ID: 973148005

View in Genome Browser
Species Human (GRCh38)
Location 4:46853064-46853086
Sequence CTAGAAACACACATAAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 998
Summary {0: 1, 1: 12, 2: 117, 3: 217, 4: 651}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973148005 Original CRISPR CTAGAAACACACATAAAACA AGG Intronic
901177203 1:7312990-7313012 GTATAAACACACAGAAAAAAAGG - Intronic
901290797 1:8122790-8122812 CAAGAAACAGCCATAAAACTGGG - Intergenic
902034222 1:13445000-13445022 ACAGTAACATACATAAAACAAGG - Intergenic
902123520 1:14188505-14188527 ATAGAGACACACACAAAAGAAGG + Intergenic
903551139 1:24157966-24157988 CTAGAAACAGACCTCAGACAAGG + Intronic
903568759 1:24288486-24288508 ATAGAATCACACATAAAACAAGG - Intergenic
904377113 1:30088648-30088670 CTAAAAACACACAAAAAATTAGG - Intergenic
904637739 1:31896819-31896841 GTACAAACACACATAACACCTGG + Intergenic
905419867 1:37834063-37834085 CTAAAAACACAAAAAAAACCTGG + Intronic
905439166 1:37982793-37982815 CTAGAAGAACACATAAATCTGGG + Intronic
905696556 1:39978952-39978974 ATAGAAGCACATGTAAAACATGG + Intergenic
905917092 1:41692495-41692517 ACAGAAATACACATAACACAAGG + Intronic
906403959 1:45526665-45526687 CTACAAATATAAATAAAACAAGG - Intergenic
907562900 1:55407273-55407295 TTTGAAACACACATAAAAGCAGG - Intergenic
908494817 1:64683892-64683914 CTACATACACCCATTAAACAAGG + Intronic
908993329 1:70121755-70121777 GTAAATACACAAATAAAACAGGG - Intronic
909092208 1:71240216-71240238 ACACACACACACATAAAACAGGG + Intergenic
909304763 1:74060119-74060141 CTAGAATCAGAAATGAAACAGGG - Intronic
909852876 1:80491068-80491090 CTACAATCACACATTAGACATGG + Intergenic
910239869 1:85074797-85074819 ACAGAAATACACATAAAACAAGG - Intronic
910701419 1:90078981-90079003 CTAAAATCCAACATAAAACAAGG - Intergenic
910999192 1:93144674-93144696 CTAAAAACACACACAAAAAATGG - Intergenic
911033859 1:93517742-93517764 CTACAAACACAAATTTAACAGGG - Intronic
911035743 1:93545020-93545042 ACAGAAACACAAATAAAAAAAGG - Intronic
911751195 1:101499925-101499947 CTAGAAAAACACCAGAAACAGGG - Intergenic
912037725 1:105342569-105342591 ATATAAACACTCATAAAACAAGG - Intergenic
912268389 1:108183536-108183558 ACAGAAACAGACATAAGACATGG - Intronic
912343820 1:108945062-108945084 ACAGAAACACACATAAAACAAGG - Intronic
912608955 1:111023403-111023425 CTAGAAATACACCTAACAAAGGG + Intergenic
913204326 1:116522493-116522515 ACAGAGACACACATAAAACAAGG + Intronic
913235520 1:116778029-116778051 ACAGAAACACACATAAAATTAGG + Intergenic
913376951 1:118163239-118163261 ATAGAAACACTTATAATACAAGG + Intronic
915015236 1:152726806-152726828 CTAGGAAGAAAAATAAAACAGGG - Intergenic
915683952 1:157611886-157611908 ATATATACACATATAAAACATGG - Intergenic
915847717 1:159285535-159285557 ATAAAAACACACATAAAATTTGG + Intergenic
915876889 1:159620338-159620360 CTAAAAACACTCAAAAAACTAGG + Intergenic
916576040 1:166067397-166067419 TTAGACACACACACAACACATGG - Intronic
916900102 1:169213185-169213207 ACAGAAATACACACAAAACAAGG + Intronic
916998705 1:170331059-170331081 ACAAAAACATACATAAAACAAGG - Intergenic
917127766 1:171705166-171705188 ACAGAAACACATATAAACCAAGG - Intronic
918683333 1:187383035-187383057 CTAGAAACAAAGATTAAATATGG + Intergenic
918885474 1:190187749-190187771 AAAGAAAAACACAAAAAACATGG - Intronic
919507275 1:198415150-198415172 CTAGAAACATACAGATAATATGG - Intergenic
919816895 1:201447040-201447062 ACAGAAACACATATAATACAAGG - Intergenic
920265458 1:204718429-204718451 ACAGAAACACACACAAAACAAGG + Intergenic
920320811 1:205121013-205121035 CTACAAAGATACATAAAAAATGG - Intronic
921049027 1:211497966-211497988 ATAGAAATGCACATAAAACAAGG + Intergenic
921080341 1:211733916-211733938 GCAGAAACACACATAAAACAAGG - Intergenic
921159241 1:212461480-212461502 ATAGAAATACACATAAAACAAGG - Intergenic
921607521 1:217173156-217173178 CTAAAAAGAAAAATAAAACAGGG + Intergenic
921636178 1:217496692-217496714 ACAGAATCACACACAAAACAAGG + Intronic
921668834 1:217904442-217904464 ACAGAAACACACATAAAACAAGG + Intergenic
922015607 1:221643283-221643305 TTAGAGACACACACAAAAAAAGG - Intergenic
922144537 1:222926576-222926598 AAAGAAACACACATAAAACAAGG - Intronic
922367907 1:224883093-224883115 CTAGAATCACAAATAAAAGCTGG - Intergenic
922989965 1:229898445-229898467 TTAGTAAAACATATAAAACAGGG - Intergenic
923002022 1:230014459-230014481 CAAAAAACACACACAGAACAAGG - Intergenic
923128612 1:231055434-231055456 ACAGAAACACTCATGAAACAAGG + Intergenic
923199547 1:231698126-231698148 ACAGAAACACACATAGAACAAGG + Intronic
923285900 1:232494937-232494959 CTACAAAGAAACATAATACAGGG + Intronic
924201258 1:241661498-241661520 ATAGAAACATGCATACAACATGG - Intronic
924280844 1:242435616-242435638 ACAGAAACACACATAAAACAAGG + Intronic
924407241 1:243760933-243760955 ACAGAAACACACATAAAACCAGG + Intronic
1062903312 10:1162087-1162109 ATAGAAACACACATTACAGAAGG + Intergenic
1063086818 10:2827157-2827179 ACAGAAACACACTTAAAACGGGG - Intergenic
1063754666 10:8994163-8994185 ACAGAAACACACATAAAACAAGG + Intergenic
1064032096 10:11889244-11889266 CAAAAAACACACACAAAAAATGG + Intergenic
1064241074 10:13629578-13629600 TTAGAAATGCACATATAACATGG - Intronic
1064389044 10:14925560-14925582 ACAGAAACACACATAAAACAAGG - Intronic
1065648507 10:27863080-27863102 ACAGAAATACACATAAAACAAGG - Intronic
1066255862 10:33678070-33678092 ATAGAAACACACACAAAACAAGG - Intergenic
1066459699 10:35602395-35602417 ACAGACACACACATAAAATAAGG + Intergenic
1067138857 10:43637876-43637898 AAACAAACATACATAAAACAAGG - Intergenic
1067139692 10:43646841-43646863 CCAGAAACCCACAGAAAATAAGG + Intronic
1067439784 10:46302097-46302119 CTGGAATCACAGCTAAAACAGGG + Intronic
1068612468 10:59075396-59075418 ATAGAAACATACATAAAACAAGG - Intergenic
1068632828 10:59315388-59315410 ATAAAGACTCACATAAAACATGG + Intronic
1068853908 10:61777093-61777115 CTGGAGACAGACATTAAACATGG - Intergenic
1069165478 10:65152897-65152919 CTAGAAAAAAACATAAAAAGGGG - Intergenic
1069210393 10:65751131-65751153 ATAGAAACACACATAAAATAAGG + Intergenic
1070109923 10:73475609-73475631 AATGAAACAAACATAAAACATGG - Intronic
1071469323 10:85969984-85970006 CTAGAATCAGAAATAAAAGAGGG + Intronic
1071811010 10:89180825-89180847 ACAGAAACACACATAAAACAAGG + Intergenic
1072351261 10:94559797-94559819 ACAGAAACACAAATAAAACAGGG + Intronic
1072548961 10:96462636-96462658 ACAGAAACACACATAAAACAAGG - Intronic
1072998754 10:100269469-100269491 CAAGAAACAAACAAAAAAGAAGG - Intergenic
1073469198 10:103712417-103712439 CTAGAAGCACTCAGAAAACCAGG - Intronic
1075260624 10:120960696-120960718 ACAGAAACACACATAAAACACGG - Intergenic
1075888220 10:125921144-125921166 CCAAAAACAAACATAATACATGG - Intronic
1076022928 10:127089288-127089310 CAAGAAACACACAGAGAACAGGG - Intronic
1076663724 10:132073110-132073132 CTACATACACACACACAACATGG - Intergenic
1076977004 11:180859-180881 CTAAAAACCCACATAAAACTGGG + Intronic
1077526786 11:3071113-3071135 AGAGAAACACACATACAATAAGG - Intergenic
1077800816 11:5534289-5534311 CTAAAAACAAACATAAACCATGG - Intronic
1077920004 11:6634532-6634554 ACAGAAACACACATCAAACAAGG - Intronic
1078793392 11:14567994-14568016 ACAGAAACACACATAAAACTAGG + Intronic
1079299469 11:19264907-19264929 ACAGAAACACACATAAAACAAGG + Intergenic
1079975382 11:27084300-27084322 CCAGAAACACTCATAGAAGATGG - Intronic
1080351856 11:31393980-31394002 ACAAAAACAAACATAAAACAAGG - Intronic
1081011223 11:37814390-37814412 ATAGAAACGCACATAAATCAAGG - Intergenic
1081689033 11:45063807-45063829 CAGAAAACACACATATAACAAGG + Intergenic
1081748619 11:45490789-45490811 ACAGAAACACCCATAAAACAAGG + Intergenic
1082143340 11:48635149-48635171 CTATAAACAGACATAAAAGTAGG - Intergenic
1082165915 11:48950431-48950453 ATAGAAACACAGATATAAAAGGG - Intergenic
1082570532 11:54732514-54732536 CTATAAACAGACATAAAAGTAGG - Intergenic
1082610680 11:55293508-55293530 ATAGAAACACAGATATAAAAGGG + Intergenic
1082659262 11:55890168-55890190 ATAGAAACACAGATATAAAAGGG - Intronic
1084314281 11:68335379-68335401 TTAGAAACACACATAAGACAAGG - Intronic
1085175051 11:74478571-74478593 ATGGAAACACACATAAAACAAGG - Intergenic
1085654076 11:78296335-78296357 ACAGAAACACATATAAAACGAGG - Intronic
1085908767 11:80797027-80797049 ACAAAAACACACATAAGACAAGG + Intergenic
1086596103 11:88573006-88573028 CTAGAAATGCAGATGAAACATGG + Intronic
1086602897 11:88657127-88657149 ACAAGAACACACATAAAACAAGG + Intronic
1086697054 11:89859706-89859728 ATAGAAACACAGATATAAAAGGG - Intergenic
1086709104 11:89984781-89984803 ATAGAAACACAGATATAAAAGGG + Intergenic
1087072258 11:94092778-94092800 AAAGAAACAGACATAAAACAAGG + Intronic
1087552509 11:99669598-99669620 CTAGAAAAATATATCAAACAGGG - Intronic
1087759358 11:102089234-102089256 CTAGAAACAAACATAACAACAGG - Intergenic
1087794627 11:102442505-102442527 CTAAAAACTCTCATTAAACAGGG + Intronic
1087962534 11:104369711-104369733 CTAGAAACACACAAAACATAAGG - Intergenic
