ID: 973147763

View in Genome Browser
Species Human (GRCh38)
Location 4:46849203-46849225
Sequence GGGGAGAAACTGATGGCGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973147763_973147769 -1 Left 973147763 4:46849203-46849225 CCTTGCGCCATCAGTTTCTCCCC 0: 1
1: 0
2: 0
3: 9
4: 168
Right 973147769 4:46849225-46849247 CAGGTTTTGCTCCATCATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973147763 Original CRISPR GGGGAGAAACTGATGGCGCA AGG (reversed) Intronic
900146695 1:1161732-1161754 GGGGAGGGACTGTTGGGGCAAGG + Intergenic
900255504 1:1696275-1696297 GGGCAGAAACCGATGACTCAAGG - Intronic
900264066 1:1748506-1748528 GGGCAGAAACCGATGACTCAAGG - Intergenic
901519907 1:9775550-9775572 GTGGAGATACTGCTGGCTCAGGG - Intronic
902043937 1:13511803-13511825 GGGCTGAAAGTGATGGCTCAGGG + Intronic
902518143 1:17000697-17000719 GCGGAGAAACTGAGGGCCCTGGG - Intronic
902980251 1:20117615-20117637 TGGGAGAAACAGATGGCAGAAGG + Intronic
904493703 1:30875357-30875379 GGGGAAACAGTGATGGGGCACGG - Intronic
905585721 1:39116172-39116194 GGAGAAAAATTGATGGAGCATGG + Intronic
906951209 1:50335649-50335671 GGGGAGAAAAAGATGGAGGAGGG + Intergenic
907278245 1:53328523-53328545 AGGGAGAAGCTGGGGGCGCAGGG + Intergenic
907420208 1:54342118-54342140 GGAGAGGTACTGATGGCCCAAGG + Intronic
908011574 1:59783621-59783643 GGGGAGAAACAGAAAGCGCCAGG + Intergenic
911089043 1:94002776-94002798 AGGGAGGAACTGCTGGGGCAGGG - Intronic
911601274 1:99850316-99850338 GGGGAGAAACAGAAGGGGAAGGG - Intronic
915199719 1:154218222-154218244 GGAGAGAAACTGTTGGACCATGG + Intronic
920086814 1:203423442-203423464 GGGGACAAACTTATGGAGTATGG + Intergenic
923115925 1:230937869-230937891 AAGGAGAAACTGATTGCCCATGG + Intronic
1063795415 10:9508737-9508759 GTGGAGGAACTGAAGGCTCATGG + Intergenic
1064102797 10:12477731-12477753 GGGAAGAAGCTGAAGGCGGAGGG + Intronic
1064920019 10:20505808-20505830 GAAGAAAAACTGATGGCCCAGGG + Intergenic
1065421281 10:25547179-25547201 GGGGAGAGACTGAAGGCGAGAGG - Intronic
1065814851 10:29474112-29474134 GGGGAGAAACCGTTGGCACCTGG + Intronic
1069948794 10:72005510-72005532 AGGGAGAAACTGATGGAGGTGGG + Intronic
1072189065 10:93066061-93066083 CGGGAGGAGCTGGTGGCGCAGGG + Exonic
1072463260 10:95639771-95639793 GGGGGAAAACTGATGGAGAAGGG - Intronic
1073186301 10:101617211-101617233 GATGAGAAAATGAAGGCGCAGGG + Intronic
1073522281 10:104144184-104144206 GGAGAGAAGCTCATGGCCCAAGG + Intronic
1077445066 11:2587018-2587040 GGGGAGCCTCTGATGGCACATGG - Intronic
1077477374 11:2796845-2796867 GGTGAGAAAACGATGGGGCAGGG + Intronic
1077923229 11:6656272-6656294 GGGGAGAAAATGATGGAGATGGG - Intergenic
1077978518 11:7275155-7275177 AGGGAGAATCTGCTGGAGCAGGG - Intronic
1078093482 11:8282435-8282457 GGGCAGATGCTGATGGCCCAGGG - Intergenic
1081782047 11:45719810-45719832 GGAGAAAACCTGATGGAGCATGG - Intergenic
1083750327 11:64757535-64757557 GGGGAGACACTGGGGGAGCAGGG + Intronic
1083783723 11:64931941-64931963 GAGGAGAAACTGAGGGCAAAGGG - Intronic
1084705383 11:70813330-70813352 GGGGAGAAATGGATGCCACACGG + Intronic
1085490353 11:76910559-76910581 GAGGAGAAAATTAAGGCGCAAGG + Intronic
1088117302 11:106327197-106327219 GGGAAGGAATTGGTGGCGCAAGG + Intergenic
1091147040 11:133289017-133289039 AGGGAGAAACTGAGGGCCCTGGG + Intronic
