ID: 973148061

View in Genome Browser
Species Human (GRCh38)
Location 4:46854501-46854523
Sequence AATAGAACTTTCAGCAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1012
Summary {0: 1, 1: 14, 2: 89, 3: 267, 4: 641}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973148061_973148064 11 Left 973148061 4:46854501-46854523 CCATCACTGCTGAAAGTTCTATT 0: 1
1: 14
2: 89
3: 267
4: 641
Right 973148064 4:46854535-46854557 TTCTACACTGTAAATCCATAAGG 0: 1
1: 0
2: 1
3: 11
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973148061 Original CRISPR AATAGAACTTTCAGCAGTGA TGG (reversed) Intronic
900750525 1:4394164-4394186 AATAGGACTTTTTGGAGTGATGG + Intergenic
901202313 1:7473637-7473659 AAAAGATTCTTCAGCAGTGAGGG - Intronic
901346008 1:8543084-8543106 AATAGAACTTTCTGCTGTGATGG - Intronic
901358980 1:8679083-8679105 AATAGAACTTTCAGTGGCAATGG - Intronic
902778257 1:18688544-18688566 AATAGAAGTTTCTGCGATGACGG - Intronic
903080704 1:20809868-20809890 AATAAAACTTTCCACAGTGATGG - Intronic
903308512 1:22432597-22432619 AACAGGACTTTCTGCAATGAAGG - Intergenic
903593217 1:24473040-24473062 AGTAGAACTTTCTGCGATGATGG + Intergenic
904149639 1:28426902-28426924 AGTAGAACTTTCTGCAAAGATGG + Intronic
904253900 1:29242447-29242469 AATAGAACCTTCTGTGGTGATGG + Intronic
904316240 1:29666524-29666546 AAAATAATTTTCATCAGTGAAGG + Intergenic
904776635 1:32912552-32912574 AATAGAACTTTCTGTAATGAGGG + Intergenic
904868545 1:33601916-33601938 AGCAGAACTTTCTGCAGTGATGG - Intronic
905360187 1:37413733-37413755 AATAGAACTTTCTGCCATGATGG + Intergenic
905555707 1:38881629-38881651 AATAGAACTTTCTGCAACAATGG + Intergenic
905712781 1:40120717-40120739 AGTAGAATTTTCTGCAATGATGG + Intergenic
906138225 1:43515563-43515585 AACAGAACTTTCTGCATTGAGGG + Intergenic
906203253 1:43973269-43973291 AATAGAACTTTCTGCCATGATGG - Exonic
906340577 1:44976909-44976931 AAAGGAACTTTCAGGGGTGATGG + Intronic
906390861 1:45414853-45414875 AATAGAACCTTCTGCAGTGATGG - Intronic
906674647 1:47684416-47684438 AATAGAACTCTCTACAGAGATGG + Intergenic
906863749 1:49392276-49392298 AATAGAACTTTCTACAGTAATGG - Intronic
906917398 1:50025721-50025743 AACAAAACTTTCTGCAGTGATGG - Intergenic
907836948 1:58118897-58118919 AATCGAACTTTCTGCTCTGATGG + Intronic
908018520 1:59874242-59874264 AATAGAACTTTCTGCAATGATGG - Exonic
908348528 1:63260858-63260880 AGTAGAACTTTCCACAGTGATGG + Intergenic
908430101 1:64048347-64048369 ACCAGAACTTTCTGCAATGATGG - Intronic
908447479 1:64214172-64214194 AGTAGCACTTTCTGCATTGATGG + Intronic
908587484 1:65586953-65586975 AATAGAAAATACATCAGTGAAGG + Intronic
908857013 1:68442108-68442130 AATAGAACTTTCTGCAATAATGG - Intronic
908865604 1:68546163-68546185 AGTAGAACTTTCTGCAATGCTGG - Intergenic
908959075 1:69672373-69672395 AATAGAACTTTCTGCAATGATGG - Intronic
909312358 1:74168860-74168882 AAAAGAACTTTTAGAGGTGATGG - Intronic
910007400 1:82415731-82415753 AATAGAACTTCCTGCAGTGAGGG + Intergenic
910164035 1:84304346-84304368 AACAGTACTTTCAACAATGATGG + Intronic
910241333 1:85089500-85089522 AAGATACATTTCAGCAGTGATGG - Intronic
910312536 1:85840964-85840986 AATCTAACTTTCTGCATTGAAGG - Intronic
910474643 1:87593755-87593777 AACAGAACTTTCTGCAGTGCTGG - Intergenic
910536090 1:88299330-88299352 AATAGAACTGTCAGCAATTATGG + Intergenic
910993722 1:93081679-93081701 AGTAGAAATTTCTCCAGTGATGG + Intronic
911097514 1:94066809-94066831 AGTAGAACTTTCTGCAGTGATGG + Intronic
911140132 1:94491989-94492011 CGTAGAACTTTCTGCAATGATGG + Intronic
911171912 1:94779062-94779084 AATAAAACTTTCATCTTTGATGG - Intergenic
911312416 1:96309929-96309951 AACAGAACTTTCTACAGTGATGG + Intergenic
911391540 1:97250798-97250820 AAGAGAACTTTCTGGTGTGAAGG + Intronic
911627285 1:100138862-100138884 AACAGAACTTTCTGCAATGATGG - Intronic
912229838 1:107779997-107780019 AATAGAACTTTCTGTGATGATGG - Intronic
912304376 1:108551542-108551564 AATAGAACTTTCTGCAATAATGG - Intergenic
912378419 1:109231866-109231888 AATAGGACTTTCTGCGATGATGG + Intronic
912378537 1:109233034-109233056 AATAGAACTTTCTGCACTGATGG + Intronic
912528892 1:110305949-110305971 AGCAGAACCTTCTGCAGTGATGG - Intergenic
912800734 1:112718429-112718451 AACAGAACTTTGTGCACTGACGG + Intergenic
912993183 1:114509757-114509779 CATATAACTTGCAGCAGTGGAGG - Intronic
913494317 1:119414182-119414204 GATAAAACTTTCTGGAGTGAAGG + Intergenic
913504713 1:119506281-119506303 AAAACAACTTTCTGGAGTGACGG + Intergenic
913515239 1:119599833-119599855 AAAAGAACTTTCTGCAGTGAAGG + Intergenic
913572295 1:120132651-120132673 TATAGAATTTTAAGCATTGATGG + Intergenic
914293216 1:146294295-146294317 TATAGAATTTTAAGCATTGATGG + Intergenic
914424719 1:147565034-147565056 ACTAGAACGTTCTGCAGAGATGG - Intronic
914554260 1:148745078-148745100 TATAGAATTTTAAGCATTGATGG + Intergenic
914942226 1:152033385-152033407 AGTAGAACTTTCTGCAGTGGTGG - Intronic
914948086 1:152084821-152084843 AATAAAATATTCAGCAGTGGGGG - Exonic
915139283 1:153756887-153756909 AACAGAACTTTCGGCAATGATGG - Intronic
915573287 1:156757919-156757941 AATAGAACTTACTGCAGTGATGG - Intronic
915889449 1:159758752-159758774 GATAGAACTTTCTGCATTGATGG - Intergenic
916236809 1:162597149-162597171 GATAGAACTTTCTGCAGTGAAGG + Intronic
916441443 1:164829397-164829419 AATATAACTTTTTGCATTGATGG + Intronic
916494327 1:165331327-165331349 AATACAACTTTCTGCAATGATGG + Intronic
916758938 1:167799649-167799671 AATAGAACTTTCTGCAATGAAGG - Intergenic
916915144 1:169398744-169398766 AATAGAACTTTCTGGGATGATGG - Intronic
916974929 1:170065861-170065883 AATAGAACTTTCTTCCCTGATGG - Intronic
917163626 1:172086445-172086467 AATAGAACTTTCTGAGATGATGG + Intronic
917327538 1:173848389-173848411 AATAAAACTTTCTGTAATGATGG + Intronic
917369965 1:174281832-174281854 TATAGAACTTTTAAGAGTGAGGG - Intronic
918017263 1:180647943-180647965 AGTAGATCTTTCTGCAGTGTAGG + Intronic
918102248 1:181386538-181386560 AATAAAACTTTTTGCAGTGATGG + Intergenic
918198578 1:182245829-182245851 AATAGAACGTTGTGCAGTGATGG - Intergenic
918252937 1:182720204-182720226 AATAGAACTGTAAGCTCTGAGGG - Intergenic
918567094 1:185947221-185947243 AATAGGACTTTCTGCAATGATGG + Intronic
918591684 1:186247699-186247721 AATTGAAATTTCAGCATGGAAGG + Intergenic