1087976487 11:104555257-104555279 ATAGAAACACACATGAAACAAGG + Intergenic
1088079929 11:105899746-105899768 ACACAAACACCCATAAAACAAGG - Intronic
1088085359 11:105971754-105971776 TTAGAATCAGACATAAAACTGGG - Intronic
1088350121 11:108877025-108877047 CTAGAAACACAGAGAACAAAAGG + Intronic
1088390056 11:109304435-109304457 ACAGAAACACACATAAAACAAGG + Intergenic
1088464537 11:110120237-110120259 ACAGAAACACACATAAAACAAGG - Intronic
1088562559 11:111130602-111130624 ACAGAAACATATATAAAACAAGG - Intergenic
1088605209 11:111523408-111523430 ACAGAAACACACATAAAACAAGG + Intronic
1088713985 11:112532666-112532688 ACAGAAACACACACAAGACAAGG - Intergenic
1089017245 11:115176156-115176178 CAACAAACAAACAAAAAACAAGG + Exonic
1089178830 11:116567004-116567026 CTAGAACCATAAAGAAAACACGG + Intergenic
1090592043 11:128282536-128282558 ATAGAAACATACATAAAGCAAGG + Intergenic
1090903275 11:131051290-131051312 ACAGAAACATACACAAAACAAGG + Intergenic
1091094398 11:132805963-132805985 CAATAATCACACAGAAAACAAGG + Intronic
1091158150 11:133393265-133393287 ATGGAAATACACATAAAACAAGG + Intronic
1091267802 11:134284051-134284073 CTAGAAAGACTCATCACACAAGG + Intronic
1091492642 12:946451-946473 ACAGAAGCACACATAAAACAAGG - Intronic
1091678532 12:2509488-2509510 ATAGAAACACACTTAAAACAAGG - Intronic
1091687972 12:2577210-2577232 CCAGTAACACAGTTAAAACATGG - Intronic
1091700595 12:2657570-2657592 GTAGAAAAATAAATAAAACATGG + Intronic
1092802588 12:12185286-12185308 CAAAAAACAAACAAAAAACAGGG + Intronic
1093269718 12:17045049-17045071 ACAGAAATACACATGAAACAAGG + Intergenic
1093305816 12:17516333-17516355 ACAGAAACATGCATAAAACAAGG - Intergenic
1093504523 12:19849746-19849768 ACAGAAACACACATAAAACAAGG + Intergenic
1093611625 12:21167136-21167158 CAAAAAACAAACAAAAAACATGG + Intronic
1093904003 12:24667611-24667633 CTACAAACACCTAAAAAACAGGG + Intergenic
1093912892 12:24767514-24767536 ACAGAAACATACATAAAACATGG + Intergenic
1094094028 12:26683590-26683612 ACAGAAGCACACATAGAACAAGG + Intronic
1094166799 12:27451461-27451483 ACAGAAACACATATAAAACGAGG - Intergenic
1094180164 12:27584098-27584120 ACAGAAACACACATAAAACAAGG - Intronic
1094248605 12:28332733-28332755 ACAGAAACACACATAAAACAAGG - Intronic
1094270994 12:28614316-28614338 ATAGATACACATTTAAAACATGG + Intergenic
1094535971 12:31323704-31323726 CTAGAAACACACAAAGAAACTGG + Intronic
1094816850 12:34195655-34195677 CTTGAAACCCACACAAGACAAGG + Intergenic
1095100189 12:38173516-38173538 CTGGAAACCCACACAAGACAAGG - Intergenic
1095294161 12:40509584-40509606 TTAGAAACATACATAAATAATGG + Intronic
1095685392 12:45027750-45027772 ATAGAACCAAACTTAAAACATGG - Intronic
1095918181 12:47501506-47501528 CTAAAAACACTCATTAAACTAGG + Intergenic
1096040597 12:48512550-48512572 ACAGAAGCACACATAAAACAAGG + Intronic
1096118526 12:49070615-49070637 GGAGAAACAAACATACAACAAGG + Intergenic
1096399435 12:51293057-51293079 ACAGAAACTCACATAAAACAAGG + Intronic
1097004267 12:55903799-55903821 CTAAAAAGACACAAAAACCACGG + Intronic
1097275793 12:57812755-57812777 TTAGATACACACCTAACACAAGG - Intronic
1097448126 12:59700154-59700176 ACAGAAACACACATAAAACAAGG + Intronic
1097488795 12:60238587-60238609 CTAAAAACACTCAATAAACAAGG + Intergenic
1097818690 12:64104507-64104529 CTAGGAACACACATTCATCAGGG + Intronic
1097964813 12:65567511-65567533 CTATACTCACACATTAAACATGG + Intergenic
1098124596 12:67277332-67277354 AAAGAAACACTCATAAAACGAGG - Intronic
1098221611 12:68275693-68275715 ACAGAAACACACATAAAACAAGG - Intronic
1098928097 12:76376015-76376037 ATAGAAGCATATATAAAACAAGG + Intronic
1099237425 12:80098198-80098220 ACAGAAATACACATAGAACAAGG - Intergenic
1099474784 12:83095036-83095058 CTACAAACACTTAAAAAACATGG + Intronic
1099737791 12:86593232-86593254 CTAGAATCATAAATAAAAGAAGG - Intronic
1100662937 12:96719988-96720010 CCATAAACACACATTAAACAAGG + Intronic
1100873790 12:98941131-98941153 ACAGAAACACATATAAAACAAGG - Intronic
1101584121 12:106069596-106069618 ACAGAGACACACATAAAACAAGG + Intronic
1102063767 12:109955512-109955534 ACAGAAACACACGTAGAACAAGG - Intronic
1102422036 12:112811159-112811181 ACAGAAACACACATAAAACAAGG - Intronic
1102520423 12:113474698-113474720 CTGGAAACACACACCAGACAGGG - Intergenic
1102701248 12:114841369-114841391 CTAAAAAGACACATAATAAATGG - Intergenic
1102835796 12:116058968-116058990 TAAGAAAAACACATAAAAAAAGG + Intronic
1103050720 12:117777036-117777058 ACAGGAACACACCTAAAACAGGG - Intronic
1103629743 12:122250422-122250444 GCAGAAACACATATAAAACTGGG - Intronic
1104290958 12:127466907-127466929 CCAGAAACACAAATAAAGCAAGG - Intergenic
1104392994 12:128407025-128407047 TTAAAAACACACCTAGAACATGG + Intronic
1104550570 12:129753045-129753067 CTTGAAAGTCACATATAACAAGG - Intronic
1105523629 13:21154064-21154086 CAAGGAACAATCATAAAACAGGG + Exonic
1105580441 13:21690999-21691021 ACAGAAACACACATAAAACAAGG + Intronic
1106642871 13:31604176-31604198 GCAGAAACATACATAAAACAAGG - Intergenic
1106749525 13:32746441-32746463 ACAGAAACATACATAAAACAAGG - Intronic
1106757107 13:32832804-32832826 CTAGAAACAGAAATAAAAGAGGG - Intergenic
1106772698 13:32977523-32977545 ACAGAAACACACACAACACACGG - Intergenic
1106808285 13:33333724-33333746 CAAGAAACACTTATGAAACATGG + Intronic
1106934286 13:34701367-34701389 CTAGAAGCAAACAGAAAACCAGG + Intergenic
1107059431 13:36141262-36141284 ACAGAAACACATACAAAACAAGG + Intergenic
1107226816 13:38060166-38060188 GCAGAAAGACACCTAAAACAAGG - Intergenic
1107282860 13:38756341-38756363 ATAGAAACACACATAAAACAAGG - Intronic
1107792849 13:44019489-44019511 ACAGAAACACATATAAAACAAGG + Intergenic
1107794916 13:44041307-44041329 CAAGCCATACACATAAAACAAGG - Intergenic
1108117329 13:47143712-47143734 ACAGAAACATATATAAAACAAGG - Intergenic
1108169518 13:47726897-47726919 ACAGACACACACATAAAATAAGG + Intergenic
1108617696 13:52150209-52150231 CAAGAATGTCACATAAAACAAGG + Intronic
1109213100 13:59557517-59557539 TTAAAAACAAACAAAAAACAAGG - Intergenic
1109449780 13:62496649-62496671 CTCTTAAAACACATAAAACATGG - Intergenic
1109715688 13:66219169-66219191 CATGAAAGACACATAATACAGGG - Intergenic
1109727078 13:66355686-66355708 ACAGAAACACACATAAAACAAGG + Intronic
1109871081 13:68334734-68334756 ACAGAAACACACATAAAACAAGG - Intergenic
1109999446 13:70175918-70175940 CTAGGAACACATATAAAGCTAGG + Intergenic
1110017456 13:70425814-70425836 CTAGAAAGACAAAATAAACAAGG + Intergenic
1110282393 13:73710172-73710194 CTCCAACCACACATACAACATGG + Intronic
1110287186 13:73763364-73763386 TTAGAAAGATAAATAAAACATGG - Intronic
1110443063 13:75546968-75546990 ACAGAAATACACATAAAACAAGG - Intronic
1110516572 13:76419733-76419755 ACAGAAACACACACAAACCAGGG + Intergenic
1110565648 13:76955204-76955226 AAAGAATCTCACATAAAACAAGG + Intronic
1110776037 13:79409098-79409120 AAAGAAACACACATAAAACAAGG - Intergenic
1111002343 13:82201478-82201500 CTAGAATAATACATAAAGCAAGG + Intergenic
1111111199 13:83711869-83711891 CTAGAAAGATACAGAACACAGGG - Intergenic
1111265788 13:85811351-85811373 AAAGAAACACACGTAAAACAAGG + Intergenic
1111845641 13:93505376-93505398 ACAGTAACACACATAAAACAAGG - Intronic
1111910462 13:94305292-94305314 ACAGAAACACACATAACACAAGG - Intronic
1112057422 13:95703174-95703196 ACAGAAACACACAGAAAACAAGG - Intronic
1112121552 13:96417914-96417936 ACAGAAACACACATAAAACAAGG - Intronic
1112318130 13:98383011-98383033 ACAGAAACACACATAAGATACGG + Intronic
1112689224 13:101870992-101871014 ATACATACATACATAAAACAAGG + Intronic
1112714362 13:102166769-102166791 ATAGAAACACATATTAAACAAGG + Intronic
1113156870 13:107333151-107333173 TCAGAAACAGGCATAAAACAAGG - Intronic
1113285301 13:108840071-108840093 GTAGAACCAGACATCAAACATGG + Intronic
1113545875 13:111149588-111149610 ACAAAAATACACATAAAACAAGG - Intronic
1113578149 13:111408952-111408974 ATAGAAACAAACATTAAACAAGG + Intergenic
1113637964 13:111934730-111934752 CTAGAGACACACTTAACACGAGG - Intergenic
1113979188 13:114258663-114258685 ATAGAAACACACATAAAACAAGG + Intronic
1114184828 14:20392818-20392840 AAAGAAACACACATGAAATAAGG + Intronic
1115019829 14:28663180-28663202 ACAGAAACACACATCCAACAGGG - Intergenic
1115186348 14:30692313-30692335 TTAGAAAGACACATAAACAAAGG + Intronic
1115425786 14:33257449-33257471 CTTGAAACAGACCTAAAATATGG + Intronic
1115901772 14:38158956-38158978 GTAGAAAAACAAATAAAACCAGG - Intergenic
1115920722 14:38370268-38370290 ATCACAACACACATAAAACAAGG + Intergenic
1116032888 14:39593995-39594017 ATAAAAACACAAATAAAACAAGG - Intergenic
1116066726 14:39993842-39993864 CTGAAAACTGACATAAAACAAGG - Intergenic
1116543176 14:46125939-46125961 TTTGAAACACTCATTAAACAAGG - Intergenic
1116574023 14:46550901-46550923 AAAGAAACACCCATAAAATAAGG + Intergenic
1116827990 14:49690544-49690566 ATAAAAACACACATAAAACAAGG - Intergenic
1117055018 14:51903287-51903309 ACAGAAGCACACAGAAAACAAGG + Intronic
1118147205 14:63152004-63152026 ACAGAAGCCCACATAAAACAAGG - Intergenic