1092287895 12:7140251-7140273 GGGGAGAAACTGAGGGAGTTGGG + Intronic
1096980515 12:55725958-55725980 GGGAAGAGACTGATGGACCAAGG - Intronic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1098980684 12:76952518-76952540 AGGGAGATAGTGATGGTGCATGG + Intergenic
1099055914 12:77840436-77840458 GAGGAGAATATGATGGAGCAAGG + Intronic
1100262703 12:92948006-92948028 GAGGAGAAACTAATGGAGTAAGG + Intergenic
1102029181 12:109730243-109730265 GGTAAGAAACTGGTGGAGCAGGG - Intronic
1103072579 12:117957123-117957145 GAGGAGAAACAGAGGGCGAAGGG - Intronic
1103170849 12:118818454-118818476 GGGGAAAAACTGAAGGCAGAAGG + Intergenic
1104360599 12:128129346-128129368 GGGGAGAATCTGATGACTCAAGG - Intergenic
1105951689 13:25234853-25234875 GTGGAGAAAGTGCTGGCCCAAGG - Intergenic
1107808351 13:44175571-44175593 AGGGAGAATCTGTTTGCGCAGGG - Intergenic
1108775317 13:53758626-53758648 GTGGAGAAAATGAAGGCTCATGG + Intergenic
1108863075 13:54886376-54886398 GGGAAGAAACTGCTGTAGCATGG - Intergenic
1110064876 13:71091118-71091140 GGAGAGAAACAGATGGTGAAAGG + Intergenic
1117325500 14:54665473-54665495 GGGGAGCAACTGATGGCTACTGG + Intronic
1117536455 14:56707558-56707580 GAGGAGAATCTGCTGGAGCAGGG - Intronic
1117538437 14:56723786-56723808 GGGGATAAAGGGATGGGGCAGGG + Intronic
1120355259 14:83425245-83425267 GTGGAGAAACTTATGGCCAAAGG + Intergenic
1120625926 14:86826432-86826454 AAGGAAAAACTGATGGTGCAGGG + Intergenic
1122146367 14:99691275-99691297 GGGGAGGAACTGCTGGGGCTGGG - Intronic
1122981480 14:105194156-105194178 GGGGAGAGACTGACGGCGGCTGG - Intergenic
1123479031 15:20614106-20614128 ATGGAGAAGCTGATGGGGCAGGG + Intergenic
1123638981 15:22386279-22386301 ATGGAGAAGCTGATGGGGCAGGG - Intergenic
1130863416 15:87910698-87910720 GGAGAGAAACCAATGGAGCAGGG + Intronic
1132067777 15:98746533-98746555 GGGAAGACACTCATGGAGCAGGG - Intronic
1132955892 16:2593324-2593346 GGGGTGCAGCTGATGGCCCATGG + Intronic
1137930271 16:52580549-52580571 GGGGAGAAACTGATGAATTAAGG + Intergenic
1139173936 16:64663932-64663954 GGGAAGAATCTGATGGCTTAGGG - Intergenic
1140403372 16:74690364-74690386 GGAGAGAAAATGATGGGCCATGG - Intronic
1145843026 17:28012277-28012299 GGAGAGAAACTGAGGGAGAAAGG + Intergenic
1146165465 17:30584949-30584971 GGGGAGGGACTGCTGGTGCAAGG + Intergenic
1153219112 18:2846977-2846999 GGGGAGAAGCGCAGGGCGCACGG + Intergenic
1155130978 18:22933902-22933924 GGGGAGAAATGGATGGAGAAGGG + Exonic
1158425829 18:57338843-57338865 GAGGAGAAACTAATGCCTCATGG + Intergenic
1158552345 18:58446658-58446680 GGGGAGGAGCTGAGGGCTCAGGG + Intergenic
1160622089 18:80178818-80178840 TGGGAGGAAGTGATGGGGCAGGG - Intronic
1161241084 19:3224502-3224524 GGGGGGAAACTGAGGCCGGAAGG - Intergenic
1161841020 19:6680341-6680363 GTGGAGAAACTGAAGGATCAAGG + Intronic
1165118723 19:33545447-33545469 GGGGAGGAAGTGATTGGGCAGGG + Intergenic
1165473131 19:36014777-36014799 AGGGAGAACCTGAAGGCCCAGGG - Exonic
1166971076 19:46568316-46568338 GGGGAGAGGCTCATGGGGCAAGG - Intronic
925069811 2:957329-957351 GGGGAGCAACGGATGGGGAACGG + Intronic
927904239 2:26846180-26846202 CGGCAGAAACTGAAGGAGCAAGG + Intergenic
930136169 2:47905847-47905869 GGGGAGACGCTGAGGGCGGAGGG + Intergenic
930525248 2:52520854-52520876 GAGGAGAAACTGCAGGGGCAAGG + Intergenic