919447281 1:197723384-197723406 AATCGAACCATCAACAGTGAGGG + Intronic
921102144 1:211937757-211937779 AACAGAACTTTCTGTAATGATGG - Intergenic
921398966 1:214699381-214699403 CATAGAACTCTTAGCACTGAAGG + Intergenic
921522910 1:216178706-216178728 AATAGAACTTTCTCCAATGAAGG + Intronic
921535825 1:216347898-216347920 GATAAAACTTTCAGTACTGATGG + Intronic
921555822 1:216597648-216597670 AATAGAACTTTCTGCAGTTATGG - Intronic
921796839 1:219355100-219355122 AATAAATCTTTCTGCAATGATGG + Intergenic
921856224 1:219987935-219987957 AGTAGAACTTTCTGCAGTGATGG - Intronic
921881588 1:220260795-220260817 AATAGAACTTTCTGTAATCATGG + Intronic
922146630 1:222952321-222952343 AATAAAACTCTCTGCAATGATGG - Intronic
922324994 1:224519966-224519988 AATAGAACTTTCTACAGTGATGG - Intronic
922656664 1:227390650-227390672 AAGAGAACTTTCTGTAATGATGG - Intergenic
922700729 1:227758620-227758642 AACAGACCTTTCTGCAGTGATGG - Intronic
923563075 1:235056308-235056330 AAAGAAACTTCCAGCAGTGATGG + Intergenic
923857729 1:237863134-237863156 ACCAGAACTTTCTCCAGTGATGG + Intergenic
924106033 1:240649910-240649932 AATAGCTCTTTCGTCAGTGAAGG + Intergenic
924201497 1:241663819-241663841 AGTTGAACTTTCTGCAATGATGG - Intronic
924202495 1:241674601-241674623 ATTTCAACTTTCAGCAGTAAAGG - Intronic
924305347 1:242682768-242682790 AGTAGAACTTTCTGCAATGGTGG - Intergenic
924518845 1:244788429-244788451 AATAAAACTTTCTGCAATGATGG - Intergenic
924523482 1:244826172-244826194 AAGAGAACTTTTTGCAGAGAAGG - Intergenic
1063486002 10:6421589-6421611 AACAGAACTTTCTGCTGTGATGG - Intergenic
1063987318 10:11518941-11518963 AGTGGACCTTTCTGCAGTGATGG - Intronic
1064305037 10:14157923-14157945 AATAGAATTTTCAGCAGACAAGG + Intronic
1065357339 10:24855332-24855354 AAGAGAACATCCAGAAGTGACGG - Exonic
1065396116 10:25239726-25239748 AACAGAACTTTCTGCACTGAAGG - Intronic
1065492469 10:26295756-26295778 AACAGAACTCTGTGCAGTGATGG - Intronic
1066128865 10:32370647-32370669 AATAGAGCTTTGGGCAGTCATGG + Intronic
1067361612 10:45586179-45586201 AAGAGAACTTTCTGTGGTGATGG - Intronic
1068109014 10:52656449-52656471 AGTAGAACTTTCGGTATTGATGG - Intergenic
1068274103 10:54770110-54770132 GATAGAACTTTCTTCAGTAATGG - Intronic
1068507822 10:57925202-57925224 AGTAGAGATTTCAGCAGTAAAGG + Intergenic
1068776746 10:60875466-60875488 AGTAGAACTTTCTGCAGTGATGG - Intronic
1068938911 10:62661876-62661898 ACTAGAACTGTCACCAGTGGAGG + Intronic
1068946791 10:62737631-62737653 AATAGAACTTTCTGCAATGATGG - Intergenic
1069119567 10:64552122-64552144 AATAGAACTGTCAACAGAGATGG - Intergenic
1069976936 10:72221496-72221518 AATAGAACTTTCTGCCATGATGG - Intronic
1070014783 10:72515813-72515835 AAAAGAACTTTCGGAAGTGATGG - Intronic
1070140728 10:73735131-73735153 AATAGAACAAACAGCAGAGAGGG - Intergenic
1070649752 10:78226542-78226564 ACTGGAACTTTCTGCAGTGATGG - Intergenic
1070670593 10:78374816-78374838 AATAGAACTGTCAGAAGTACAGG - Intergenic
1071026743 10:81123624-81123646 AATAGAACTTTCTACAATGCTGG + Intergenic
1071847896 10:89538271-89538293 AACAGAATTTTCTACAGTGATGG + Intronic
1072240783 10:93494152-93494174 AATACAACTTTCTGCAGTGATGG - Intergenic
1073465845 10:103694099-103694121 AACAGAACTTTCAGCCTTTAGGG - Intronic
1073632748 10:105164951-105164973 AATAGAATGTTCAGCGATGATGG + Intronic
1073920781 10:108456074-108456096 AATAGAACTTTCTGCAATGATGG - Intergenic
1074113474 10:110438543-110438565 AATGGAACTTTCTGCAATGATGG + Intergenic
1074440675 10:113475031-113475053 TAGAGAAATTTCAGCAGTGGTGG + Intergenic
1074691250 10:116006516-116006538 ATTAGAACTTTCTGCTGTGATGG - Intergenic
1074752839 10:116603350-116603372 AACAGAACTTTCTGCAATGAGGG + Intronic
1075045714 10:119144907-119144929 AGTGGAACTTTCTGCAGTGATGG - Intronic
1075064087 10:119277673-119277695 GAGTAAACTTTCAGCAGTGATGG - Intronic
1075426294 10:122344136-122344158 AACTGAACTTTCCGCAATGATGG + Intergenic
1075437631 10:122457430-122457452 TCTAGAATTTTCTGCAGTGATGG - Intergenic
1075502644 10:122989770-122989792 AACATAACTTTCTGCAGTGATGG - Intronic
1075597798 10:123744821-123744843 AATAGAACTTTCCGTGATGATGG - Intronic
1075743133 10:124707860-124707882 AACTGAGCTTCCAGCAGTGATGG + Intronic
1075913215 10:126144407-126144429 AATAGAGCTTACAGCAGAGTGGG - Intronic
1075966020 10:126612402-126612424 AATAGAACTTTCTACAATGATGG - Intronic
1076013431 10:127008441-127008463 AATAGAACTTTCTGTAATGATGG - Intronic
1076018420 10:127048735-127048757 AACAGAACTTTCTACAGTGATGG - Intronic
1076023319 10:127092143-127092165 AGCAGAACTTTCCGCAGTGATGG - Intronic
1076190252 10:128478158-128478180 AATAGATCTTTCTGCAATGATGG - Intergenic
1076295065 10:129377779-129377801 CATAGAACTTTCTGCTCTGATGG - Intergenic
1076400358 10:130179807-130179829 AAGAGATCTTTCACCAGCGAGGG - Intronic
1076649065 10:131974908-131974930 AATTGCACTTTTAGCAGTAAGGG - Intronic
1077659397 11:4053938-4053960 AACAGAACTTTCTACAATGATGG + Intronic
1077915894 11:6611467-6611489 AAGAGAACTGTCAGCAGAGCGGG + Intronic
1078778210 11:14412654-14412676 AATAGAACTTTCTGAAATGATGG - Intergenic
1078813081 11:14790925-14790947 AATAGAAATTTTTGCAATGATGG + Intronic
1079293200 11:19207435-19207457 AAGAGACCTTTCTGCAGTGATGG - Intronic
1079309705 11:19354257-19354279 AACAGAACTTCCTGCAATGATGG + Intronic
1079464677 11:20718173-20718195 AATAGAACTTTCTGTGATGATGG + Intronic
1079646214 11:22866402-22866424 AAAAAAGCTCTCAGCAGTGAGGG - Intergenic
1079875210 11:25847748-25847770 AGTAGAATTTTCTGCAATGATGG - Intergenic
1079948402 11:26771084-26771106 AATGGAACTTTCTGCAATGATGG + Intergenic
1080006222 11:27409975-27409997 AATAGAACTTTCTGCAATGATGG + Intronic
1080356037 11:31447048-31447070 AATAGAACTTTCTGAAATAATGG - Intronic
1080368912 11:31611177-31611199 AGTAGAATTTTCTGCAGTGATGG + Intronic
1080389895 11:31835291-31835313 AATAAAACATTCTGTAGTGATGG + Intronic
1080673503 11:34402944-34402966 AACAGAACTTTCTGCAATGATGG + Intergenic
1080730025 11:34941010-34941032 AATAGAAGTTTCTGTGGTGATGG + Intronic
1080753986 11:35177939-35177961 AATAGAACTTTCTGCAATGATGG - Intronic
1080758474 11:35225031-35225053 AATAGAACTTTCTGTGATGATGG + Intronic
1080954421 11:37076560-37076582 AACAGAACTTTCTGCAATGAAGG + Intergenic
1081209003 11:40308764-40308786 AAGAAAAATGTCAGCAGTGACGG + Intronic