1118259446 14:64233702-64233724 AAAGAAACACACATAAAACAAGG - Intronic
1118424500 14:65644772-65644794 ATAGAAACACACATAAAACAAGG - Intronic
1118677017 14:68197337-68197359 CAAAAAATACACACAAAACATGG - Intronic
1118920666 14:70146953-70146975 GCAGAAACACACATAAGACAAGG + Intronic
1119135818 14:72218575-72218597 ACAGAAACACATGTAAAACAAGG - Intronic
1119169343 14:72522027-72522049 GTAGCTACACACATAAATCAAGG - Intronic
1119672826 14:76532481-76532503 CTAGAGAGATACATAAATCAAGG - Intergenic
1120074487 14:80140102-80140124 CTAGAAATACATATAATGCATGG + Intergenic
1120439203 14:84513639-84513661 TTTTAAACACACATAAAATACGG - Intergenic
1120763218 14:88304863-88304885 ACAGAAACACACATACAACAAGG + Intronic
1120958448 14:90103517-90103539 ATTCAAACACACATAAAACTAGG + Intronic
1121108935 14:91299146-91299168 ACAGAAACCCACATAAAACAAGG - Intronic
1121143867 14:91566520-91566542 ACAGAACCACACATAAGACAAGG - Intergenic
1121255876 14:92529932-92529954 ACAGAGACACACATAAAACAAGG + Intronic
1123045438 14:105510894-105510916 CTAGAAACACCAGGAAAACAGGG - Intergenic
1123202144 14:106676044-106676066 CTGAAAACACACATGAACCATGG - Intergenic
1123773342 15:23551991-23552013 TTAGATACACAAATAAAAAAAGG - Intergenic
1123980130 15:25594588-25594610 ACAGAAACACACATAAAACAAGG + Intergenic
1124135039 15:27027860-27027882 CAAGAAACATACATAAGAAAGGG - Intronic
1124364044 15:29059634-29059656 ACAGAAACACACATAAAACAAGG + Intronic
1124411217 15:29438861-29438883 ACAGAAACACACATGAAACAAGG + Intronic
1125016535 15:34942704-34942726 ATAGAAACACACATAAAATAAGG + Intronic
1126066860 15:44832469-44832491 CTAGAGACACACAAAAGATATGG - Intergenic
1126092972 15:45068079-45068101 CTAGAGACACACAAAAGATATGG + Intronic
1126210334 15:46094249-46094271 CTAGAAATACAGAGAAAAAATGG - Intergenic
1126342440 15:47656225-47656247 ATAGAAACACATATCAAACAAGG + Intronic
1126487414 15:49197245-49197267 CTAGACACATAACTAAAACAAGG - Intronic
1126845369 15:52755071-52755093 CTAGCAACAAATAAAAAACATGG + Intergenic
1127145359 15:56017669-56017691 GCCAAAACACACATAAAACAAGG - Intergenic
1127816106 15:62610376-62610398 ATAGAAACACACATAAAACAAGG - Intronic
1128348808 15:66875363-66875385 ACAGAAACACACATGAAACAAGG - Intergenic
1128604280 15:69025159-69025181 ATAGAAACACACATAAAACAAGG - Intronic
1128859757 15:71057988-71058010 ACAGAAACACACATATAACAGGG + Intergenic
1129338654 15:74870423-74870445 AAAAAAACACACATAAAAAATGG + Intronic
1129633798 15:77292271-77292293 ACAGAAATACAGATAAAACAAGG - Intronic
1130388836 15:83436834-83436856 TTAGAGGCACACATAACACAAGG + Intergenic
1130891682 15:88138726-88138748 CTAGAAAGACAAATATAGCATGG - Intronic
1130969309 15:88719558-88719580 ACAGAAACATACATAATACAAGG - Intergenic
1131050571 15:89345004-89345026 ATGGAAACACACATAACACAAGG - Intergenic
1131381964 15:91971710-91971732 ACAGAAACACACTTAACACAAGG + Intronic
1131441419 15:92462361-92462383 CTACAAACACACAAACAAAAAGG + Intronic
1131730150 15:95270926-95270948 CTAGAATCACAAATAGAACCAGG - Intergenic
1132333486 15:101028250-101028272 GCAGCAACACACATAAAACAAGG - Intronic
1132366112 15:101258138-101258160 GGAGGAACACATATAAAACAAGG - Intergenic
1133403543 16:5505828-5505850 CTAGACACACACGCAAACCACGG - Intergenic
1133481921 16:6179120-6179142 CTAGAAACCCAAATATAACAAGG + Intronic
1133788542 16:8991458-8991480 CTAAAAACACACAAAAAAATTGG - Intergenic
1133927396 16:10204391-10204413 GTACACACACACATAAAACTGGG - Intergenic
1134177729 16:12021724-12021746 CTAAAAATACACACAAAAAATGG + Intronic
1134493027 16:14710390-14710412 CTACAAACAAACAAAAAACAGGG - Intronic
1134498408 16:14749514-14749536 CTACAAACAAACAAAAAACAGGG - Intronic
1134524957 16:14936137-14936159 CTACAAACAAACAAAAAACAGGG - Intronic
1134582169 16:15379581-15379603 CTACAAACAAACAAAAAACAGGG + Intronic
1134712547 16:16334624-16334646 CTACAAACAAACAAAAAACAGGG - Intergenic
1134785148 16:16935453-16935475 ACAGAAACACACATAAAATGAGG - Intergenic
1134817391 16:17217058-17217080 ATAGAAACACACATGCAACAGGG + Intronic
1134895542 16:17883244-17883266 ACAGAAACACACATAAAACAAGG + Intergenic
1134954280 16:18374069-18374091 CTACAAACAAACAAAAAACAGGG + Intergenic
1135282290 16:21162971-21162993 ACAGAAATACACATAAAACGAGG - Intronic
1135313102 16:21420985-21421007 CTACAAACAAACAAAAAACAGGG + Intronic
1135366026 16:21853265-21853287 CTACAAACAAACAAAAAACAGGG + Intronic
1135627029 16:24004667-24004689 CTAAACAAAAACATAAAACAGGG + Intronic
1136136055 16:28257623-28257645 CTGGAAACACCCGTAAACCAAGG - Intergenic
1136152255 16:28358717-28358739 CTACAAACAAACAAAAAACAGGG + Intronic
1136194489 16:28642466-28642488 CTACAAACAAACAAAAAACAGGG - Intronic
1136210825 16:28756565-28756587 CTACAAACAAACAAAAAACAGGG - Intronic
1136255545 16:29036525-29036547 CTACAAACAAACAAAAAACAGGG - Intergenic
1136309770 16:29399712-29399734 CTACAAACAAACAAAAAACAGGG + Intronic
1136323213 16:29501491-29501513 CTACAAACAAACAAAAAACAGGG + Intronic
1136437898 16:30241461-30241483 CTACAAACAAACAAAAAACAGGG + Intronic
1137518243 16:49169112-49169134 CTAGAATCTGACATGAAACACGG - Intergenic
1137544584 16:49392414-49392436 CTAGATACACATTTAAAACCAGG + Intronic
1137723842 16:50643737-50643759 ACAGAAGCACACATAAAACAAGG - Intergenic
1137969627 16:52971534-52971556 ATGGAAACACCCATGAAACAAGG - Intergenic
1137979600 16:53058435-53058457 ACAGAAACACACATAAACAAAGG + Intronic
1138704452 16:58900181-58900203 CTATGAAGATACATAAAACAGGG + Intergenic
1138906709 16:61344623-61344645 ATAGAAACACATATAAATCTAGG + Intergenic
1139701761 16:68712000-68712022 CAAGAAACAAACAAAACACAAGG - Intronic
1139832902 16:69814570-69814592 GAAGAAACACACACAGAACATGG - Intronic
1140136925 16:72214577-72214599 CTAGAAACAGTCATAAAAATTGG + Intergenic
1140244985 16:73239977-73239999 ACAGGAACACACATAAAACGAGG - Intergenic
1140289310 16:73636328-73636350 CTGGCAACAAAAATAAAACAAGG + Intergenic
1140365220 16:74375829-74375851 CTACAAACAAACAAAAAACAGGG - Intergenic
1140498481 16:75411055-75411077 CTAAAAACACAAAAATAACAGGG + Intronic
1140593892 16:76385726-76385748 ACAGAAACATACGTAAAACAAGG - Intronic
1140658435 16:77164292-77164314 CAAGAAACAAACAAAAAAAATGG + Intergenic
1140967649 16:79982874-79982896 ATAGATACACAAATAAAATATGG - Intergenic
1141433931 16:83987537-83987559 TAAGAAATACACATAAAAAAAGG - Intronic
1141775498 16:86120247-86120269 ACAGAAACACACATCATACAGGG - Intergenic
1142443252 16:90115811-90115833 CTAAAAACCCAAATAAAACTGGG - Intergenic
1142464142 17:119033-119055 CTAAAAACCCACATAAAACTGGG + Intergenic
1142570248 17:868945-868967 AGAGAAAGACACAGAAAACACGG + Intronic
1142791891 17:2273201-2273223 ACAGAAACCCACATAAAACAAGG + Intronic
1142819161 17:2450610-2450632 CTTCAAATACACATAAAATAAGG + Intronic
1144236607 17:13267500-13267522 CAACAAACAAACAAAAAACAAGG + Intergenic
1144277920 17:13693316-13693338 ACAGAAACACACATAAAACAAGG + Intergenic
1145096205 17:20029753-20029775 CTAGAATCAGAAATAAAAGAGGG - Intronic
1145720203 17:27064303-27064325 CTAGTTACTGACATAAAACATGG + Intergenic
1146338723 17:32000030-32000052 CGTGAAACACATATAACACAGGG - Exonic
1146403949 17:32521275-32521297 TTAGAAACACACCTAAAATAGGG + Intronic
1146637452 17:34517023-34517045 CTAAAACCACACAGCAAACAAGG - Intergenic
1146751301 17:35383750-35383772 CAAGAAACACAAAGAAAACATGG - Intergenic
1148497004 17:48059038-48059060 CCACAACCACACATACAACATGG + Exonic
1149125585 17:53226972-53226994 ATCCAAACACACATAATACAGGG - Intergenic
1149725546 17:58890158-58890180 GCAGAAACACATATAAAACAAGG - Intronic
1150543520 17:66128883-66128905 ATAAAAACACACAGAAAAAAGGG + Intronic
1150869217 17:68886320-68886342 CTAGATATAGACAAAAAACAAGG - Intronic
1151661837 17:75523252-75523274 CTACAAGGACACAGAAAACAAGG - Intronic
1151783339 17:76262252-76262274 CTTGAATCACAAATAAAACATGG - Intergenic
1152060824 17:78073737-78073759 ACAGAAAAACATATAAAACAAGG - Intronic
1152289880 17:79433889-79433911 ATAGAAACACCCTTAAAACAAGG - Intronic
1152974367 18:199770-199792 ACAGAAACACACATAAAACAAGG + Intronic
1153038400 18:786858-786880 ACAGAAACACACATATAACAAGG + Intronic
1153042220 18:823884-823906 CTAAAAACAAAAACAAAACAGGG - Intergenic
1153227335 18:2908808-2908830 ATAGAAACAGACATAGAACAAGG - Intronic
1153760940 18:8331404-8331426 CTAGTTACTGACATAAAACATGG - Intronic
1154013853 18:10598732-10598754 ACAGAAACACAAATAAAACAAGG - Intergenic
1154118900 18:11635340-11635362 CTACAAACAAACAAAAAACAGGG + Intergenic
1154153097 18:11922427-11922449 ACAGAAACACAAATAAAACAAGG - Intergenic
1154995246 18:21634477-21634499 ACAGAAACACTCATAAAACAAGG - Intergenic
1155051712 18:22153881-22153903 ACAGAAACACACATAAAACAAGG + Intergenic
1155473839 18:26217939-26217961 ATAGAAACACACATGAAATAAGG - Intergenic
1155647595 18:28098460-28098482 ACAGAAATGCACATAAAACAAGG - Intronic
1156019589 18:32584615-32584637 ACAAAAACACACATGAAACAAGG - Intergenic
1156402649 18:36753880-36753902 CTAAAAAGACAAATAAAAAATGG - Intronic
1156435440 18:37122849-37122871 CCAGGAAGACACAGAAAACACGG + Intronic
