCATACCGCAGAATCTTGGGGG + Intergenic
1180788473 22:18559984-18560006 CCTAACCACCAGAACCCTGGGGG + Intergenic
1181233264 22:21435334-21435356 CCTAACCACCAGAACCCTGGGGG - Intronic
1181245386 22:21499509-21499531 CCTAACCACCAGAACCCTGGGGG + Intergenic
1181764918 22:25084521-25084543 CACACCCTGCAGAATCTGGGAGG - Intronic
1182279039 22:29207598-29207620 CCCACCCAGGAGACCCTGGGAGG - Intronic
1182284192 22:29234325-29234347 GCTGCCCAGCAGAGCCTTGGGGG - Exonic
1183044404 22:35208173-35208195 AAAGCCCAGCAGAACCTTGGGGG - Intergenic
1183585596 22:38751234-38751256 CCCACCCAGGAGCTCCCTGGAGG - Exonic
1183929070 22:41225786-41225808 TCCATCCAGGAGAACCTGGGGGG - Exonic
1184389866 22:44197101-44197123 AGCACCCAGCAGAACCCAGGTGG - Intronic
1184718012 22:46292900-46292922 TCCACCCTGCAGAACCTCAGTGG + Exonic
949464452 3:4329620-4329642 CCCTCCCATCAGAAACCTGGAGG - Intronic
950903077 3:16514053-16514075 CCCAGCCATCAGCACCTTGATGG - Intergenic
953244076 3:41175012-41175034 CCCACCCTGGAGATCCTTAGGGG - Intergenic
954119776 3:48490401-48490423 ACCACCCAGCAGAGCCATGGGGG + Intronic
954752264 3:52820253-52820275 ACCACCCAGCACAGCCTTTGAGG + Intronic
955391628 3:58526398-58526420 TCCACCCAACAGAAGCTTGGTGG + Intronic
956167842 3:66409840-66409862 CAAACCCAACAGGACCTTGGGGG + Intronic
965616351 3:170596711-170596733 CCCACCTTCCAGAACTTTGGTGG - Intronic
965641210 3:170830723-170830745 CCCACACAGAAGAATTTTGGTGG + Intronic
967806319 3:193717181-193717203 CCATCCCAGCAGCACCTTGCAGG - Intergenic
971382372 4:26110742-26110764 CACACCCACCAGCACCGTGGAGG - Intergenic
973145731 4:46823165-46823187 CCCACCCAGCAGAACCTTGGAGG - Intronic
976068023 4:81212293-81212315 CCCCCCCAGCAGAATGTTCGCGG + Intronic
983550552 4:169012900-169012922 CCTACCCAGCAGGACATTGAAGG + Intergenic
985480240 5:105678-105700 CAAAGCCAGCAGACCCTTGGAGG + Intergenic
985660041 5:1152445-1152467 CTCACCCAGCAGGACCGAGGGGG + Intergenic
987649540 5:20722843-20722865 CCCACACAGCTGAATCTTTGAGG - Intergenic
988746022 5:34138687-34138709 CCCACACAGCTGAATCTTTGAGG + Intergenic
992731613 5:79675591-79675613 CCCACGCAGCTGAACATGGGTGG - Intronic
998888568 5:146721429-146721451 CCCACACAGAAGAATCTTGAGGG + Intronic
999954650 5:156687266-156687288 CCCACCCAGCACAAATGTGGGGG + Intronic
1000841227 5:166220924-166220946 ACCACTCAGCAGAACATTGAAGG + Intergenic
1001954331 5:175838033-175838055 ACCACCCAGAAGAATCTTTGAGG - Intronic
1002027665 5:176406372-176406394 CCCACCCATGAGAACCTCTGTGG + Intronic
1002517967 5:179773614-179773636 CCCACAGAGCAGAAATTTGGTGG + Intronic
1003232814 6:4270080-4270102 CCCACCCACCAGCTCCTAGGGGG + Intergenic
1003326876 6:5098733-5098755 CACACCCATCAGTACCATGGCGG + Intergenic
1006734665 6:36264556-36264578 CCCTCCCAGGAGAACCAGGGAGG - Intronic
1007591014 6:43021008-43021030 CCTTCCCAGCAGAACCTGGCTGG - Exonic
1008641301 6:53465416-53465438 CCCACCCAGGAGAACCCAGCGGG - Intergenic
1017823462 6:158064905-158064927 CCCAACCAGCAGCAGCTTGATGG - Exonic