1081296851 11:41401338-41401360 AATAGAACTTTCTGCCGTAATGG - Intronic
1082186143 11:49183885-49183907 AAAAGAACTTTCCAGAGTGATGG + Intronic
1082186814 11:49192472-49192494 AAGGGAACTTTCTGAAGTGAAGG + Intronic
1082929420 11:58584715-58584737 TACAGAATTTTCAGCAGTGATGG - Intronic
1083106208 11:60360889-60360911 AAAACAACTCTCAGCAGAGAGGG + Intronic
1085071381 11:73549506-73549528 TGCAGAACTTTCTGCAGTGATGG - Intronic
1085358721 11:75865409-75865431 AATAAAACTTTCTGCAATGATGG + Intronic
1086419210 11:86621503-86621525 AAAAAAACTTTCTGAAGTGATGG - Intronic
1086578308 11:88366163-88366185 AATAGAACTTTCTGTGATGATGG + Intergenic
1086679522 11:89652897-89652919 AAGGGAACTTTCAGAAGTGAAGG - Intergenic
1086680189 11:89661486-89661508 AAAAGAACTTTCCAGAGTGATGG - Intergenic
1087142178 11:94775676-94775698 AACAGAAATTGCTGCAGTGATGG - Intronic
1087674375 11:101142128-101142150 AAAAAAACTTTCAGGAGTCAGGG - Intergenic
1088220723 11:107567369-107567391 CATAGAGCTTTCTGCAATGATGG + Intergenic
1088296139 11:108296888-108296910 CACAGAACTTTCTGCAATGATGG - Intronic
1088752255 11:112854003-112854025 AATGGAAATTTCTGCAATGATGG + Intergenic
1089613564 11:119682910-119682932 AATAGAACTGTCAGCTGAGTAGG - Intronic
1089720732 11:120418179-120418201 GAAGGAACTTTCTGCAGTGATGG - Intronic
1089926192 11:122260711-122260733 AATAGAATTTTCTGCAGTGATGG - Intergenic
1090250218 11:125245732-125245754 AAAAGAAGTTTGAGGAGTGAAGG + Intronic
1090260180 11:125313864-125313886 AATAGAACTCTCTGTGGTGATGG - Intronic
1090270671 11:125383810-125383832 AACAGAACTTTCTGCAATGGTGG - Intronic
1090329484 11:125919803-125919825 AACAGAGCTTTCTGCAGTGATGG + Intronic
1090331299 11:125934299-125934321 AATAGAACTTTCTGCAATGATGG + Intergenic
1091078748 11:132645879-132645901 AATAGACCTTTCCGCGATGACGG - Intronic
1092117888 12:6022472-6022494 GATAGAACTTTCTGCAGTGGGGG - Intronic
1092992399 12:13915540-13915562 AACAGGACTGTCTGCAGTGATGG + Intronic
1092996735 12:13958050-13958072 AATAAAACTTTCTACCGTGACGG - Intronic
1093005337 12:14045021-14045043 AACAGAACTTTCTGCAATGATGG + Intergenic
1094117455 12:26932584-26932606 AATAGAACTTACTGCGATGATGG + Intronic
1094210205 12:27881800-27881822 AATAAAACATTCAGCAGTGATGG + Intergenic
1094322603 12:29201882-29201904 AATAAAACTTTCTGTAGTGGTGG - Intronic
1094342327 12:29426801-29426823 AATAGAACTTTCTGCAATGATGG + Intronic
1095471163 12:42538334-42538356 AACAGAACCTTCTGCAATGATGG - Intronic
1095539357 12:43290521-43290543 AATAGAACTTTCTGTATTGATGG + Intergenic
1095580905 12:43796619-43796641 AATAGGACTTTTTGCACTGATGG + Intronic
1095587068 12:43861144-43861166 AATAGTATTTTCAGCAGTGGAGG + Intronic
1096673261 12:53212879-53212901 AGTAGAACTTTCTGCAATGATGG - Intronic
1097292464 12:57929648-57929670 GAGAGAACTTTCTGGAGTGAAGG + Intergenic
1097349012 12:58527249-58527271 AATAGCACTTTCTGAAGTAAGGG - Intergenic
1097381562 12:58901586-58901608 AATGGCACTTTCTGCAGTGATGG - Intronic
1097842442 12:64335038-64335060 AACAGAACTTTTGGCAATGATGG - Intronic
1097894215 12:64808279-64808301 AAAAGAACTTTCAAAAGGGATGG - Intronic
1097961749 12:65538336-65538358 AATAGAACTTTTTGCAATAATGG + Intergenic
1098328487 12:69327424-69327446 AACAGAACTTTCATCATTGCTGG + Intergenic
1098810870 12:75089912-75089934 AGTAGAACTTTCTGGAATGATGG - Intronic
1098858317 12:75679353-75679375 AATGGGATTTTCAGCAATGAGGG + Intergenic
1098994174 12:77099079-77099101 AATAGAACTTTCCCCAATGATGG - Intergenic
1099002645 12:77198321-77198343 AAAATAACTTTCAAAAGTGAAGG - Intergenic
1099363347 12:81735390-81735412 CATAGACATTTCATCAGTGATGG - Intronic
1099447760 12:82772545-82772567 AGGAGAACTTTCTGCAATGATGG - Intronic
1099591668 12:84599423-84599445 AATAGAACTGTCTACAATGATGG - Intergenic
1099665644 12:85625594-85625616 AACAGAACTTTCTACAATGAAGG - Intergenic
1100107953 12:91200317-91200339 AATAGAACTTTCTCCAGTAATGG + Intergenic
1100117308 12:91322718-91322740 AAGAGAGCTTTCAGCAATGATGG + Intergenic
1100307074 12:93360498-93360520 AAAGGAACTTTCTGGAGTGATGG + Intergenic
1100889038 12:99103169-99103191 AGCAGAAGTATCAGCAGTGAAGG - Intronic
1101307827 12:103547341-103547363 AATAGAACTTTCTACAATAATGG - Intergenic
1101329163 12:103743568-103743590 AATCAAACTTTCGGCAGTGCGGG + Intronic
1101686111 12:107023440-107023462 AGTAGAACTTTCTGCAATGATGG - Intronic
1101732163 12:107435833-107435855 AGTAGAACTTTCTGCACTGATGG + Intronic
1101931397 12:109017054-109017076 AATAGAACTTTCTGCAATTATGG + Intronic
1103021546 12:117538606-117538628 AATGGAACTTTCAGTGATGATGG + Intronic
1103403180 12:120657046-120657068 GGTAGAACTTTCTACAGTGATGG + Intronic
1103468799 12:121163421-121163443 AATTGAACTTGATGCAGTGATGG + Intronic
1103559102 12:121783094-121783116 AGTAGAACTTTCTGCAGTGGAGG - Intronic
1103566836 12:121820341-121820363 AGTAGAACTTTCCACAGTGATGG + Intronic
1103618038 12:122167694-122167716 AATAGAACTTCCTGCGGTAATGG + Intergenic
1103687098 12:122740806-122740828 AATAGAGCTTTCTACCGTGATGG + Intergenic
1104171108 12:126281679-126281701 AATGGGACCTTCTGCAGTGAAGG - Intergenic
1104428169 12:128695087-128695109 AATAGGACTTTCTACAGTGGTGG + Intronic
1104529626 12:129556845-129556867 AATAGAATTTTCTGTGGTGATGG - Intronic
1105395902 13:20034383-20034405 AAGAGACCTTTCTGTAGTGAAGG + Exonic
1105456501 13:20545893-20545915 AAGAGAACTTTCTGCAGTAGTGG + Intergenic
1105572674 13:21618827-21618849 AGTAGAACTTTCCGTGGTGATGG - Intergenic
1105656578 13:22447358-22447380 AACAGAACTGTCAACAGTGCAGG - Intergenic
1105991958 13:25631207-25631229 AACAGGACTTTCTGCAGTGATGG + Intronic
1106261459 13:28070811-28070833 AATAAAACAGTCTGCAGTGATGG + Intronic
1106451132 13:29883526-29883548 AACAGAACTTTCTGCAATGAAGG + Intergenic
1106551283 13:30773355-30773377 AATGGGACTGACAGCAGTGACGG + Intergenic
1106909925 13:34452626-34452648 AATAGCATTTTCAGAAGAGATGG - Intergenic
1106986289 13:35355538-35355560 AAAAGAACTTTCTGCAATGACGG - Intronic
1107637187 13:42404431-42404453 AACATAACTTTCTGCAATGATGG - Intergenic
1107670567 13:42742630-42742652 AACAGAGCTTTCTGCAATGATGG + Intergenic
1107812935 13:44217408-44217430 AATAGAATTTTCTGCAATGACGG + Intergenic
1108193532 13:47968159-47968181 AATAAAACCTTCTGCAATGATGG + Intronic
1108739776 13:53323775-53323797 AATAGAATTATCTGCATTGATGG + Intergenic