1156654516 18:39269294-39269316 ATAGAGCCATACATAAAACATGG + Intergenic
1157303793 18:46501601-46501623 ACAGAAACACACATAAAACAAGG + Intronic
1157401143 18:47389561-47389583 CTAGAAACACCCAGGAAGCAGGG - Intergenic
1157490164 18:48117614-48117636 CTAGTAAAGCACTTAAAACAGGG + Intronic
1158057599 18:53300585-53300607 ATAGAAACACACATAAAACAAGG + Intronic
1158162532 18:54501782-54501804 ACAGAAACACACATAAAACAAGG + Intergenic
1158322254 18:56276370-56276392 CTAGAAACACAAAGAAAACCAGG + Intergenic
1158362506 18:56690839-56690861 CTAGACATAGAAATAAAACAGGG + Intronic
1158691108 18:59661633-59661655 ACAGAAATATACATAAAACAAGG - Intronic
1158766844 18:60460986-60461008 CTTGAAATACAAAGAAAACAGGG + Intergenic
1158794823 18:60832135-60832157 CCAGAAACAGAAATAAAATATGG - Intergenic
1158817221 18:61116361-61116383 TTAGAAACACATAGAAAACAAGG + Intergenic
1159442257 18:68496544-68496566 CAAGTAAGACACATAAAACATGG - Intergenic
1159451686 18:68610882-68610904 ATACACACACACATAAAATAAGG + Intergenic
1159950032 18:74476205-74476227 CTCATCACACACATAAAACAAGG + Intergenic
1160020664 18:75178237-75178259 GCAGAAACACATATAAAACAAGG + Intergenic
1160063481 18:75552696-75552718 ACAGAAGCACACTTAAAACAAGG + Intergenic
1160367179 18:78336327-78336349 ACAGAAACACACATTATACAAGG + Intergenic
1161923498 19:7283907-7283929 ACAGAAACACACATAAAACAAGG - Intronic
1161931856 19:7345935-7345957 CGAGACACACACAGAACACAAGG - Intergenic
1162922380 19:13911019-13911041 ACAGAAACACACATAGAGCAAGG + Intronic
1163134466 19:15299617-15299639 GTAGAGACACACACAGAACAGGG + Intronic
1163217121 19:15888812-15888834 ATAGACACAGACAAAAAACATGG + Intronic
1164523217 19:28994795-28994817 CTAGAAGCAAACCTGAAACAAGG + Intergenic
1165037391 19:33043547-33043569 CTCCAAACAAACAAAAAACAAGG + Intronic
1166726559 19:45031935-45031957 ATATAAAAATACATAAAACAAGG + Intronic
1167141776 19:47656402-47656424 ACAGAAACACACATAAGCCAAGG + Intronic
1167188508 19:47965588-47965610 ACAGAAACACATATAAAAGAAGG + Intergenic
1167525559 19:49981572-49981594 ACAGAAACATACATAAAACAAGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1167641294 19:50683393-50683415 ACAGAAACATGCATAAAACAAGG - Intronic
1167701835 19:51052992-51053014 AGAGAAACACACCTAAAACAAGG + Intergenic
1167846162 19:52166353-52166375 TTATAAGCAAACATAAAACATGG - Intronic
1168382311 19:55934200-55934222 ACAGAGACACATATAAAACAAGG - Intergenic
1168427731 19:56252648-56252670 TAAGAAACAAACATCAAACATGG + Intronic
1168502789 19:56907688-56907710 CCAAAAACTCACATAAAGCAAGG + Intergenic
925780965 2:7381514-7381536 CTAGAGTCACATATAAGACAGGG + Intergenic
926352275 2:12007004-12007026 TTAGAAACTTAAATAAAACAAGG + Intergenic
926705149 2:15831908-15831930 ACAGAAACACACCTCAAACAAGG - Intergenic
926802380 2:16670160-16670182 ACAGAAACACACATAAAGCAAGG - Intergenic
927365068 2:22285473-22285495 CTATAACCACAGATAAAACAGGG + Intergenic
928160243 2:28916869-28916891 ATAGAAACAAACATAAAACAAGG - Intronic
928280964 2:29945964-29945986 ACAGAAACACACATAAAACAAGG + Intergenic
929084290 2:38153060-38153082 TCAGAAACACACATAAAGTAAGG + Intergenic
929852466 2:45604786-45604808 CTATAAAGAAAAATAAAACAGGG - Intronic
930247213 2:48996456-48996478 ATAGAAACATATATAAAACATGG - Intronic
930626402 2:53703056-53703078 CTAGAAAAACAGACAAAACCAGG + Intronic
930760844 2:55034014-55034036 ATAGAAAAACACATAAAACAAGG + Intronic
931177442 2:59868213-59868235 ATAGAAACACACATACAACAAGG + Intergenic
931627063 2:64266094-64266116 ACAGAAACACACATAAAACAAGG - Intergenic
931799569 2:65745690-65745712 ACAGAAACACACATAAAGCAAGG - Intergenic
932079303 2:68697129-68697151 ATAGAAACATATATAAAACAAGG - Intronic
932408710 2:71531879-71531901 ACAGAAGCACACATAAACCAAGG + Intronic
932529989 2:72519542-72519564 GCAGAAACACTCATAAATCAAGG + Intronic
932723434 2:74157244-74157266 CCATAAAAACACAAAAAACAGGG + Intronic
933304137 2:80576649-80576671 ACACAAACTCACATAAAACAAGG - Intronic
933533970 2:83548471-83548493 CCAGAAACACACATATATGAAGG - Intergenic
933654023 2:84872794-84872816 GTAGAAGCACACATAAAACAAGG - Intronic
933671133 2:85008195-85008217 GCAGAAATACACATAAAACAAGG - Intronic
933850113 2:86359435-86359457 ATAGAAACACACATAAAGCAAGG + Intergenic
934528221 2:95066177-95066199 ACAGAAATTCACATAAAACAAGG - Intergenic
934593366 2:95579340-95579362 ATAGAAACACAGATATAAAAGGG - Intergenic
934693175 2:96377831-96377853 ATAGGAGCAGACATAAAACAAGG - Intergenic
934863477 2:97784625-97784647 CTAAAAGCATACATAAAACGGGG + Intronic
935080817 2:99792039-99792061 ACAGAAACACACATACAACAAGG + Intronic
935543286 2:104374780-104374802 CTTGAAAGACACACAAAACCTGG + Intergenic
936087099 2:109476781-109476803 CAAGAAACAACCATAAAAAAGGG - Intronic
936441904 2:112561623-112561645 ACAGAAACACACAAAAAACAAGG - Intronic
936598321 2:113870898-113870920 ACAGAAACACACATAAAACAAGG + Intergenic
936605658 2:113950134-113950156 AAAGAAACACACATGAAACAAGG - Intronic
937407710 2:121646111-121646133 CTAAAAACAAAAACAAAACAAGG - Intronic
938653212 2:133405206-133405228 ACAGAAACACACACAAAACAAGG - Intronic
938803975 2:134788924-134788946 ACAGAAATACACACAAAACAAGG + Intergenic
938837013 2:135114627-135114649 ACAGAAACACACATAAAAGAAGG - Intronic
938918558 2:135969877-135969899 ACAGAAACACACACAAAAGAAGG - Intronic
939456453 2:142443374-142443396 ACAAAAACACATATAAAACAGGG + Intergenic
939747767 2:145998580-145998602 GTAGCCACACACATAAAATAAGG + Intergenic
939875114 2:147568931-147568953 ATAGAAACTCACATACAAAAAGG + Intergenic
940069024 2:149664191-149664213 ACAGAAACACACATAAAACAAGG + Intergenic
940209454 2:151241597-151241619 ACAGAAACACACACCAAACAAGG - Intergenic
940319500 2:152361459-152361481 GTAGAAACAGACAATAAACAAGG - Intronic
941311644 2:163940084-163940106 AGAGAAACACACATGGAACAAGG + Intergenic
943040925 2:182803997-182804019 ACAGAAACACACATAAAACAAGG - Intergenic
943057705 2:183003779-183003801 GTAGATACAAACATAAAATACGG + Intronic
943445586 2:187983090-187983112 ACAGAAACACATATAAAACAAGG + Intergenic
943574836 2:189619095-189619117 CTACAAATACACAAAAAATAAGG - Intergenic
943613598 2:190065620-190065642 ACAAAAACATACATAAAACAAGG + Intronic
943745838 2:191462120-191462142 CAGCAAACACACATAAAATAAGG - Intergenic
943803616 2:192093257-192093279 GTAGTAAGACAAATAAAACAAGG + Intronic
944437860 2:199710407-199710429 ACAGAAACACACATATAACAAGG + Intergenic
944527017 2:200629745-200629767 CAGGAAACAAACATGAAACAAGG - Intronic
944665351 2:201954803-201954825 CTAAGAAAATACATAAAACATGG + Intergenic
944876710 2:203969561-203969583 CTAGAGACACAAAGAAAACATGG - Intergenic
945141205 2:206688200-206688222 ATACAGAAACACATAAAACAAGG - Intronic
945371823 2:209028017-209028039 ACAGAAACACACATAAAACAAGG - Intergenic
945598119 2:211820974-211820996 CTAAGAACTCAAATAAAACAAGG + Intronic
945680682 2:212910484-212910506 ATGGAAACACACATAAAAGAAGG + Intergenic
945711724 2:213305538-213305560 ATAGAAACCCTCAAAAAACATGG - Intronic
945741287 2:213665669-213665691 AAATAAACACACATAAAACAAGG - Intronic
945867012 2:215187639-215187661 GAAGAAACACACATAAAGCAAGG + Intergenic
945970932 2:216231267-216231289 ATAAAAAAACACATAAGACATGG - Intergenic
946672182 2:222116594-222116616 AAACAAACACACAAAAAACAAGG + Intergenic
946917040 2:224534033-224534055 CTAGAAACAAAAATATAAAAAGG + Intronic
947191855 2:227514790-227514812 CAAGAATGACACCTAAAACAAGG - Intronic
947479362 2:230483906-230483928 ACAGAAACACATATAAAACAAGG - Intronic
947557640 2:231110430-231110452 TTAGAAAGACAAATAATACAGGG + Intronic
947598273 2:231427840-231427862 ACAGAAACAAACATAAAAAAAGG - Intergenic
947788598 2:232848145-232848167 AAAGACACACACATAAAACAAGG - Intronic
947942944 2:234074767-234074789 ACAGAAACACACATAAAGCAAGG - Intronic
948014776 2:234679211-234679233 ATAGAAACACACATAAAACAAGG - Intergenic
948087274 2:235262026-235262048 ACGGAAACACACACAAAACAAGG - Intergenic
948289227 2:236812666-236812688 ACAGAAACACACATAAAACAGGG - Intergenic
948959455 2:241321298-241321320 GTAGATAAACACATAAAGCAAGG - Intronic
1169516648 20:6323303-6323325 ACAGAAACACACATAAAACAAGG - Intergenic
1169656138 20:7925457-7925479 CTAGAAATACAGTGAAAACAAGG - Intronic
1170171776 20:13421925-13421947 ACAGAAACACATATAAAATAAGG - Intronic
1170498485 20:16950278-16950300 GCAGAAACACAAATAAAACAAGG + Intergenic
1170834711 20:19874280-19874302 CTAGAAACACACATAAAGCAAGG + Intergenic
1171048598 20:21834649-21834671 CCAGAAACACATTTAAGACAAGG + Intergenic
1171224873 20:23434104-23434126 CTAGAGACACACATAAAATAAGG + Intergenic
1171820564 20:29833435-29833457 CTTGAAACCCACACAAGACAAGG + Intergenic
1171897270 20:30819735-30819757 CTTGAAACCCACACAAGACAAGG - Intergenic
1172012645 20:31854926-31854948 ACAGAAACACACAGAAAACAAGG - Intronic
1172524419 20:35589986-35590008 AAACAAACACACATAAAACAAGG + Intergenic
1172609750 20:36241215-36241237 ATAGAAATACACAGAAAAAAAGG - Intronic
1172648802 20:36488552-36488574 ACAGAGACACACATAAAACAAGG - Intronic