932056556 2:68449093-68449115 GGGCAGAAGCTGGTGGTGCAGGG - Intergenic
932176218 2:69605146-69605168 GGGGACAAACTGCTGGGGTAGGG - Intronic
932299445 2:70655844-70655866 AGGGAGAAACTGATGGCTTTGGG + Intronic
932825098 2:74931941-74931963 GGGGAGAAATTGATGATGTAGGG + Intergenic
936118997 2:109725395-109725417 GGGGAGAAACCCATGGTGCTTGG + Intergenic
937338370 2:121075821-121075843 GGAGAGAAACTGAGGGGGCAGGG - Intergenic
940057882 2:149532354-149532376 AGGGGGAAAGTGATGGCGCTGGG + Intergenic
940488636 2:154328764-154328786 TGGGAGAAAATGTTGGAGCAAGG - Intronic
941865034 2:170325633-170325655 GGGGAGGAACTGGTCGTGCATGG + Intronic
942173259 2:173307789-173307811 TGGGGGAAACTGGTGGGGCAAGG + Intergenic
947839977 2:233201582-233201604 GGGGAAACACTGATGGTGCTTGG - Intronic
1170359237 20:15526404-15526426 GGGGCTAAACTGATGAGGCAAGG + Intronic
1170361108 20:15547391-15547413 GGGGAAAAAATGATGGCGATAGG - Intronic
1172907032 20:38378023-38378045 GGGGAGAAATACATGGAGCATGG + Intergenic
1173049699 20:39547289-39547311 GGGGGGAAAGTGATGACTCAAGG - Intergenic
1173280330 20:41621228-41621250 GGGGAGGAACTGAAGGGGAAAGG + Intergenic
1175164578 20:57034166-57034188 GGCAGGAAACTGATGGCACAGGG + Intergenic
1176024563 20:62979053-62979075 GGGGAGAAAATGGTGGCACGGGG - Intergenic
1177513764 21:22121993-22122015 GGGGAGGACCTGAAGGAGCAGGG - Intergenic
1179889186 21:44327162-44327184 GGGGAGACGCTGAGGGCCCATGG - Exonic
1181068606 22:20319061-20319083 AGGTGGAAACTGATGGTGCAGGG + Intronic
1181072258 22:20352571-20352593 GTGGAGAAACTGAAGGGCCAAGG + Intronic
1181685741 22:24526824-24526846 GGGCACAAACTGATGGCTGATGG - Intronic
1181845308 22:25702970-25702992 GTGGAGAATCTGCTGGTGCACGG + Intronic
1183972643 22:41489505-41489527 GGGAAGAAAGTGCTGGGGCAGGG - Intronic
1184928051 22:47658161-47658183 GGGGAGAAAATGAAGCCTCAGGG + Intergenic
950095236 3:10325163-10325185 GGGGGGAAGATGATGGCACAGGG + Exonic
950305504 3:11912981-11913003 GGGGAAAAAATGGTGGGGCATGG - Intergenic
951443425 3:22748672-22748694 GGAAAGAAACTGAGGGGGCAAGG + Intergenic
952428068 3:33195398-33195420 GGGGAGAAACTGCTGGGGGATGG + Intronic
953007297 3:38990250-38990272 GGGGAGAAACTGCTGGGCCCCGG + Intergenic
954051983 3:47987063-47987085 TGTGAGAAACTGAGGGCGCAGGG - Intronic
954423055 3:50428725-50428747 AGGAAGAAACTGAGGGGGCAGGG + Intronic
959689910 3:109187628-109187650 GGGGAGTCACTGATGGCCCTAGG - Intergenic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
965554749 3:170007405-170007427 GGAGAGAAACTGAAGACACATGG + Intergenic
967245221 3:187479864-187479886 TGAGAGAAACTGATGGTGGAAGG + Intergenic
972138014 4:35917260-35917282 TGGCAGAAACTGATGGTCCAAGG + Intergenic
973147763 4:46849203-46849225 GGGGAGAAACTGATGGCGCAAGG - Intronic
974076124 4:57170153-57170175 GAGGTCAAACTGATGGAGCATGG + Intergenic
975514277 4:75228267-75228289 GGGGAGAGAATGAGGGCACAGGG - Intergenic
976144597 4:82029972-82029994 AGGCAGAAACTGATGGAGCTAGG - Intronic
986169306 5:5303081-5303103 GGTGAGAAACAGCAGGCGCAGGG + Intronic
988318449 5:29661344-29661366 GGGGAGAAAATTCTGGGGCAAGG + Intergenic
990540865 5:56771259-56771281 GGGGAGAAGCTGCTGGATCAGGG + Intergenic
994784339 5:104136863-104136885 GGCAAGAAACAGATGGTGCATGG - Intergenic