1109236487 13:59827603-59827625 AAAAGAACTTTCAGCAAAGTTGG + Intronic
1109422984 13:62137773-62137795 AAAACAGCTTTCAGCAGAGAGGG - Intergenic
1109770643 13:66967479-66967501 TAAAGAACTTTCTGCAGTGATGG - Intronic
1110194202 13:72767609-72767631 AACAGAACGTTCTGCAGTGATGG + Intronic
1110333385 13:74298503-74298525 AATAGAACTTTCTGCAACAATGG - Intergenic
1110962937 13:81653003-81653025 AATAATACATTCAGCAATGAAGG - Intergenic
1110988090 13:82000041-82000063 AATAAAACTTTCTGCAGTGTTGG - Intergenic
1111666129 13:91270995-91271017 AATAGAACTTTCTGTGATGATGG - Intergenic
1111824662 13:93252484-93252506 AAGAGAACTTTCAACAGGGTTGG - Intronic
1111882771 13:93979101-93979123 AATAGAACTTTCTGAGATGAGGG + Intronic
1112219834 13:97476920-97476942 AATAGAATGTTCTGCAATGATGG - Intergenic
1113424311 13:110195327-110195349 AATAGAAATGTTGGCAGTGATGG - Intronic
1115317430 14:32039820-32039842 AATAGAACTTTCTATAGCGAAGG + Intergenic
1115490409 14:33952775-33952797 AAGAGCTCTTTGAGCAGTGATGG - Intronic
1115668281 14:35578713-35578735 AATAGAATTATCTGCAGTTATGG + Intronic
1115706201 14:36000982-36001004 GAAGGAACTTTCAGGAGTGATGG + Intergenic
1116553821 14:46277602-46277624 AATAGAATATTCAAAAGTGATGG + Intergenic
1117047200 14:51825297-51825319 AATAGAAGCAACAGCAGTGATGG + Intergenic
1117062158 14:51973972-51973994 AATAGAACCTTCCACGGTGATGG - Intronic
1117405556 14:55399372-55399394 AGTAGAACTTTCCACAATGATGG - Intronic
1117560890 14:56937258-56937280 AATAGAACTTTCTGCAATGACGG - Intergenic
1117882010 14:60321240-60321262 AGTAGAACTTTCAGCTATAATGG - Intergenic
1118111411 14:62724536-62724558 CATAGAAATTTCAGCAGAGTTGG - Intronic
1118230795 14:63947223-63947245 AATAGGATTTTCTGCAGTGATGG + Intronic
1118519679 14:66569136-66569158 AATAGTTCTTTCATCAGTGAAGG - Intronic
1118581401 14:67303152-67303174 AATAGAACTTTCTCCAATGATGG - Intronic
1119403889 14:74383591-74383613 AAGAGAACTTTCTGGAGTTATGG + Intergenic
1119446576 14:74669562-74669584 AAGAGAACTTTCTGCAGTGGTGG - Intronic
1119701364 14:76757456-76757478 AAAAGAAATTTCTGCAGTGATGG + Intergenic
1119909691 14:78338354-78338376 AATAGGAATTTCTTCAGTGATGG - Intronic
1119940758 14:78638813-78638835 AATATACCTTTCAGCACTGAGGG + Intronic
1120301892 14:82718193-82718215 AATACAACTGTCAGCAAGGATGG - Intergenic
1120821737 14:88917726-88917748 AGTGGAACTTTCTGCAGTGGTGG + Intergenic
1120869584 14:89325140-89325162 AGCAGAACTTTCTGCAGTGGTGG - Intronic
1121478402 14:94236751-94236773 AGTAGAACTTTCTCCAATGATGG - Intronic
1122331282 14:100916222-100916244 AGTAGAACTTTCTGCAGTGATGG + Intergenic
1124114192 15:26825091-26825113 AATAGTACTTACTGCAATGAAGG + Intronic
1124374597 15:29122158-29122180 ACGAGAACTTTGTGCAGTGATGG - Exonic
1124861635 15:33447769-33447791 AAAAGAACTTTCAGTGATGATGG - Intronic
1124996658 15:34729642-34729664 AATATAACTTACTGCAATGATGG + Intergenic
1125670643 15:41469984-41470006 AAGAGAACTGTCAGTAGTGTTGG + Intronic
1125953225 15:43771598-43771620 AATAGAGCTTTCTTCAGTGATGG + Exonic
1126209363 15:46082399-46082421 AACAGAACTTTCTGCAATAATGG - Intergenic
1126302435 15:47213048-47213070 AAGAGAACTTTCTGAAGTGTTGG + Intronic
1126302446 15:47213241-47213263 AACAGAACTTCATGCAGTGATGG - Intronic
1126361344 15:47849490-47849512 AATAAACCTTTCAGAAGTTATGG + Intergenic
1126579786 15:50232276-50232298 TGTAGAACTTTCTGCAATGATGG + Intronic
1126636089 15:50781148-50781170 AATAGGACATTCTGCAGTGATGG - Intergenic
1127133989 15:55899730-55899752 AACAGAACTTTCTGTACTGATGG + Intronic
1127228244 15:56958591-56958613 AACAGAACTGTCTGCAGTGACGG - Intronic
1127661952 15:61108063-61108085 GAAGGAATTTTCAGCAGTGAGGG - Intronic
1127689287 15:61378620-61378642 AACAGAACTTTCTGTAGAGATGG + Intergenic
1128028298 15:64458431-64458453 AACAGAACTTTTTGCAGCGATGG - Intergenic
1128714600 15:69898807-69898829 AGTAGAACTTTCTGTGGTGAAGG - Intergenic
1128741216 15:70085116-70085138 AGTAGAACTTTCTTCAGTGATGG - Intronic
1129482261 15:75836805-75836827 AATAGAACTTTCTGCAATGATGG - Intergenic
1129610174 15:77047208-77047230 GAAAGAACTTTCTGCAGCGATGG + Intronic
1129614732 15:77089355-77089377 AATAGAACTTTCTGCAGGGATGG + Intergenic
1130015587 15:80183681-80183703 GATAGAACATTCAGAAGTGCTGG + Intronic
1130237749 15:82152948-82152970 AAAAGAACTTTCTGCAATGGTGG + Intronic
1130334824 15:82949872-82949894 AACAGAACTTTCTGCACTGCTGG - Intronic
1130624298 15:85497751-85497773 AACAGAATTTTCTGCAATGATGG - Intronic
1130731559 15:86498779-86498801 TATAAAACTATGAGCAGTGAAGG + Intronic
1130918159 15:88322210-88322232 TACAGAACTTTCTGCAGAGATGG + Intergenic
1131821952 15:96282791-96282813 AAAAGTAATTTCAGCAATGATGG + Intergenic
1132228868 15:100166981-100167003 AATAAAACTTTCTGCGATGACGG + Intronic
1132474568 16:127537-127559 AAAAGAACTTTCTACTGTGATGG + Intronic
1133626915 16:7579001-7579023 AACAGCACTTTCTGCAGAGATGG + Intronic
1133657893 16:7884229-7884251 AATAGAACTTTCTGTGATGATGG + Intergenic
1133883212 16:9802723-9802745 AATAGAACTTTCTGCAATGCTGG + Intronic
1134045728 16:11099533-11099555 AAAAGGACTTTCTGCATTGATGG - Intronic
1134880676 16:17743053-17743075 AGTAGAACTTTCTGCATTCATGG + Intergenic
1135090940 16:19516532-19516554 AGTAGAACTTTCTGCAATGATGG - Intronic
1135246521 16:20861841-20861863 AATAGGAATCTCAGCAGGGAAGG - Intronic
1136556157 16:31009182-31009204 AACAGAAGTTTCAGCACTGGGGG - Intronic
1137380802 16:47997715-47997737 AATGGAGCTTTCAACAGTGGAGG + Intergenic
1137490388 16:48927539-48927561 AATAGAACTTTCTGTGATGATGG + Intergenic
1137534505 16:49308047-49308069 AATAGAACTTTCAGTGATGAAGG + Intergenic
1137795415 16:51213504-51213526 AATAGAACTTCTAGCGATGATGG - Intergenic
1137810805 16:51350775-51350797 AGTGGAACTTTTTGCAGTGATGG - Intergenic
1138168532 16:54826695-54826717 AAAAGAACTTTCTGGGGTGACGG - Intergenic
1138440606 16:57032687-57032709 AATAGAACTTTCTGCAATGATGG - Intronic
1138523249 16:57585037-57585059 AACAGACCTGTCACCAGTGAAGG + Intronic
1138616503 16:58171664-58171686 AATAGGACCTTCTGCAATGATGG + Intronic
1138994009 16:62426328-62426350 AATAGACGTTTCTCCAGTGATGG + Intergenic
1139262838 16:65611517-65611539 AATAGAACTTTCTGCAATGATGG - Intergenic
1139661987 16:68427458-68427480 AACAGAACTTTCTGCAGTGATGG + Intronic