1172874330 20:38155127-38155149 CAAAAAACACACAAAAAACAGGG + Intronic
1173494035 20:43506129-43506151 CTAGAAACAAACAACTAACATGG - Intergenic
1174135732 20:48377719-48377741 ACAGAAACACACATAAAACAAGG - Intergenic
1174227231 20:49011210-49011232 ACAGGAACACACATACAACAAGG + Intronic
1174587521 20:51620473-51620495 GTAGAAACGCACATAAAATAAGG - Intronic
1174605749 20:51760285-51760307 ACAGAAACACACCTAAAACGAGG + Intronic
1175432105 20:58912590-58912612 AAATAAACACACATAAAACCTGG + Intergenic
1176700488 21:10043331-10043353 CCAGAAGCACTCATAAAACTCGG + Intergenic
1177040873 21:16108992-16109014 ACAGAAGCACACATAAAACAAGG + Intergenic
1177284154 21:19025842-19025864 TAAGAAACACACATAACTCATGG + Intergenic
1177375275 21:20262477-20262499 CTAAAAACACACAAAAAATTAGG + Intergenic
1177477363 21:21641477-21641499 ATATAAACACACATAACACAAGG + Intergenic
1177702084 21:24652548-24652570 CTAGAAAGAACAATAAAACAGGG - Intergenic
1178072163 21:28980364-28980386 ACAGAAACACACATAAAACAAGG + Intronic
1178635222 21:34296586-34296608 ATAGAAACACACATAGAAGGAGG - Intergenic
1178901101 21:36599399-36599421 ACAGAAGCACACATAAAGCAGGG - Intergenic
1179126206 21:38592950-38592972 CCTGACACACACATAAAAAATGG - Intronic
1180156274 21:45978740-45978762 CTATAAACACACTTATAGCACGG + Intergenic
1180250575 21:46584349-46584371 CTAGAATCAGAAATAAAAAAGGG + Intergenic
1180324596 22:11358384-11358406 CTTGAAACCCACACAAGACAAGG + Intergenic
1181974067 22:26715853-26715875 ACAGAAACACACATAAAACTTGG - Intergenic
1182279841 22:29211877-29211899 CCAGAAATACGCATAAAACTTGG - Intronic
1182642322 22:31778226-31778248 CTAAAATCAAAAATAAAACAAGG + Intronic
1182677808 22:32053525-32053547 CTAGAAACACCAAGAATACATGG - Intronic
1183050718 22:35258187-35258209 CAAGAAACACACAAAATACCAGG - Intronic
1183844902 22:40534764-40534786 CTAGATAAACACACCAAACATGG - Intronic
1184347016 22:43919873-43919895 CCAGGAACACACATAAAACAAGG - Intergenic
1184925737 22:47635816-47635838 CCAGGAAAACACATAAAAAAAGG - Intergenic
949615204 3:5746046-5746068 CTTGAAACACTTATAAACCAGGG + Intergenic
949739786 3:7218423-7218445 TTAGAAATAAAAATAAAACATGG - Intronic
950281965 3:11715780-11715802 ACAGAAACATACGTAAAACAAGG - Intronic
950647281 3:14384630-14384652 CTAAAAAGAAACATAAAACTAGG + Intergenic
950769005 3:15295988-15296010 ACAGAAACACACATATAACAAGG + Intronic
950941234 3:16894397-16894419 CTGGAAATATACATAAACCAGGG - Intronic
951087909 3:18536543-18536565 ATAGAAACACACATAAAACAAGG + Intergenic
951140849 3:19157115-19157137 CCAGAAAATCAAATAAAACATGG - Intronic
951142241 3:19176914-19176936 ATAGAAATACACATAAAACAAGG - Intronic
951142475 3:19180955-19180977 CTAGAGACAGAAATATAACATGG + Intronic
951395346 3:22158718-22158740 TGAGAAACAAACAAAAAACACGG + Intronic
951642289 3:24849533-24849555 ACAGAAACACACATAAAACAAGG - Intergenic
952535869 3:34308335-34308357 CCAGAAACATACAAAAATCAGGG - Intergenic
953180876 3:40594107-40594129 ACAAAAACACACATTAAACAAGG - Intergenic
953722377 3:45367767-45367789 TTGGAAACACACAAAAGACAAGG - Intergenic
953751656 3:45613254-45613276 ATAGAAGCACACATAAAACAAGG + Intronic
953896234 3:46805113-46805135 AAAGGAACATACATAAAACAAGG - Intronic
955206651 3:56901832-56901854 GCAGAAATACACATAAAACAAGG - Intronic
955928087 3:64027648-64027670 CTTGCAACACAGATAAAAAAAGG - Intergenic
955944424 3:64178815-64178837 AAAGAAACACACATGAAACAAGG - Intronic
956186177 3:66564405-66564427 ACAAAAACATACATAAAACAAGG - Intergenic
956383920 3:68696591-68696613 CTATAATCATACATAAATCATGG - Intergenic
956385755 3:68717279-68717301 ACAAAAACACACATAAAACAAGG + Intergenic
956403396 3:68903747-68903769 TTTTAAAAACACATAAAACAGGG - Intronic
956456337 3:69424124-69424146 ACAGAAACACACTTAAAACAAGG + Intronic
956967251 3:74476170-74476192 AGAGAAACACACACAAAACAAGG + Intronic
956995141 3:74818509-74818531 CTCAAGACAGACATAAAACAAGG + Intergenic
957171429 3:76742248-76742270 TTAGAAACACACAAAAATTAAGG - Intronic
957435220 3:80166488-80166510 TTAAAAACAAAAATAAAACAGGG + Intergenic
957441012 3:80247623-80247645 CTAGAAACAAACATAGAATACGG - Intergenic
957656724 3:83088225-83088247 ACAGAAACACATATAAAACAAGG - Intergenic
957795438 3:84999316-84999338 ATAGAAACACACATACAAAAAGG - Intronic
957965377 3:87315878-87315900 ATAGAAATACACATAAAACATGG + Intergenic
957968954 3:87358890-87358912 ACAGAAATACAAATAAAACAAGG - Intergenic
958005948 3:87812162-87812184 CTAGAAAGATACAGAAAATATGG + Intergenic
958152742 3:89712248-89712270 CTAGAAAGAAAAATAAAGCAAGG - Intergenic
958850275 3:99316469-99316491 ACAGACACACACATTAAACAAGG + Intergenic
958999924 3:100951686-100951708 CTCAAAACCCGCATAAAACATGG + Intronic
959010097 3:101065293-101065315 TAAGAAAAGCACATAAAACAGGG + Intergenic
959025329 3:101234241-101234263 ACAGAAACACACAGGAAACAAGG + Intronic
959455267 3:106552228-106552250 ATAGACACACACTTAATACATGG - Intergenic
959471155 3:106752013-106752035 ACAGAAAGACACATAAAATAAGG + Intergenic
959497378 3:107067283-107067305 TTAGTAACACAAATAAAACATGG - Intergenic
959832318 3:110879285-110879307 TTAGGAACACACATGAAAGAAGG - Intergenic
959886956 3:111514153-111514175 GTAGACACACACATAATACAGGG + Intronic
960041452 3:113153753-113153775 CAAAAAACAAACAAAAAACAAGG - Intergenic
960092959 3:113660383-113660405 CTGGAAACACACAGACAACGTGG - Exonic
960366193 3:116775782-116775804 ACAGAAAAACACATGAAACACGG + Intronic
960570585 3:119181775-119181797 CTAGAAAGACAAATAAAACAGGG + Intronic
960798933 3:121518123-121518145 ACAGAAACATGCATAAAACAAGG - Intronic
961775818 3:129284433-129284455 ACAGAAACACACATAAAACAAGG + Intronic
962062926 3:131950183-131950205 AAAGAAGCACACATAAAACAAGG - Intronic
962595475 3:136938736-136938758 AGAGAAACACACATAAAACAGGG + Intronic
962761078 3:138515227-138515249 ATAGAAACATACAGACAACAAGG - Intronic
962941766 3:140131016-140131038 CTTTAAACACTCAGAAAACATGG - Intronic
963231600 3:142914010-142914032 CTTGCCACACACATAAAATATGG - Intergenic
963858531 3:150281326-150281348 CTAGGAACAGACATAAAAATTGG + Intergenic
963877830 3:150496591-150496613 ATGGCAACACACCTAAAACAAGG - Intergenic
964284946 3:155108057-155108079 ACAGAAACACACATAAAACAAGG + Intronic
964792792 3:160468873-160468895 TTAGCAACACACAGAAAACCTGG - Intronic
965010050 3:163076077-163076099 ATAGAAACTTACAAAAAACAGGG + Intergenic
965014175 3:163135073-163135095 CTGAACACACACATAAATCATGG + Intergenic
965979991 3:174677650-174677672 ACAGAAACACACATAAAACAAGG - Intronic
966326098 3:178756432-178756454 CATAAAACACACATAAAACAAGG - Intronic
966394166 3:179484872-179484894 ACAGAAACACACATTAAACAAGG + Intergenic
966645985 3:182246820-182246842 GTAGAAGCAAGCATAAAACATGG + Intergenic
967005869 3:185381806-185381828 ACAGAAGCACACATAAAACAAGG + Intronic
967621532 3:191640193-191640215 TTAGAAACAGACATAAAAAATGG + Intergenic
967656729 3:192059290-192059312 ACAGAAACAAATATAAAACAAGG - Intergenic
967769249 3:193315859-193315881 ACACACACACACATAAAACAGGG - Intronic
967968012 3:194977397-194977419 CTAGAAACTCACATAAATACTGG + Intergenic
968029233 3:195468833-195468855 CTACAAAGAAAAATAAAACAGGG + Intergenic
968339028 3:197939288-197939310 CTTGAAATACAAATAAAAAAAGG + Intronic
968363569 3:198167199-198167221 CTAAAAACCCAAATAAAACTGGG - Intergenic
968560851 4:1280988-1281010 CTATAAACACAAAAGAAACAGGG + Intergenic
969208630 4:5668995-5669017 GTAGACACACACAGAAAAGATGG + Intronic
970674816 4:18437183-18437205 ATATACACACACATAATACAAGG - Intergenic
970740798 4:19235308-19235330 CTAAAAACACACAAAAAAATTGG + Intergenic
970891631 4:21052094-21052116 ATAGGAACAGACAAAAAACAAGG - Intronic
971059346 4:22950085-22950107 CTAGAGAGACACATAAAATTTGG + Intergenic
971235766 4:24840844-24840866 ACAGAGACACACATAAAACAAGG + Intronic
971427184 4:26527823-26527845 ACACAAACACACATAAAACAAGG + Intergenic
971427264 4:26528850-26528872 ACACAAATACACATAAAACAAGG - Intergenic
971766355 4:30836969-30836991 CTTGAGACACATATAAAACATGG + Intronic
971852928 4:32007287-32007309 TTAAACAAACACATAAAACAAGG + Intergenic
971956219 4:33422621-33422643 GGAGAAACAGACATTAAACAAGG + Intergenic
971968397 4:33592217-33592239 CTAGAAAATCACACAAAAAATGG - Intergenic
972064409 4:34922594-34922616 ACAGAAACACACATAAAACAAGG + Intergenic
972107613 4:35509914-35509936 CTCAAAACACGTATAAAACATGG - Intergenic
972165979 4:36284627-36284649 ATAGAAACACACATATAAGTAGG - Intronic
972233127 4:37098424-37098446 ATAGAAACATACATAAAACAAGG - Intergenic
972470822 4:39402482-39402504 TTAGAAACATACATAAAAAGAGG - Intergenic
972669952 4:41205576-41205598 CTAGAAAAACACAAAAACTATGG + Intronic
973014528 4:45121289-45121311 CAATAAACAAACATAAAAGAGGG + Intergenic
973148005 4:46853064-46853086 CTAGAAACACACATAAAACAAGG + Intronic
973745282 4:53957994-53958016 ACAGAAACACACACAAAACAAGG + Intronic
973760638 4:54111957-54111979 ATAGAGACACACATAAAACAAGG - Intronic
974139049 4:57860390-57860412 CTAGATACACAAATAAGACTAGG - Intergenic