1018728151 6:166628994-166629016 CCCTCCCAGCAGAACCTTAAAGG - Intronic
1019017489 6:168890517-168890539 CCGACCCAGCAGAACCCCGTGGG + Intergenic
1020028389 7:4915968-4915990 GCCGCCCAGCAAACCCTTGGCGG - Intronic
1020085435 7:5307770-5307792 CCCACGCAGCAGCAGCCTGGAGG + Exonic
1020676061 7:11186334-11186356 CCCACCTACCATCACCTTGGGGG - Intergenic
1022088922 7:27095456-27095478 CGCCCCCAGCATAACCCTGGTGG + Exonic
1026015293 7:66667070-66667092 CCCCTCCACCAGAGCCTTGGAGG - Intronic
1026826773 7:73587376-73587398 CTCACACAGCAGGACCTGGGAGG + Intergenic
1027395252 7:77747093-77747115 CCCACTCTGCAGTACCCTGGTGG + Intronic
1030988467 7:116270493-116270515 CCCATCCAGAAGAACTTTGCAGG + Intergenic
1031976017 7:128094033-128094055 CCCTACCAGAAGCACCTTGGAGG - Intergenic
1034466994 7:151235676-151235698 TCCTCCCAGCAGCACCTTAGAGG + Intronic
1034676196 7:152894447-152894469 CCCGCCCTCCAGAACCTTGGGGG - Intergenic
1034718012 7:153261747-153261769 CCCACACAGCAGAACCATGTGGG - Intergenic
1034747663 7:153537296-153537318 TCCACTCAGCAGAATCTTAGGGG + Intergenic
1035017942 7:155782624-155782646 GCCACCCGGCAGGACCCTGGGGG + Intergenic
1035064419 7:156094837-156094859 TCCACCGAGCAGAAGCTTCGCGG + Intergenic
1039412683 8:37368502-37368524 CCCACAAAGCAGAAACATGGAGG + Intergenic
1040286009 8:46100751-46100773 CCCACCCAGGACAGCCCTGGGGG + Intergenic
1040304895 8:46206907-46206929 CCCACCCAGGACAGCCTTAGTGG - Intergenic
1040315044 8:46256540-46256562 CCCACCCAGGACAGCCCTGGGGG - Intergenic
1040331009 8:46385754-46385776 CCCACCCAGGACAGCCTTTGGGG - Intergenic
1040342118 8:46446347-46446369 CCCACCCCGGACAGCCTTGGGGG + Intergenic
1043134354 8:76502570-76502592 ACCACCCAGCAGAAGCATGATGG + Intergenic
1048999726 8:139817100-139817122 CCCAGCCTGCAGCACCCTGGGGG - Intronic
1052695476 9:31871986-31872008 CCCACAGAGCTGAACCTGGGTGG + Intergenic
1060412019 9:123406074-123406096 CCCACCCCCCAGAAGCTTGTGGG + Intronic
1060828492 9:126699774-126699796 GCCACCCAGCAGAAGCCTGTGGG + Exonic
1061916231 9:133755863-133755885 CCCACCAATCAGAACCCTTGTGG - Intergenic
1062011277 9:134268186-134268208 CCCACCAAGCAGATCCTGGTGGG + Intergenic
1062151817 9:135023443-135023465 ACCTCCCATCAGAACCATGGTGG - Intergenic
1062609397 9:137367208-137367230 CCTGCCCAGCAGTGCCTTGGGGG + Intronic
1187216986 X:17286806-17286828 CCCCCCGAGCAGTCCCTTGGGGG - Intergenic
1190740278 X:53284040-53284062 CCCAGCATGCAGAGCCTTGGAGG + Intronic
1191177309 X:57517557-57517579 CACTCCCAGCAGATCTTTGGAGG - Intergenic
1192201102 X:69067308-69067330 CCCACCCAGCTCAACCTCAGTGG + Intergenic
1192697927 X:73437685-73437707 CCCTCCCATCATAAGCTTGGAGG - Intergenic
1194220422 X:91183122-91183144 CCCTCCCATCACAAGCTTGGAGG + Intergenic
1195914013 X:109917748-109917770 CCAACCAAACTGAACCTTGGAGG + Intergenic
1200081148 X:153577050-153577072 CCCAAACAGCAGAATGTTGGGGG + Intronic
1200132419 X:153858072-153858094 CCCAGCTAGCAGAGCCTAGGAGG + Intergenic
1200556933 Y:4646874-4646896 CCCTCCCATCACAAGCTTGGAGG + Intergenic