1139974649 16:70799790-70799812 AATAGAGCATTCTGCAATGATGG + Intronic
1140181200 16:72720276-72720298 AATAGCACTTTCTGCGATGATGG + Intergenic
1140298127 16:73728460-73728482 AATAGAACTTTTTACAATGATGG - Intergenic
1140322723 16:73969371-73969393 AGTAGAACTTTCTGCTGTGATGG - Intergenic
1140426220 16:74863927-74863949 AATAGAACTTTCAGGAATAGCGG - Intergenic
1140445323 16:75022732-75022754 AACAGCACTTTCTGCAATGATGG - Intronic
1140724922 16:77803327-77803349 AATAGAACTTTCTGGAATGATGG - Intronic
1140735113 16:77891440-77891462 AACAGAACTTTCTGCAACGATGG - Intronic
1140860277 16:79012127-79012149 AATAGAACTTTCTGCAGTGATGG + Intronic
1140900993 16:79367580-79367602 AATGCAACTCTCTGCAGTGATGG + Intergenic
1141077208 16:81018062-81018084 AACAGAGCTTTCTGCAGTGATGG + Intronic
1141196342 16:81864447-81864469 GACAGAACTTTCAACAATGATGG - Intronic
1141757045 16:85998169-85998191 GATAGAAAATTCTGCAGTGATGG + Intergenic
1141991088 16:87610357-87610379 AATAAAGCTTTCTGCACTGATGG - Intronic
1143154122 17:4825142-4825164 AGTAGAACTCTGTGCAGTGATGG - Intergenic
1143570972 17:7758334-7758356 AAAAGAACTTTTTGCAATGATGG - Intronic
1144062658 17:11597985-11598007 AGTAGAACTTTCTGCGATGATGG - Intergenic
1144153153 17:12470749-12470771 AGTACAACTTTCTGCAGTGATGG + Intergenic
1144376647 17:14649554-14649576 AAGAGAACTTTCTGGAATGATGG - Intergenic
1144442206 17:15293697-15293719 AATAGGGCTTTCTGCAATGATGG - Intergenic
1144442272 17:15294229-15294251 AGTAGTACTTTTAGCAGAGACGG + Intergenic
1144692024 17:17273381-17273403 AATAGAACTATCTGCAGTGGTGG - Intronic
1145236402 17:21211324-21211346 ATCATAACTTTCTGCAGTGATGG + Intronic
1145919166 17:28597525-28597547 AATAGAACTTTCTGGGATGAGGG - Intronic
1146043752 17:29484424-29484446 AGGAAAACTTTCTGCAGTGAAGG + Intronic
1146665164 17:34696400-34696422 AATAGTACTTTTAGAAATGAAGG + Intergenic
1146835454 17:36107164-36107186 AACAGAACTTTCTGCAATGATGG - Intergenic
1146850077 17:36214433-36214455 AACAGAACTTTCTGCAATGATGG - Intronic
1146938602 17:36827782-36827804 AATAGAACGCTCTGCAATGATGG + Intergenic
1147552954 17:41457590-41457612 AGTAGAACTTTCTGCAGTGTTGG + Intergenic
1148136412 17:45294934-45294956 AATAGAACTTTCTGCAATGCTGG - Intronic
1148900536 17:50872699-50872721 AACAGAACTTCCTCCAGTGATGG + Intergenic
1148945240 17:51256774-51256796 AATAGAAGTTTCTGCAATGATGG - Intronic
1149072618 17:52560705-52560727 AATAGAACTTTGAGTGATGATGG - Intergenic
1149479719 17:56993321-56993343 AATAGAACTTTCTACAGTAATGG - Intronic
1149488832 17:57067260-57067282 AATAGCACATTTAGCACTGAAGG - Intergenic
1149676361 17:58466421-58466443 AAAATAACTTTCAGCAATGATGG + Intronic
1149806634 17:59623759-59623781 AGTAGAACTTTCTTCAATGATGG + Intronic
1149811077 17:59672791-59672813 GGTAGAACTTTCCCCAGTGATGG - Intronic
1150102298 17:62434140-62434162 AATAGAACTTTGTGCAGTGACGG + Intronic
1151174582 17:72276613-72276635 ACAAGAACTTTCCGGAGTGATGG + Intergenic
1151187923 17:72377727-72377749 AATAGAACTTTCCTTGGTGATGG - Intergenic
1151458888 17:74243098-74243120 ACTAGAACTTTCCCCAGTGGAGG - Intronic
1152013261 17:77734055-77734077 AACAGAACATTCTGCAATGATGG + Intergenic
1152187745 17:78868811-78868833 CAAAGAGCTTTCTGCAGTGATGG - Intronic
1153497469 18:5714387-5714409 AAGAGAACTTTCTGGAGTGATGG - Intergenic
1153518424 18:5927548-5927570 AATAAAACTTTCTGCTGTGATGG + Intergenic
1153520001 18:5942696-5942718 AACAGAACTTTCTGTGGTGATGG + Intergenic
1153545352 18:6199460-6199482 AGCAGAACTTCCTGCAGTGACGG - Intronic
1153608904 18:6861999-6862021 AATAAAAGTTTCAGCAGTATTGG + Intronic
1153737367 18:8085075-8085097 AATAGAACTTTCTGAAATGATGG - Intronic
1153759905 18:8320433-8320455 AGTAGAACTTTCTGCAGTGGTGG + Intronic
1153862416 18:9226447-9226469 CAAGGAACTTTCAGGAGTGATGG - Intronic
1153977858 18:10285161-10285183 AATTAAACTTTCAACAGTAATGG - Intergenic
1154955348 18:21248884-21248906 AACAGAACTTTCTCCAGTGATGG - Intronic
1155194963 18:23465537-23465559 AATAGAACTTTCTGTGGTAATGG + Intronic
1155204363 18:23545080-23545102 AATACTTCGTTCAGCAGTGAAGG + Exonic
1155503158 18:26506745-26506767 CATAGAACTTTCTGCAGTACAGG + Intronic
1155931555 18:31714248-31714270 GATAGAACTTTGTGCAATGATGG - Intergenic
1156129870 18:33958653-33958675 AATAAAACTTTCTGCAGTGAAGG - Intronic
1156407423 18:36796274-36796296 AACAGAACTTTCTGTGGTGATGG + Intronic
1156784005 18:40887582-40887604 AAAAGATCTTTCAGAAATGAAGG - Intergenic
1156844735 18:41651999-41652021 AATGGAACATTCTGCAATGATGG - Intergenic
1158033649 18:52998209-52998231 AATAGAACTTTCCACAGTGATGG - Intronic
1158285458 18:55876017-55876039 AAAAGAACTTTCTGTAATGATGG + Intergenic
1159202589 18:65206585-65206607 AAAAGAGCTTTCAGCAAAGAGGG - Intergenic
1159644013 18:70896281-70896303 AGTAGAACTTTCTACAGTGATGG - Intergenic
1161199778 19:3008206-3008228 CACAGAGCTTTCTGCAGTGATGG - Intronic
1161621584 19:5300366-5300388 CACAGAACTTTCTGCAGTGATGG - Intronic
1162336932 19:10067614-10067636 CATAGAACTTTCTGCAGTGACGG - Intergenic
1164549373 19:29195821-29195843 AATAGAACTGTCTGTAATGAAGG - Intergenic
1165252165 19:34548150-34548172 AAGAGAACTTTCTGCAGTGGTGG - Intergenic
1165268332 19:34680336-34680358 AAGAGAACTTTCTGCAGTGGTGG + Intronic
1165274532 19:34736561-34736583 AAGAGAACTTTCTGCAGTGGTGG + Intronic
1165536459 19:36451160-36451182 AAGAGAACATTCAGTGGTGATGG - Intronic
1167222164 19:48206855-48206877 AACAGAACTTTCTGCAGTGATGG - Intronic
1167242035 19:48349827-48349849 ACTAGAACTCCCTGCAGTGAGGG + Intronic
1168527908 19:57103483-57103505 TTTAGAACTTTCCGCAGTGCAGG - Intergenic
925332966 2:3073015-3073037 ATTAGAGCGTTCAGCAGAGATGG + Intergenic
925481400 2:4278316-4278338 AGTAGAACTTTCTGGGGTGAGGG + Intergenic
925866703 2:8234505-8234527 CATAGAACTTACAGCACTGGGGG - Intergenic
926376185 2:12230207-12230229 AATAGAACTTTCCACAATGGTGG + Intergenic
926651357 2:15349921-15349943 AATAGAACTTTCTTCAGTGAAGG - Intronic
928344844 2:30482265-30482287 AATAGAATTTTAATCAGTGTAGG + Intronic
929061535 2:37930069-37930091 AAAAGAACTTTCCGCAGTGATGG + Intronic
929073624 2:38059084-38059106 AATAGAACTTTCCGCTATGATGG + Intronic
929163484 2:38857060-38857082 AATAGAACTTTCCGTGTTGATGG + Intronic
929213454 2:39384590-39384612 AAAAGAACTTTCTGCATTGATGG + Intronic