974191981 4:58517507-58517529 CTAGATAAAAACAGAAAACATGG + Intergenic
974460568 4:62182068-62182090 AGAGAAACACACACAAAGCAAGG - Intergenic
974547017 4:63324914-63324936 ATAGAAATAAGCATAAAACAAGG + Intergenic
974805530 4:66875219-66875241 ATAGAAATACATATAAAACAAGG - Intergenic
975335219 4:73168735-73168757 ACAGAAACACACGTAAAACAGGG - Intronic
975814562 4:78204137-78204159 GTAGAAACACACATAAAACAAGG + Intronic
975846139 4:78527093-78527115 ACAGAAACAGACATAAAACAAGG + Intronic
976050524 4:81007280-81007302 ACAAAAACACACATAAAGCAAGG - Intergenic
976106465 4:81624401-81624423 CGAGAAACAAAGATAAATCAGGG + Intronic
976252055 4:83062798-83062820 ACAGAAACACACATAAAACAAGG + Intronic
976740346 4:88349913-88349935 ACAGAAACACACATAAAACCAGG - Intergenic
976766182 4:88600407-88600429 ACAGAAACACACATAAAAAAAGG - Intronic
976800164 4:88981583-88981605 CAAGAAACCCAAAGAAAACAAGG + Intronic
976835929 4:89373925-89373947 ACAGAAACACACACAAAACAAGG + Intergenic
977229081 4:94430508-94430530 CTAGAAAGACTGATAAAGCATGG - Intergenic
977740823 4:100479304-100479326 CTTGCAACACACAAAAAATAAGG - Intronic
977857777 4:101914654-101914676 ACAGAAACACACATAAAGCAAGG - Intronic
978181424 4:105800851-105800873 ATAGAAGCACATATAAAATAAGG - Intronic
978279815 4:106997421-106997443 GCACAAACACACATAAAACTTGG - Intronic
978573114 4:110161791-110161813 GCAGAAACACACACAAAACTAGG + Intronic
978710738 4:111777719-111777741 CCAGTAGCACACATAAAAGAAGG - Intergenic
978786435 4:112615014-112615036 GCAGAAACATACATAAAACAAGG + Intronic
978870980 4:113577541-113577563 CTAGTAACAGACAAAATACAAGG - Intronic
978874862 4:113627472-113627494 ACAGAAACACACATAAAACTAGG - Intronic
979186522 4:117802258-117802280 ACAGAATGACACATAAAACAAGG + Intergenic
979443078 4:120775834-120775856 CCACAAATACACATAAAAGAGGG + Intronic
980689396 4:136274874-136274896 AGAGAAACAAACAGAAAACATGG - Intergenic
980737843 4:136914173-136914195 CTAGATAAAAACAGAAAACAGGG + Intergenic
980823142 4:138041948-138041970 ACAGAAACGCACATAAAATAAGG - Intergenic
980926827 4:139145848-139145870 ATAAAAACACCCAAAAAACAAGG + Intronic
981751677 4:148098233-148098255 ACAGAAACATGCATAAAACAAGG - Intronic
982538020 4:156630721-156630743 CTAGAACCATACAGAAAATATGG + Intergenic
982561681 4:156935659-156935681 ACAGAAACACACATAAAATAAGG + Intronic
982631322 4:157832895-157832917 ACAGAAATAAACATAAAACAAGG + Intergenic
983031307 4:162805264-162805286 CACCACACACACATAAAACAAGG + Intergenic
983322956 4:166217155-166217177 ATTGAAACACAAAGAAAACAAGG - Intergenic
983368648 4:166830152-166830174 CTAGACACTCCCATTAAACAAGG + Intronic
984339278 4:178433812-178433834 CTAGAAAAATAAATAAACCACGG - Intergenic
984941922 4:184940158-184940180 ATAAAAACAGACATAAATCAAGG - Intergenic
985216807 4:187662131-187662153 CTAAAAAAACCCTTAAAACATGG - Intergenic
985482430 5:123263-123285 CTAGAAACTCACAAAATACTTGG + Intergenic
985818472 5:2144237-2144259 CTATAAACAAACAGCAAACAGGG - Intergenic
986059631 5:4175743-4175765 CTATATAAACACATGAAACAGGG - Intergenic
986406984 5:7436139-7436161 ACAGACGCACACATAAAACAAGG + Intronic
986688665 5:10296103-10296125 ACAAAAACACACATAAAACCAGG + Intronic
987229126 5:15874229-15874251 CTAAAAACACACAATAAACTAGG + Intronic
988179560 5:27772352-27772374 AAACAAACACACAAAAAACATGG + Intergenic
989691489 5:44150355-44150377 ACAAAAACACACATAAAACAAGG - Intergenic
990227865 5:53676408-53676430 ACAAAAACACATATAAAACAAGG - Intronic
990441573 5:55851213-55851235 ACAGAAACACACACAAAACAAGG - Intergenic
990488563 5:56282347-56282369 AAAGACACACATATAAAACAAGG + Intergenic
991708028 5:69378666-69378688 ATAAAAACACATATACAACAAGG - Intronic
991981190 5:72232627-72232649 CTATAAACACTCTTAAAACGTGG + Intronic
992523502 5:77582129-77582151 CTAGAATCAGACATGAAAGAGGG + Intronic
992524060 5:77588769-77588791 ACAAAAACACACATAAAACAAGG - Intronic
993119514 5:83757428-83757450 CTAAAAACACTCAAAAAACTCGG + Intergenic
993342041 5:86736701-86736723 CTATAAACACACATATAGGATGG - Intergenic
993563742 5:89446155-89446177 TTCAAAATACACATAAAACATGG - Intergenic
993722339 5:91334050-91334072 ACAGAAAAACACATAAAACAAGG + Intergenic
993874502 5:93291045-93291067 CAAGAAACACACAAAACATAAGG - Intergenic
994520146 5:100823335-100823357 CAAGAAATAAACATAAAAAAGGG + Intronic
994698104 5:103098408-103098430 CCAAATACACACATACAACAAGG + Intronic
994812832 5:104544247-104544269 ATAGAAACACACATAAAAAGTGG - Intergenic
995418854 5:111939892-111939914 AAAGAAACACATATAAGACAAGG + Intronic
995637473 5:114210314-114210336 GCAGAATCACACATAATACATGG + Intergenic
995725458 5:115177575-115177597 GTATAATCACACACAAAACAGGG + Intronic
995915928 5:117244754-117244776 ACAGAAACACACATAAAACAAGG + Intergenic
995931021 5:117444427-117444449 CTAGAAACACACCTTATATAAGG - Intergenic
996011659 5:118487322-118487344 ATAGAAACACACAGATAACCAGG - Intergenic
996048122 5:118899340-118899362 ACAGAAACACATGTAAAACAAGG + Intronic
996081551 5:119263307-119263329 TTAGAAACACACAAAGAACTTGG + Intergenic
996171550 5:120298697-120298719 ACAGAAACACACATAAAACAAGG + Intergenic
996592936 5:125168419-125168441 AGAGAAACAAATATAAAACAGGG + Intergenic
996665348 5:126052627-126052649 ACAGAAACAGACACAAAACAAGG + Intergenic
996768332 5:127058431-127058453 ATAGAATCACACATAAAATAAGG + Intronic
997228969 5:132228942-132228964 ACGGAAATACACATAAAACATGG + Intronic
997600764 5:135136881-135136903 GAGGAAACACACACAAAACATGG - Intronic
997606859 5:135181200-135181222 ACAGTAACACACATAAAACAAGG - Intronic
998371234 5:141662940-141662962 ACAGAAAAACACACAAAACAAGG + Intronic
998563705 5:143196486-143196508 GCAGAAATACATATAAAACAGGG - Intronic
998578846 5:143348807-143348829 ATAGAAACACACATGAAACAAGG + Intronic
999050561 5:148520015-148520037 GCACAAACACACATCAAACAAGG + Intronic
999745578 5:154589390-154589412 CAAGGACCATACATAAAACACGG + Intergenic
1000013768 5:157258824-157258846 ACAGAAACATGCATAAAACAAGG + Intergenic
1000020386 5:157313245-157313267 ACAGAAGCACATATAAAACAAGG - Intronic
1000382866 5:160644803-160644825 CAAGAAACACCCATAAAAATGGG + Intronic
1000584922 5:163085658-163085680 CTATAAAAAGAAATAAAACAGGG - Intergenic
1001405329 5:171472705-171472727 ACAGAAACACACATACAACAAGG - Intergenic
1001516375 5:172358199-172358221 CTAGAAACATTCCTAAAACTAGG - Intronic
1001549160 5:172589776-172589798 ACAGAAACACACATACAACGAGG + Intergenic
1002145633 5:177178711-177178733 TTAAAAACAAACATTAAACAAGG - Intronic
1002417551 5:179128357-179128379 ACAGACTCACACATAAAACAAGG - Intronic
1002567851 5:180122113-180122135 ACATAAGCACACATAAAACAAGG + Intronic
1003138645 6:3454005-3454027 CTTGAAACACACAGAACACTGGG + Intronic
1003735373 6:8872290-8872312 CTGGAAACAAAGATAAAACATGG - Intergenic
1003756188 6:9123280-9123302 AGGGAAACACACATAAAACAAGG + Intergenic
1004064555 6:12230344-12230366 ACAGAAATACACATAAAACAAGG - Intergenic
1004381452 6:15136119-15136141 CTACAAACACAGATAAAATATGG + Intergenic
1004754471 6:18597029-18597051 CTAGAAGCACTCATAAAGAATGG + Intergenic
1004792107 6:19038062-19038084 ACACAAGCACACATAAAACAGGG + Intergenic
1004943531 6:20586634-20586656 CTCAAAACAAACATAAAAAAAGG + Intronic
1005102530 6:22187931-22187953 ACAGAAACACTCATAAAATAAGG - Intergenic
1005132606 6:22527303-22527325 ATAAAAACATATATAAAACAAGG + Intergenic
1005564047 6:27071203-27071225 CTAAAAAAGCACAAAAAACATGG + Intergenic
1005967606 6:30738589-30738611 ACAGAAACACATATAAAGCAAGG - Intronic
1006207984 6:32366598-32366620 CTAAAAACACACAAAAAAATTGG + Intronic
1006900467 6:37497319-37497341 ACAGAATCACACATGAAACAAGG - Intronic
1006960092 6:37920520-37920542 CTTGAAACACACAAAAATCGAGG + Intronic
1007474614 6:42110632-42110654 GCAGAAACACAGCTAAAACAAGG - Intronic
1008129964 6:47710081-47710103 ATAGAAACACACATCAAACAAGG + Intronic
1008169967 6:48192648-48192670 AGAGAAACATACATAAAACAAGG - Intergenic
1008248772 6:49211296-49211318 CTAGAAAGTGAAATAAAACATGG + Intergenic
1008353618 6:50524126-50524148 GCAGAAATACAAATAAAACAAGG + Intergenic
1008540126 6:52538964-52538986 ACAGAAACACACATAAAACAAGG - Intronic
1008913783 6:56764549-56764571 CTACAAACAGACATGAAACAAGG - Intronic
1009003961 6:57758227-57758249 AGAGAGACACACCTAAAACAAGG + Intergenic
1009807723 6:68623984-68624006 AGAGAGACACACACAAAACATGG - Intergenic
1009961418 6:70527103-70527125 CTAGATAAACTCATAAAACTTGG - Intronic
1010143940 6:72644240-72644262 ACAGAAACACACATAAAATAAGG - Intronic
1010182955 6:73108994-73109016 GTATATACACACATAAAACATGG - Intronic
1010184833 6:73132005-73132027 ATGTAAACACACATAAAACGTGG + Intronic
1010989543 6:82464585-82464607 TTAGAAACAAACAAAAAAAATGG - Intergenic
1011064123 6:83306000-83306022 CTATAAACACACGTAAATTAAGG + Intronic
1011409386 6:87051242-87051264 CTAGAAACTCACATACTAAATGG + Intergenic
1011450560 6:87487481-87487503 ATTGAAGCACACACAAAACAAGG - Intronic
1012458627 6:99435232-99435254 ATATAAAAGCACATAAAACACGG + Exonic