995813931 5:116144908-116144930 GGGGAGAAAATGATGCAGAATGG + Intronic
997692916 5:135839106-135839128 GGGAAGAAACTGAGGGAGAAAGG - Intronic
999442511 5:151613465-151613487 GCGGAGAACCTCATGGAGCAAGG - Intergenic
1000265562 5:159632926-159632948 AGGGAGAAAATGCTGGCTCAGGG + Intergenic
1001586304 5:172835395-172835417 GTGGTGAAACTGAGGGCGCTCGG - Intronic
1006105809 6:31715623-31715645 AGGGAGAAACTGAGGACTCACGG - Exonic
1006188301 6:32192522-32192544 GGGGAGAAACTGGTGGGGGAGGG + Exonic
1006296948 6:33173977-33173999 GGAGAGAAACAGGTGGCTCAAGG - Intronic
1023351396 7:39323498-39323520 AGGTAGAAGCTGATGGTGCATGG - Intronic
1025214332 7:57043222-57043244 AGGGAGAAACTGGTGGCACAGGG - Intergenic
1025657621 7:63533591-63533613 AGGGAGAAACTGGTGGCACAGGG + Intergenic
1025829566 7:65038048-65038070 GGGGAGAAAGGGGTGGGGCAGGG - Intergenic
1025916803 7:65872997-65873019 GGGGAGAAAGGGGTGGGGCAGGG - Intergenic
1026830423 7:73607058-73607080 GGGGGGAAAGTGATGGAGGATGG - Intronic
1026981683 7:74530307-74530329 GGGGAGGCAATGATGGGGCAGGG + Intronic
1027877706 7:83791962-83791984 TGGGTGAAACTCATGGCACAAGG - Intergenic
1028969535 7:96842379-96842401 GGGGAGAGAGGGATGGGGCAAGG - Intergenic
1029160046 7:98545046-98545068 GGGGTGACACTGAGGGAGCAAGG - Intergenic
1029262922 7:99315539-99315561 TGGCAGAAATTGATGGCACACGG + Intergenic
1029898081 7:104007585-104007607 GGGGAAAAACTGAGGGAGAAGGG - Intergenic
1030187330 7:106776908-106776930 GGGGAAAAACTGATGACATAGGG + Intergenic
1032530263 7:132614525-132614547 GGGGAGGCACTGAAGGCTCAGGG + Intronic
1032728764 7:134616784-134616806 AGGGAAAAACTGATGATGCAGGG + Intergenic
1034128960 7:148698724-148698746 GGGGAGAAGCTGTTGGGGGAGGG - Intronic
1034383801 7:150721211-150721233 GGGGACAAACGCATGGCACAGGG + Exonic
1039687276 8:39817340-39817362 GGGGAGGAACGGATGGGGAAAGG + Intronic
1041986707 8:63930573-63930595 AAGGTCAAACTGATGGCGCAAGG + Intergenic
1043141779 8:76599424-76599446 GGTGAGAAACTGATGAGACAGGG + Intergenic
1044506709 8:93028847-93028869 GGGGATAGAGTGATGGAGCAGGG - Intergenic
1044735138 8:95271196-95271218 GGGGAGACAATGTTGGGGCAAGG + Intergenic
1048256261 8:132907289-132907311 GGGGAGAGGCTGATGGGGCAGGG - Intronic
1048438335 8:134439076-134439098 GGTGAGAAATTCATGGCCCATGG + Intergenic
1049444793 8:142624946-142624968 GGGGAGAGACTGAGGGCTCTAGG - Intergenic
1051680480 9:19602707-19602729 AGGTAGAAACTGATGGAGCTGGG - Intronic
1060224468 9:121782745-121782767 GGGGACAGCCTGATGGGGCAGGG + Intronic
1061290645 9:129648858-129648880 GGGGAGAAACTGAGGTAGCAGGG + Intergenic
1061585911 9:131568242-131568264 GGAGAGACACTGCTGGCGGAAGG - Intergenic
1186250301 X:7658787-7658809 AGGGAGAAACTGATGGGCCCAGG + Intergenic
1186883967 X:13894021-13894043 GGGGAGAACTTGCTGGCGCCAGG + Intronic
1190391181 X:49933319-49933341 GGGGAGAAATTGGTGGGGAATGG + Intronic
1193018822 X:76767717-76767739 GGGGAAAAAGTGATGGGGGAGGG - Intergenic
1194429376 X:93782223-93782245 GGGCAGAAAATGATGGGGCTGGG + Intergenic
1198683369 X:139204422-139204444 GGGCAGAAGCTGAGGGCGCGGGG - Intronic
1200254023 X:154569697-154569719 GAGGAGAAAATGATGGTGCTCGG - Intergenic
1200263746 X:154634711-154634733 GAGGAGAAAATGATGGTGCTCGG + Intergenic
1201902352 Y:19056565-19056587 GGATAGAAACTGACGGCACAGGG + Intergenic