929349445 2:40931232-40931254 AATAGACTTTTCAGCATTGTTGG + Intergenic
929502180 2:42499805-42499827 AAAGAAACTTTCAGAAGTGATGG + Intronic
929716645 2:44317551-44317573 AATAGAACTTTCTGTAATGCTGG - Intronic
930321762 2:49863666-49863688 AAAACAACTTTCTGCAATGATGG - Intergenic
930365161 2:50430378-50430400 AATAGAACTTTCTGTGATGATGG + Intronic
930525528 2:52524843-52524865 AAGACAACTCTCAGCAGAGAGGG - Intergenic
930793740 2:55365088-55365110 TATAGAACTTTCTGCATTGATGG - Intronic
931287903 2:60848048-60848070 AATGGAACTTTCAGAAGGAAAGG - Intergenic
931439664 2:62279482-62279504 AAAAGAACTTTTTACAGTGATGG + Intergenic
931465617 2:62484210-62484232 ATTAGAACTTTCTGCAATGGTGG + Intergenic
931729411 2:65139849-65139871 AATGGAACTTTCTGCAGTGATGG - Intergenic
931829191 2:66033303-66033325 AATAGAACTTCCTGCAGTGATGG - Intergenic
932106553 2:68948429-68948451 AACAGAACTTTCTGCAGCGGTGG - Intronic
932121817 2:69108023-69108045 AATAGAACTTTCTGTAATGATGG + Intronic
932149689 2:69358817-69358839 AATTGAACTTTCTCCAGTGTTGG - Intronic
932259166 2:70312528-70312550 AATAGAACTTTCTGCAATTATGG - Intergenic
932760742 2:74437582-74437604 AATAAAACCTTCTGCGGTGATGG + Intronic
933372705 2:81437032-81437054 CATAGAACTTTCAAAAATGATGG - Intergenic
933495383 2:83044253-83044275 AATAGAACTTTCTATAGTCATGG - Intergenic
934956185 2:98622263-98622285 AACAGAGCTTTCTGCAGTGATGG + Exonic
935039838 2:99415524-99415546 AACTGAACTTTCTGCAGTGATGG + Intronic
935352891 2:102169497-102169519 AATAGAACTTTCAGTGATGTTGG - Intronic
935504112 2:103878449-103878471 AATTGAAGTCTCAACAGTGATGG + Intergenic
935554624 2:104495403-104495425 AATAGAACTTTGTGTAATGATGG + Intergenic
935898518 2:107764467-107764489 AAGAGAACTTTCTGCAGTTATGG - Intergenic
936063758 2:109315072-109315094 AGTGGAACTTTCTGCACTGATGG - Intronic
936619235 2:114077621-114077643 AGCTGAACTTACAGCAGTGAAGG - Intergenic
937161234 2:119763613-119763635 AATTAAACTTTCTGCAATGATGG + Intronic
937334053 2:121049969-121049991 GATGGAACTTTCTGCAATGATGG - Intergenic
938048525 2:128145416-128145438 AACAGAACTTTCTGCAATGATGG - Intronic
938606889 2:132903348-132903370 AATAGAACTTTCTGCAGTGTTGG - Intronic
938872685 2:135497595-135497617 AATGGAACTTTCCGCTGTGATGG - Intronic
939362351 2:141189198-141189220 AACAGCACTTTCTACAGTGATGG + Intronic
940084485 2:149843127-149843149 ATTAGATCTTTCAGAAGTTAAGG + Intergenic
940249648 2:151660821-151660843 AATAGAACTTTCTGTAATGATGG + Intronic
940351261 2:152691574-152691596 AATAGAACTTTCTGCAGTGATGG - Intronic
940368354 2:152873906-152873928 AAAAAAACTTTCTGCAATGATGG - Intergenic
940589210 2:155699320-155699342 GAGAGAACTTTGAGCAGTAAAGG - Intergenic
940660584 2:156540226-156540248 AATAGAGATGTCAGCAGTGGTGG - Intronic
940910248 2:159203961-159203983 AATAGAACTTTCCGTAATAATGG + Intronic
940941033 2:159561016-159561038 AACAGAACTTTCTACAATGATGG + Intronic
941103779 2:161328499-161328521 AGTACAACTTTCTACAGTGATGG + Intronic
941376179 2:164733790-164733812 AATGGAATTTTCTGCACTGATGG + Intronic
941937234 2:170993548-170993570 ACTATAATTTTGAGCAGTGAAGG - Exonic
942498485 2:176563757-176563779 AAATGAACTTTCAGCTGAGAAGG - Intergenic
942690805 2:178582977-178582999 ACTTGAATTTTCAGCAGTAATGG + Exonic
942858536 2:180582004-180582026 AATAGAACTTTCTGCAAAAAAGG - Intergenic
943355217 2:186847394-186847416 CATATAATTATCAGCAGTGATGG + Intronic
943601638 2:189927906-189927928 AATACAACTTTCTGCAATGATGG - Intronic
944071826 2:195678982-195679004 AATAGAACTTTCTATAATGATGG + Intronic
944076774 2:195741790-195741812 AGTAGAACATTTTGCAGTGATGG + Intronic
944448854 2:199820571-199820593 AATAGAACTTTCTGTGGCGATGG - Intronic
944545990 2:200799487-200799509 TATATAACTTTCTGGAGTGATGG - Intergenic
944779302 2:203001736-203001758 GATAGAACTTTCTGCAGTGAAGG - Intronic
944888126 2:204086011-204086033 GATAGAACTTTCTGCAATGATGG - Intergenic
944907165 2:204273808-204273830 AAGATAACTTTCTGCAATGATGG + Intergenic
944920075 2:204403605-204403627 AATAGAACTTTCTGCAATGATGG + Intergenic
945008605 2:205437452-205437474 AATAGAACGCTCTGCAATGATGG + Intronic
945109037 2:206345166-206345188 GATAGAAATATCAGCAGTGAAGG + Intergenic
945194560 2:207226129-207226151 CATAGAACTTTCTGGAATGATGG + Intergenic
945911340 2:215653066-215653088 AGTAGAACTTTCTGCATTGATGG + Intergenic
945960064 2:216124128-216124150 AGTACAACTTTCTGCAATGATGG - Intronic
946243306 2:218370199-218370221 AATAGAACTTTCTGCAGTGATGG + Intergenic
946342249 2:219077841-219077863 AATCGAACTTTCTGCAATGATGG + Intronic
946411889 2:219519554-219519576 AATAGAACATTCTGTGGTGATGG + Intronic
947088278 2:226479836-226479858 AATAGAACCTTCCACAGTAATGG + Intergenic
947855319 2:233320036-233320058 AGTAGAATTTTCAGAAGTGGGGG + Intronic
947895147 2:233664184-233664206 GATAGAAAAATCAGCAGTGAGGG - Intronic
948227511 2:236322934-236322956 AGTAGAACTTTCTGCAATGATGG - Intergenic
948325118 2:237111511-237111533 AATAGAATTTTCAGTAATGATGG - Intergenic
948365336 2:237450951-237450973 TCTAGAACATTCTGCAGTGAAGG - Intergenic
948372717 2:237500323-237500345 GATGGAACTTTCTACAGTGATGG + Intronic
1169267888 20:4177910-4177932 AATAGAACTTTCCACAGTGATGG + Intronic
1169359111 20:4933035-4933057 AATAGAACTTTCTGCAATGAGGG + Intronic
1169387264 20:5161404-5161426 TATAGAACTTTCTGCAATAATGG - Intronic
1169526262 20:6429260-6429282 AAAAAAACTTTCTGCAATGATGG + Intergenic
1169566981 20:6865405-6865427 AACAGAACTTTCTTCGGTGATGG + Intergenic
1169682331 20:8229621-8229643 AATAAAACTTTCTGCGATGATGG - Intronic
1169702327 20:8460932-8460954 AATAGAACTTTCTGTGATGATGG + Intronic
1169733065 20:8807697-8807719 AATAGAATTTTCTGCAGTGATGG + Intronic
1169736714 20:8845573-8845595 AATAGAACTTTCTGTAATGATGG - Intronic
1169823368 20:9738984-9739006 AGAAGAACTTTCAGCATTAATGG - Intronic
1169824048 20:9746560-9746582 AATAGAATTTTCTGCAATGCTGG + Intronic
1169824238 20:9748726-9748748 AATAGAATTTTCTGCAATGCTGG + Intronic
1169927420 20:10797232-10797254 AAAAGAACTTTCCAGAGTGATGG - Intergenic
1170036885 20:11998904-11998926 AATAAATCTTTCTGCAGTGATGG - Intergenic
1170084640 20:12515130-12515152 TATTGAACTTGAAGCAGTGAAGG - Intergenic
1170296606 20:14832982-14833004 AATAGAACTTTCTGTAATGATGG + Intronic