1012940899 6:105414331-105414353 ATAGAAACCCTCAAAAAACAAGG + Intergenic
1013023714 6:106247629-106247651 ACAGAAACACACATAGAACAAGG - Intronic
1013364273 6:109424065-109424087 CTAGGAAGAAAGATAAAACAAGG + Intronic
1014128747 6:117807155-117807177 CTAAAAACACTCAATAAACAAGG - Intergenic
1014245827 6:119067608-119067630 ACAGAAACACACATAAAACAAGG + Intronic
1015153394 6:130063584-130063606 ACAGAAACACACATAAAACAAGG - Intronic
1015467798 6:133567322-133567344 AAACAAACAAACATAAAACACGG + Intergenic
1015595476 6:134862124-134862146 ACAGATACACACATAAAACAAGG - Intergenic
1015934815 6:138398260-138398282 GCAGAAACACACATAAAACAAGG + Intergenic
1016139441 6:140589863-140589885 CTAAAAACAGATATAAAACTGGG + Intergenic
1016198180 6:141372395-141372417 ATATACACACACATAAAATATGG - Intergenic
1016420607 6:143878668-143878690 ACAGAAACATGCATAAAACAAGG + Intronic
1016510466 6:144837011-144837033 CAAGCAACTCCCATAAAACATGG - Intronic
1016690752 6:146935086-146935108 ACAGAAATGCACATAAAACAAGG - Intergenic
1016691297 6:146941116-146941138 CTAGAAACACTCAATAAACTAGG - Intergenic
1017207199 6:151816111-151816133 ACAGAAAAACATATAAAACAAGG + Intronic
1017347422 6:153400461-153400483 CCAGAAACACATACAAAACAAGG + Intergenic
1017399956 6:154049056-154049078 ACAGAAACACACATAAAACAAGG - Intronic
1017815601 6:158014367-158014389 ATAGAAAAACACATAAAACAAGG + Intronic
1017823118 6:158063065-158063087 ATGGAAACATACATAAAACAAGG + Intronic
1018139296 6:160811977-160811999 CCAGAAACACACACAAAACAAGG - Intergenic
1018306032 6:162456734-162456756 ACAGAAACACACATAAAACAAGG - Intronic
1018522146 6:164661995-164662017 CCAGAAACAAAAATAAATCAGGG - Intergenic
1018558295 6:165073093-165073115 GTAGAAAGAAACATAAAACAGGG + Intergenic
1019225848 6:170507313-170507335 ACAGAAACATACATAAAACAAGG - Intergenic
1019252131 7:21484-21506 CTAAAAACCCAAATAAAACTGGG + Intergenic
1019812913 7:3177797-3177819 AGAGAAACACACATAAAGCGGGG - Intergenic
1019946693 7:4335337-4335359 TCAGAAACACACACAAAACAAGG - Intergenic
1020380405 7:7538727-7538749 ATAGAAATACACACAAAAAAAGG + Intergenic
1020716405 7:11679158-11679180 CTAAAAACACTCAATAAACAAGG + Intronic
1021064905 7:16161365-16161387 CTAGAAACACTCAATAAACTAGG - Intronic
1021357508 7:19670123-19670145 ACAGAAACAAACATATAACAAGG + Intergenic
1021469578 7:20985970-20985992 ACAGAAACACACATAAAACAAGG - Intergenic
1021744946 7:23730722-23730744 ATTGAAACACACATGAATCAAGG + Intronic
1022180709 7:27916470-27916492 ACAGAAACACACCTAAAACAAGG - Intronic
1022218746 7:28291221-28291243 CTAAAAACAAACAAAAAAAAAGG - Intergenic
1022285240 7:28950411-28950433 ATAGAAACATACATAAATTAAGG + Intergenic
1022287584 7:28968962-28968984 CTAGAAATACATATAATAAAAGG - Intergenic
1022402577 7:30053900-30053922 ATGAAAACACACATAAAACAAGG - Intronic
1022518314 7:30989351-30989373 ACAGAAACAGACATAAAACAAGG + Intronic
1022518562 7:30990820-30990842 ACAGAAACAGACATGAAACAAGG - Intronic
1023151511 7:37205354-37205376 ACAGAAACACACATAAAAGAAGG - Intronic
1023697337 7:42861293-42861315 CTAAAAACACACAAGAAACTAGG - Intergenic
1023719877 7:43081833-43081855 ACAGAAACACACATAATGCAAGG + Intergenic
1024468693 7:49742785-49742807 CTAGAAACTCACAGAAAATGAGG + Intergenic
1024873476 7:53993247-53993269 ATAGAGAAACACATAACACAAGG + Intergenic
1024916495 7:54505814-54505836 ATAGAAACACACATAAAACAAGG - Intergenic
1024932575 7:54679308-54679330 CAAGAAATAAACATAAAAAAGGG + Intergenic
1024954866 7:54906834-54906856 ACAGAAACACACATCAAACAGGG - Intergenic
1024979988 7:55149880-55149902 TTAAAAACCCATATAAAACATGG - Intronic
1026232236 7:68495118-68495140 ATAGAAACAAACAAAAAAGAAGG - Intergenic
1026326040 7:69311407-69311429 GCAGAAACCCACCTAAAACATGG + Intergenic
1026476756 7:70743153-70743175 AAAGAAACAAAAATAAAACAAGG - Intronic
1027161784 7:75808009-75808031 CAAGAAAAAAACATAAAAAATGG + Intergenic
1027340732 7:77205309-77205331 ACAGAAACACACTTAAAATAAGG - Intronic
1027401580 7:77814311-77814333 ATAGAAACACATATGAAACAAGG - Intronic
1027409366 7:77898669-77898691 ACAGAAACACACATAAAACAAGG - Intronic
1027847198 7:83395870-83395892 ACACAAACACACATAAAAGAAGG + Intronic
1028343383 7:89750213-89750235 AATGAAACACACATAAAACAAGG - Intergenic
1028499190 7:91499311-91499333 CTAGAAACACTCAATAAACTAGG - Intergenic
1028724556 7:94072547-94072569 CTTGAAACACACAGAAAACTGGG - Intergenic
1028809170 7:95064226-95064248 AAAGAAACACACGTGAAACATGG - Intronic
1029047901 7:97650488-97650510 AGAGAAATACATATAAAACAAGG + Intergenic
1029233601 7:99092796-99092818 ACAGAAGCACACATAAAACAAGG + Intronic
1029422775 7:100479564-100479586 CTAGAGACACACAGAAGAGACGG + Intergenic
1030483126 7:110129587-110129609 ACAGAAACACACACAAAACAAGG + Intergenic
1030489072 7:110208809-110208831 CTTAAAAAACACATAAAACTTGG + Intergenic
1030570009 7:111211645-111211667 CTGGAAAAAGACAGAAAACAAGG + Intronic
1030767160 7:113424503-113424525 ACAGAAACACACATAAAACAAGG + Intergenic
1031528363 7:122848806-122848828 CAAGCAACTCACATAAAATAAGG + Intronic
1032053363 7:128663812-128663834 TTAAAAACAAACATAAAATAAGG - Intergenic
1032316953 7:130846977-130846999 CTAAAAACACACAGAGAAGACGG - Intergenic
1032381205 7:131483479-131483501 ACAGAAACACACATAATACGTGG - Intronic
1032479926 7:132238228-132238250 ACAGAAACACACACAAAACAAGG + Intronic
1032521327 7:132547682-132547704 CCAGAACCACAGAGAAAACAGGG + Intronic
1032535407 7:132658848-132658870 CTAGGAACTCACAGAAAACCAGG + Intronic
1032810356 7:135407945-135407967 TTAAACACACAAATAAAACATGG + Intronic
1032934743 7:136715598-136715620 CTAAAAACAAAAACAAAACAGGG + Intergenic
1032971856 7:137173934-137173956 ACAGAAACAAACATAAAACAAGG + Intergenic
1033021445 7:137729050-137729072 CTTAAAACACACAAAAAAGATGG + Intronic
1033044704 7:137951392-137951414 ACAGAAGCACACATAAAACAAGG + Intronic
1033051635 7:138009712-138009734 ACAGAAACACACATAAAACCAGG - Intronic
1033289899 7:140074779-140074801 ATAGAAAAACACATAAAACAAGG - Intergenic
1033309374 7:140249412-140249434 CTAGAAAAACACATGAAACCAGG - Intergenic
1033380378 7:140811131-140811153 ACAGAAACACACACAAAACAAGG + Intronic
1033650956 7:143343103-143343125 CCAGAAACACACATACAACAAGG - Intronic
1033991257 7:147290155-147290177 ACAGAAACACACACAAAACAAGG - Intronic
1034081645 7:148283877-148283899 TAAGATACACACATAAAGCAAGG + Intronic
1034106231 7:148492805-148492827 ACAGAAACACACATAAAACAAGG - Intergenic
1034857440 7:154565160-154565182 AAAGAAAGACACATAAAACAAGG + Intronic
1034906522 7:154952636-154952658 ACAGAAACACACATAAAACAAGG + Intronic
1035093788 7:156335388-156335410 ACAGAAACACACACCAAACATGG - Intergenic
1035588493 8:795248-795270 GCAGAAACACAAATAAAACAAGG - Intergenic
1036417931 8:8567619-8567641 AAAGAAAAACACATAAAACAAGG - Intergenic
1036821109 8:11940878-11940900 CTAAAAACACAAATATAAGATGG + Intergenic
1037278373 8:17206350-17206372 GTAGAAACACACATAAAACAAGG + Intronic
1037479664 8:19292642-19292664 CTAGAAACACACACAGCTCAAGG + Intergenic
1037631615 8:20662404-20662426 ACAGAAATACACATAGAACAAGG + Intergenic
1037792507 8:21958359-21958381 ACAAAAACACAAATAAAACATGG - Intronic
1037828654 8:22175583-22175605 AAAGAAACACTCATAAAACAAGG - Intronic
1038143036 8:24866990-24867012 ACAGAAACACACATAAAACAAGG + Intergenic
1038177351 8:25193229-25193251 ACACAAACACACATAAAATAAGG - Intronic
1038278848 8:26144330-26144352 ACAGAAACACACATAAAGCAAGG - Intergenic
1038511553 8:28140917-28140939 ACAGAAACACACATAAAACAAGG + Intronic
1038879015 8:31586982-31587004 CAAAAAACATACATAAAACAAGG - Intergenic
1039601394 8:38841146-38841168 ACAGGAACACACGTAAAACAAGG - Intronic
1039771396 8:40691147-40691169 GCAGAAACACACATACATCAAGG - Intronic
1039772635 8:40703047-40703069 ACAGAAACACACACAAAACAAGG + Intronic
1039818047 8:41112050-41112072 AGAGAAACACACATAAAACAAGG - Intergenic
1041288955 8:56290172-56290194 ACAGAAACACACATAAAACAAGG + Intergenic
1041488358 8:58404206-58404228 ACAGAAATAGACATAAAACAAGG + Intergenic
1041756101 8:61314732-61314754 TTAGAAAGACTTATAAAACATGG - Intronic
1041988712 8:63958404-63958426 CAAGCAACAAAGATAAAACATGG + Intergenic
1042203537 8:66305061-66305083 CAAGAAACACAAATAAACCTAGG - Intergenic
1042205529 8:66326484-66326506 ACAGAAAATCACATAAAACAAGG - Intergenic
1042209498 8:66365624-66365646 ACAGAAACACACATAAAACAAGG + Intergenic
1042567567 8:70128065-70128087 ACAGAAACACACATAAAACAAGG + Intronic
1042626766 8:70766778-70766800 CTAAAAACACTCATGAAACTAGG - Intronic
1043081120 8:75766343-75766365 CAAGAAATACCCATAAAACTGGG - Intergenic
1043098923 8:76014842-76014864 TCAGAAACACACATAAAACAGGG - Intergenic
1043523685 8:81073714-81073736 CTAGAAAGATACATAGGACAGGG - Intronic
1043801330 8:84614401-84614423 CTAGAAGGACACATAAGAGATGG + Intronic
1044011381 8:86998188-86998210 ACAGAAACACACACAAAACTAGG - Intronic
1044189904 8:89303178-89303200 TCAGAAACATACATAAAATAAGG + Intergenic
1044211809 8:89559488-89559510 ACAGAAACACACATTAAACAAGG - Intergenic