1170596425 20:17809348-17809370 GATAGAACCTTCTGCACTGATGG - Intergenic
1170996144 20:21361181-21361203 AGTAGCACTTTCAGCACTGCTGG - Intronic
1171404188 20:24898809-24898831 AAAACAGCTTTCAGCAGAGAGGG + Intergenic
1171416993 20:24988859-24988881 AATAGAACTTTCTGCAACGATGG + Intronic
1171949026 20:31404556-31404578 AATAGAACATTCTGCCATGATGG - Intergenic
1172071982 20:32264445-32264467 AATAAAACTTTCTGTAGTGATGG - Intergenic
1172184458 20:33022603-33022625 AATGGAACTTTCTGCAAGGATGG + Intronic
1172464018 20:35142017-35142039 AATCCAATTTTCTGCAGTGATGG - Intronic
1172607502 20:36224108-36224130 AGCAGAACTTTCTGCAGTGATGG + Intronic
1172641718 20:36444206-36444228 AGTAGAACTTTCTGTAATGATGG + Intronic
1172680351 20:36709280-36709302 AGTAGAACTTGCTGCAGTCATGG - Intronic
1172713221 20:36943267-36943289 AGTAGAACTTTCTGCGATGATGG + Intronic
1172757439 20:37296215-37296237 AATAAAGCTTTCTGCAGTGATGG - Intronic
1172920439 20:38477091-38477113 AATAGAATTTTCTGCAATCATGG + Intronic
1172965956 20:38835473-38835495 AATAGAGCTTTCTGCAGTGATGG + Intronic
1172973783 20:38891867-38891889 AATAGAACTTTCTACAATGATGG + Intronic
1173064092 20:39692935-39692957 AATAGAACATTCTGCAATGATGG - Intergenic
1173550796 20:43931946-43931968 AACAGAACTTTCTGCAGGGATGG - Intronic
1173677479 20:44849473-44849495 AATGGAACTTTCTGCAGTGATGG - Intergenic
1174580437 20:51567694-51567716 AAGAGAACTTTCCACGGTGATGG - Intergenic
1174603191 20:51741165-51741187 AGTAGAACTCTCAGCCATGATGG - Intronic
1174623784 20:51897506-51897528 AATAGAACTTTCTGCAATGATGG + Intergenic
1174756544 20:53164508-53164530 AATAGAACTTTCTGTGATGATGG + Intronic
1175060532 20:56238194-56238216 AGTATAACTTTCTGCACTGATGG + Intergenic
1175194285 20:57231678-57231700 GATTCAACTTTCAGCAGAGAGGG + Intronic
1175202073 20:57284964-57284986 CACAGAACTTTGAGCAGAGAGGG + Intergenic
1175500244 20:59445021-59445043 CGTGGAACTTTCCGCAGTGATGG - Intergenic
1177084685 21:16688788-16688810 AATAGAACTTTCTGTGATGATGG + Intergenic
1178040523 21:28635791-28635813 AATAGAACTTTCTACAATAATGG + Intergenic
1178081487 21:29071300-29071322 AATAGAACTTTTTGCAGTGCTGG - Intronic
1179001780 21:37467972-37467994 AACAGAATTTTCCGCAATGATGG - Intronic
1179067061 21:38034947-38034969 AATAGAACTTTCTGAAATTATGG - Intronic
1180569323 22:16700886-16700908 GATAGAACTTTCTGCAGTGGGGG - Intergenic
1181744993 22:24950146-24950168 AATAGAACTTTCTGCAACGATGG - Intergenic
1181858268 22:25798308-25798330 ACAAGAACTTTCTGCAATGATGG + Intronic
1182013383 22:27019128-27019150 AATAGAACTTTCTGTGATGACGG - Intergenic
1182074320 22:27484534-27484556 AAAAAAACTTTCTGCAGTCATGG + Intergenic
1182118063 22:27768929-27768951 CATAGAACTTTCTGGAATGATGG - Intronic
1183993259 22:41613210-41613232 AATAGAACTTTCTGCAGTGATGG - Intronic
1184336982 22:43859727-43859749 AGCAGAACTTTCAGCTGTGATGG + Intronic
949230755 3:1747235-1747257 AAAAGAACTTTCCTCAATGATGG + Intergenic
949358452 3:3206358-3206380 AATAGAACTTTCTGTGGTGATGG - Intergenic
949735091 3:7162636-7162658 AATAGAACTGTCAGGTGTGAGGG + Intronic
949831332 3:8217643-8217665 AATAGGACTTTCAAAACTGAAGG - Intergenic
949938377 3:9135174-9135196 AATGGAAGTTTCTGCAATGATGG - Intronic
950011025 3:9723923-9723945 AATAGCACTTTCTGCAATGATGG + Intronic
950023867 3:9807649-9807671 AATGGAACTTTCTGCAATGATGG - Intronic
950621793 3:14211915-14211937 AATATAACTTTCAACAGGAAGGG + Intergenic
950767926 3:15287479-15287501 AACAGAACTTTCTGCAATAATGG + Intronic
950823952 3:15795284-15795306 AATATAGCTTGCACCAGTGATGG + Exonic
950938586 3:16869305-16869327 AACAGAACTTTCTGCAGTGTTGG - Intronic
951036148 3:17934354-17934376 AGTAGAATTTTCTGCAGTGATGG + Intronic
951354176 3:21643849-21643871 AATAGAACTTTCTGCAGTTTTGG - Intronic
951410257 3:22354958-22354980 AGTAGAACTTTCTGCAGTGAGGG - Intronic
951506433 3:23450257-23450279 AGTACAACTTTCTGCACTGATGG + Intronic
951534925 3:23731815-23731837 AATAGAACTTTCTGCAATGGTGG + Intergenic
951636258 3:24781326-24781348 AATAGAACATTCACGAGTTATGG - Intergenic
951693551 3:25421956-25421978 AATAGAGCTTTCTGCAATGATGG + Intronic
951724776 3:25745133-25745155 AATAGAATTTTCAGCAATAATGG + Intronic
951994283 3:28709872-28709894 AATAAAACTTCCTGCAATGAAGG + Intergenic
951994308 3:28710208-28710230 AATAAAACTTTCTGCAACGAAGG - Intergenic
952280120 3:31914871-31914893 AATGGAACCTTCAGCAGTGATGG - Intronic
952338747 3:32427666-32427688 AATAGAACTTTCTGTGATGATGG - Intronic
952752650 3:36837799-36837821 AACAGAGCTTTCTGCAATGATGG + Intronic
952869371 3:37884921-37884943 AATAGAACTGACAGCAGGAAAGG + Intronic
953143968 3:40255995-40256017 AATAGAACTTTGTGTAATGAGGG + Intronic
953648429 3:44776724-44776746 AATGGAACTTTCTGCAGTGATGG + Intronic
953774397 3:45803223-45803245 AATGGAACTTTCTGCAGTGATGG - Intergenic
953858090 3:46517164-46517186 AGTGGAGCTTTCTGCAGTGACGG - Exonic
954228784 3:49200116-49200138 GCTAGAACTTTCTGCAGTGGAGG + Intronic
955112749 3:55965236-55965258 AATAGAACTTTCTGCAATTATGG + Intronic
955178716 3:56644826-56644848 AATAGAACTTTCTGCAATAATGG + Intronic
955331916 3:58054369-58054391 AATAGAAGTTTCTGCAACGATGG - Intronic
955496819 3:59542214-59542236 GATAGAACTTTCTGGAATGATGG - Intergenic
955533279 3:59897162-59897184 AAAAGAACTTTCTGCAATGATGG + Intronic
955573815 3:60336719-60336741 AACGGAACTTTCTGCAGTGCTGG - Intronic
955717888 3:61849823-61849845 AAAAGGAGTTTCAGCAGTTATGG - Intronic
955765365 3:62338988-62339010 AACAGAATTTTCTGCAGTGGCGG + Intergenic
955777824 3:62452456-62452478 AATAGAACTGTCTAAAGTGATGG - Intronic
956016634 3:64890641-64890663 AACAGAACTTTCTGCAATGACGG - Intergenic
956041007 3:65144858-65144880 AATAGAACTTTCTGCAATCCTGG - Intergenic
956058449 3:65325459-65325481 AATAGAACTTTCTGCAGTGATGG - Intergenic
956105128 3:65809586-65809608 CAAAAAACTTTCAGCTGTGATGG + Intronic
956127121 3:66021269-66021291 AATAGAACTTTCTGTGATGATGG - Intronic
956366844 3:68513318-68513340 AATAGTACTTTCTGTAGGGATGG + Intronic
956460946 3:69471971-69471993 AAGACAACTTTCACCAGTGAGGG - Intronic
956682914 3:71798002-71798024 AATAGAACTTTCTGCAATGGTGG + Intergenic
956771531 3:72530256-72530278 AATAGAACTTTTTGCAATGATGG - Intergenic
956906202 3:73767918-73767940 AATAGGACTTTCTGCAATAATGG + Intergenic