1044340631 8:91042217-91042239 AAAGAAAAACATATAAAACATGG - Intergenic
1044471205 8:92570702-92570724 ACAGAAAGACACATAAAACAAGG - Intergenic
1044665786 8:94633242-94633264 CTTCAAACAGACATAAAACAGGG + Intergenic
1044748179 8:95391389-95391411 ACAGAAACACACATAAAACAAGG - Intergenic
1044799507 8:95939412-95939434 ACAGAAACACGCAGAAAACAAGG + Intergenic
1044848283 8:96403143-96403165 ACAGAAACACACATAAAATAAGG + Intergenic
1044879020 8:96703056-96703078 AAAGAAGCATACATAAAACAAGG + Intronic
1045008759 8:97938839-97938861 ACAGAAACACACATAAAACAAGG - Intronic
1045275517 8:100701034-100701056 CTTAACAAACACATAAAACAAGG - Intronic
1045729913 8:105225788-105225810 CTAGAGATAAAAATAAAACAAGG + Intronic
1046989779 8:120439434-120439456 ACAGAAACACACATAAAACAAGG + Intronic
1047113018 8:121811865-121811887 CTAGAAAGATACATAAAAGGAGG - Intergenic
1047437341 8:124845817-124845839 ACAAGAACACACATAAAACAAGG - Intergenic
1047526655 8:125639685-125639707 GCAAAAACACACATAAGACAAGG + Intergenic
1048578556 8:135711901-135711923 CTAGAAACACCTATAGAAAAAGG + Intergenic
1048698316 8:137054414-137054436 ACAGAAGCACACCTAAAACAAGG - Intergenic
1048707723 8:137172800-137172822 GAAGAAAGACACATAAAACAGGG + Intergenic
1049117395 8:140701081-140701103 CTTGAAAGACACATAAAACAAGG - Intronic
1049310053 8:141929035-141929057 CTAGAAAAAAACAGCAAACACGG + Intergenic
1049391920 8:142376028-142376050 CTATAAACATACGGAAAACATGG + Intronic
1050352856 9:4756813-4756835 CTAGAATCACAATTAAAACCAGG - Intergenic
1050458505 9:5856753-5856775 TCAGAAACACACATAAAACAAGG - Intergenic
1050722760 9:8609602-8609624 TTAGCACCACTCATAAAACAGGG + Intronic
1051026504 9:12619085-12619107 ACAGAAACACACATAAAACAAGG - Intergenic
1051446749 9:17148411-17148433 ACAGAAACACACATAAAATGAGG - Intronic
1051801234 9:20936663-20936685 CTAAAAATACAAAAAAAACAGGG + Intronic
1052333019 9:27289983-27290005 ACAGAAACACACATAAAACAAGG - Intronic
1052620629 9:30904631-30904653 ACAGAAACACATATAAAATAAGG + Intergenic
1052730423 9:32278749-32278771 CTAGGAACTCACACAGAACAGGG + Intergenic
1052810804 9:33057772-33057794 CTACAAACTCACAAAAACCAGGG + Intronic
1053637687 9:40030137-40030159 CCAGAAGCACTCATAAAACTCGG + Intergenic
1053768394 9:41435084-41435106 CCAGAAGCACTCATAAAACTCGG - Intergenic
1054318480 9:63626731-63626753 CCAGAAGCACTCATAAAACTCGG + Intergenic
1054547063 9:66346582-66346604 CCAGAAGCACTCATAAAACTCGG - Intergenic
1054848803 9:69824766-69824788 ACTGAAACACACATAATACAAGG + Intronic
1055182509 9:73405166-73405188 TTAGAAACACAAAGAACACATGG + Intergenic
1055421062 9:76143169-76143191 CGAGAAACACAAACAAAAGAAGG - Intronic
1055472408 9:76626063-76626085 ACAGAAACACACATAAAAAAAGG + Intronic
1055579138 9:77689925-77689947 ATACACACACACATAAAATAAGG - Intergenic
1055659523 9:78488929-78488951 AAACAAACCCACATAAAACAAGG - Intergenic
1055737905 9:79352297-79352319 GCAGAAACACACGTAAAACAAGG - Intergenic
1056081689 9:83101813-83101835 ACAGAAACACACATAAAACAAGG - Intergenic
1056145806 9:83728214-83728236 ATAGAAACACACATAAAAGAAGG + Intergenic
1056274230 9:84977147-84977169 ACAGAAACGTACATAAAACAAGG - Intronic
1056375700 9:86008515-86008537 ACAGAAATACACATAAAATAAGG + Intronic
1056420349 9:86419922-86419944 ACAGAAACACACATAACACAAGG - Intergenic
1056445818 9:86665488-86665510 CTAAGAACATCCATAAAACAGGG + Intergenic
1056449628 9:86704005-86704027 ATAGAAAAACACATAGAATAAGG + Intergenic
1056544151 9:87599870-87599892 ACAGAAACACACATAAAACAAGG - Intronic
1056782081 9:89558050-89558072 ATAGAAACACACATCAAACAAGG + Intergenic
1056925637 9:90832056-90832078 ATAGAAATACACATAAAACAAGG + Intronic
1057028834 9:91757828-91757850 ACAGAAACACACATAAACCAAGG - Intronic
1057776338 9:98013333-98013355 CTAAAAACACATTTAAAACATGG - Intronic
1057887009 9:98837465-98837487 ACAGAAACACATAGAAAACAAGG - Intronic
1057891877 9:98875761-98875783 CTAGGCACACACATACATCATGG + Intergenic
1058333536 9:103796212-103796234 CTACAAACACAAACAAAACATGG + Intergenic
1058344023 9:103937065-103937087 ATAGAAACATATTTAAAACATGG + Intergenic
1058402639 9:104635962-104635984 CAAGAAACACATGTAACACATGG + Intergenic
1058649609 9:107162825-107162847 ATGGAAACACACTTAAAACAAGG + Intergenic
1058721312 9:107767134-107767156 AAAGAAACACACATACATCATGG - Intergenic
1058775110 9:108275385-108275407 ACAGAAGCACACAGAAAACAAGG + Intergenic
1058925781 9:109662348-109662370 CTAAAAACTCTCAAAAAACAAGG - Intronic
1059317253 9:113436387-113436409 CTAGAACCAGATATAAAAGAGGG - Intergenic
1059788110 9:117608960-117608982 ACAAAAATACACATAAAACAAGG - Intergenic
1059818202 9:117941795-117941817 CTAGAAACATAAATATAATATGG + Intergenic
1059828459 9:118062140-118062162 GTATAAACACACATAAAAACAGG - Intergenic
1060995945 9:127874996-127875018 CTCGAAACTCCCAGAAAACAGGG + Intronic
1061573153 9:131489988-131490010 CTTGAAACACACCCAAAGCAGGG - Intronic
1062415154 9:136445122-136445144 GCAAGAACACACATAAAACACGG + Intronic
1062748210 9:138230431-138230453 CTAAAAACCCAAATAAAACTGGG - Intergenic
1202785499 9_KI270719v1_random:13399-13421 CCAGAAGCACTCATAAAACTCGG + Intergenic
1203372245 Un_KI270442v1:318944-318966 CTTGAAACCCACACAAGACAAGG + Intergenic
1185634419 X:1541067-1541089 ACAGAAACACACGTAAAATAAGG - Intergenic
1185885993 X:3783451-3783473 ACAGAAACACACCTAAAACAAGG + Intergenic
1186043183 X:5504004-5504026 CAAGAAATATACCTAAAACAAGG - Intergenic
1186057217 X:5662623-5662645 ACAGAAATACACATAAAACAAGG - Intergenic
1186134558 X:6505401-6505423 CTGAATACACATATAAAACATGG + Intergenic
1186158862 X:6755188-6755210 ACAGAAACACACAGAAAACAAGG + Intergenic
1186589244 X:10912129-10912151 CAAGAGAAACACATAAAACAAGG - Intergenic
1187025201 X:15428223-15428245 CTTGAAACACACATAAAAGAAGG + Intronic
1187105879 X:16241027-16241049 ATAGAAACAAACATAAGATAAGG + Intergenic
1187124253 X:16438783-16438805 ACAGAAACATATATAAAACAGGG + Intergenic
1187287513 X:17919889-17919911 ACAGAAACACACATAAAACAAGG - Intergenic
1187386636 X:18854869-18854891 ACAGAAACATACACAAAACAAGG + Intergenic
1187544073 X:20230204-20230226 CTGGGCACAGACATAAAACAAGG + Intronic
1187881519 X:23851912-23851934 ATACATACATACATAAAACAGGG - Intronic
1188360240 X:29244022-29244044 CTAGAAACAAATAGATAACAGGG - Intronic
1188437413 X:30177199-30177221 CAGGAAACACACGTAGAACATGG - Intergenic
1188545733 X:31304467-31304489 CTATAAAGACATATATAACAAGG - Intronic
1188753455 X:33931960-33931982 CAAGAAACAAACATAAAATTGGG + Intergenic
1189140257 X:38597571-38597593 AAACAAACACATATAAAACAAGG + Intronic
1189294063 X:39906457-39906479 CGTGAAACACAGATCAAACACGG + Intergenic
1189459378 X:41225702-41225724 GTAGAAACACACATACAACAAGG - Intronic
1189529093 X:41859789-41859811 ACAGAAGCACACATAAAACAAGG + Intronic
1189633927 X:42984914-42984936 CCAGAAACACATAGTAAACAAGG + Intergenic
1191763030 X:64664538-64664560 CTAGAAACACCTAGACAACAGGG + Intergenic
1191940751 X:66479198-66479220 CAAGAAACTCCCTTAAAACATGG + Intergenic
1192123612 X:68479736-68479758 TTAGAGACACATATAAAACATGG - Intergenic
1192728665 X:73779672-73779694 ACGGAAACACACATAAAACAAGG - Intergenic
1193082380 X:77418578-77418600 ACAGAAACACACACAAAACAAGG - Intergenic
1193326311 X:80181898-80181920 CTAGTTACACAGATATAACAAGG + Intergenic
1193797617 X:85895680-85895702 CTAGAAATGCACATAAAAGTAGG - Intronic
1193906197 X:87247403-87247425 TTAAAAAGACACATAAACCAAGG - Intergenic
1194504683 X:94718669-94718691 CTTAAAAGACAAATAAAACATGG - Intergenic
1195171870 X:102276985-102277007 CTACATACACACATCAATCAAGG - Intergenic
1195186990 X:102410108-102410130 CTACATACACACATCAATCAAGG + Intronic
1195344584 X:103936828-103936850 CTAAAAACACTCAATAAACAAGG - Intronic
1195366258 X:104128957-104128979 ACAGAAGCATACATAAAACAAGG - Intronic
1195571011 X:106398714-106398736 ACAAAAACACATATAAAACAAGG + Intergenic
1196064879 X:111453212-111453234 CTAGAAAAAAATATAAATCAGGG + Intergenic
1196772252 X:119306570-119306592 ACAGAAACACATATAACACACGG - Intergenic
1196967123 X:121068672-121068694 TAAGAAATACACATAAAACAAGG + Intergenic
1196980291 X:121205642-121205664 ATAGAATCAGAGATAAAACAAGG - Intergenic
1197842649 X:130765527-130765549 CTACAACCACACACAAAATATGG - Intronic
1198118988 X:133572610-133572632 CTAAAAACAGAGATAAAAAAGGG + Intronic
1198160607 X:134004130-134004152 CTAGCAACACACGTGTAACAAGG - Intergenic
1199080961 X:143576476-143576498 ATACACACACACACAAAACATGG + Intergenic
1199118424 X:144020717-144020739 CTAAAAACAAACAAAAAAAAAGG + Intergenic
1199231157 X:145437368-145437390 ATGGAAAAATACATAAAACAAGG - Intergenic
1200412562 Y:2876016-2876038 CAAACAACACACACAAAACAAGG - Intronic
1200593601 Y:5108923-5108945 CTAGATACACAATTACAACATGG - Intronic
1200778153 Y:7188779-7188801 GTAGAAACACAGTGAAAACAAGG - Intergenic
1201912647 Y:19148707-19148729 ACAGACACACACCTAAAACAAGG - Intergenic
1202329965 Y:23739063-23739085 CCAGAAAAAAATATAAAACAGGG - Intergenic
1202540805 Y:25930991-25931013 CCAGAAAAAAATATAAAACAGGG + Intergenic