957641950 3:82865403-82865425 AATAGAACTTTCTTCAATAATGG + Intergenic
958170832 3:89938251-89938273 AGTAGAACTTTCTGCAATAATGG + Intergenic
958271400 3:91503910-91503932 AATAGAACTTTCTGTGATGATGG - Intergenic
958428027 3:94002172-94002194 AGTAGAACTTTCTGCAATGATGG + Intronic
958879196 3:99650334-99650356 AATAGAACTTTCTGCAATGATGG + Intronic
959112605 3:102139849-102139871 AAGGGAACTTTCTGCAATGATGG + Intronic
959161642 3:102731866-102731888 AATAGACCTTTATGCAATGATGG + Intergenic
959693531 3:109224712-109224734 AAAACAACTCTCAGCAGAGAGGG + Intergenic
959999179 3:112713098-112713120 AATATTACTTTCTGCACTGAAGG - Intergenic
960675290 3:120188038-120188060 AATATATCTTTCAGAAATGAAGG + Intronic
960926743 3:122801820-122801842 AAGACATCTTTAAGCAGTGAAGG + Intronic
961022483 3:123520551-123520573 AATAGAACTTTCTGCATTGCTGG - Intronic
961161782 3:124732679-124732701 GATAGAACTTTCTGCAATGATGG - Intronic
961919287 3:130409066-130409088 AATAGGAGTTTCTGCAGTGATGG - Intronic
961941658 3:130644284-130644306 AATAGAAGTTTCTGCAGTGATGG + Intronic
961993393 3:131215927-131215949 AGTAGAATTTTCTGCAGTGTTGG + Intronic
962054164 3:131851014-131851036 AATAGATGGTTCTGCAGTGAAGG - Intronic
962124726 3:132604672-132604694 AATAGAAATTTCACCAGTACTGG - Intronic
962250173 3:133831328-133831350 CAAAGAACTTTCTCCAGTGATGG + Intronic
962529607 3:136266709-136266731 AATAGACATTTCAGCAAAGAAGG - Intronic
962572876 3:136728732-136728754 AATGTAACTTTCTGCAGTGATGG - Intronic
962824755 3:139090200-139090222 AATAGAACTTTCTGAGATGATGG + Intronic
962958110 3:140285134-140285156 AGTAGAACTTTCTGCAATGTTGG + Intronic
963020746 3:140870713-140870735 AATAGAACTTTCTGCAATTATGG + Intergenic
963118207 3:141751852-141751874 AATAGAATTTTCTTCACTGAAGG - Intergenic
963149768 3:142033328-142033350 AATAGAACTTTCTTCAGTGATGG - Intronic
963239092 3:142985075-142985097 AACTGAACTTTCTGCAATGATGG - Intronic
964187002 3:153958208-153958230 AATAGAACTTCCTGCAGTTATGG - Intergenic
964617291 3:158680877-158680899 AATAGAACTTGGTGCAGTGATGG + Intronic
965785638 3:172331847-172331869 AATAGAACTTTCTGCAGTGATGG + Intronic
966098591 3:176238463-176238485 AATAGTACTTTCACCAAAGATGG - Intergenic
966674890 3:182574120-182574142 AATATACCTTTCAGAAATGAAGG + Intergenic
967184553 3:186933334-186933356 AAAACAGCTTTCAGCAGAGAGGG - Intronic
967295544 3:187960938-187960960 AATAGATCTTTCTGCAATCACGG - Intergenic
967346643 3:188464450-188464472 CACAGAACTTTCTGCAGTGGTGG - Intronic
967704697 3:192636403-192636425 CAGAGAACTTTCTGCAGCGATGG - Intronic
968211608 3:196853616-196853638 AATAGAACTTTCTGCAATGATGG + Intergenic
968237399 3:197042101-197042123 AATAGTCTTTTCAGCTGTGATGG + Intergenic
969275133 4:6129605-6129627 AAAGGAACTTTCAGCAGGAATGG - Intronic
970014278 4:11495447-11495469 AAAAGAACTTTGTGCAGTGATGG + Intergenic
970020648 4:11563845-11563867 AAAAGAAATTTTTGCAGTGATGG + Intergenic
970175097 4:13331534-13331556 GATAGAACTTTCTGCACTGAGGG - Intergenic
970263825 4:14258986-14259008 AATAGAACTTTCAGTAATCATGG + Intergenic
970679101 4:18486703-18486725 AAGAGAACTTTCTACAGTGATGG + Intergenic
971081200 4:23213583-23213605 AACAGAACTTTCTGCAATGAGGG - Intergenic
971144933 4:23966270-23966292 AATAGAGCTTTCTGCAATCATGG + Intergenic
971470434 4:27019495-27019517 AATAAAACTTCCTGCATTGATGG + Intronic
971641899 4:29145017-29145039 AAGAGAACTTTCTGGAATGATGG - Intergenic
971833025 4:31722850-31722872 GATAGAACTTTCTGTAATGATGG + Intergenic
972439463 4:39072476-39072498 AATGGAACTTTCAGCATTGATGG + Intronic
972732368 4:41807462-41807484 AGTGGAACTTTCTGCAATGACGG + Intergenic
972757287 4:42061176-42061198 AACAGAATTTTCTGCAATGATGG + Intronic
972864991 4:43220945-43220967 GATAGAACTTTCTGCTATGATGG + Intergenic
973148061 4:46854501-46854523 AATAGAACTTTCAGCAGTGATGG - Intronic
973296637 4:48530172-48530194 AACAGATCTTACAGCAGGGAAGG - Intronic
973619005 4:52709300-52709322 CATACAACTTTCTGCAGTGATGG - Intergenic
973790091 4:54370260-54370282 AATAGAACCTTCTGCAATGATGG + Intergenic
974449072 4:62027344-62027366 AATAGAACTTTCTGTGATGATGG + Intronic
975319062 4:72989329-72989351 AATAGAACTTCCAGTGATGACGG + Intergenic
976067191 4:81201354-81201376 AGTAGAACTTTCTTCAGTGATGG - Intronic
976093867 4:81487140-81487162 AGTAGAACTTCCATCATTGAAGG - Intronic
976132100 4:81895705-81895727 CTTAAAACTTTCAGCAGTGATGG + Intronic
976198623 4:82558346-82558368 AAAAGAACTTTCTGCATTGATGG - Intronic
977091197 4:92677907-92677929 AAATGAATTTTCAGTAGTGAAGG - Intronic
977534008 4:98235631-98235653 AGTAGAATTTTCTACAGTGATGG - Intergenic
977768941 4:100834249-100834271 AATATATCTCTGAGCAGTGAGGG + Intronic
978029231 4:103918266-103918288 AATAGAACTATCAATTGTGACGG + Intergenic
978649433 4:110982535-110982557 GATAGAACATTCAGCTGAGATGG + Intergenic
979026003 4:115576517-115576539 AATAGAGCATTCAGAAGTTAAGG + Intergenic
979608108 4:122660687-122660709 TATATAACTTTCTGCAGTGATGG - Intergenic
979670893 4:123359195-123359217 AATAGCAATGTCAGTAGTGATGG + Intergenic
980077819 4:128312347-128312369 AAGAGAACATTCAGGAGTAATGG - Intergenic
980251274 4:130318746-130318768 AATAGAACTTCCTGCAATGATGG - Intergenic
980500915 4:133652258-133652280 AACAGAAATTTCTGCAATGATGG + Intergenic
980526592 4:133996590-133996612 AATAGAACTCTCAAAAATGAAGG - Intergenic
980847506 4:138341813-138341835 AATAGAACATTCTGCAATGAGGG + Intergenic
980925453 4:139132625-139132647 AATAGAATTTTCAGCAATGAAGG - Intronic
981602705 4:146508637-146508659 AGTAGAGCTTTCAGCAGTGATGG - Intronic
981676453 4:147348609-147348631 AATGGAACTTTCAGCAGGACTGG - Intergenic
981789985 4:148525695-148525717 AGTAGAACTTTTGGCATTGATGG + Intergenic
981793009 4:148561651-148561673 AATAGAACTTTCTGTGGTGATGG - Intergenic
981941432 4:150285650-150285672 AACAGAACTTTCTACAATGATGG + Intronic
982179133 4:152733799-152733821 AAAAGAACTTTCTGCAATGATGG - Intronic
982628016 4:157792508-157792530 AATAGAACTTTCTGTAATGATGG + Intergenic
982648831 4:158060214-158060236 AAAATATCTTTCAGCAATGAAGG + Intergenic
982661483 4:158212321-158212343 GCTAAAACTTTCTGCAGTGATGG + Intronic
982815653 4:159880673-159880695 ACTGGAACTTTCTGCAATGATGG + Intergenic
983060738 4:163156580-163156602 AATAGAGCTTTCTACAGTGTTGG - Intronic
983136767 4:164093672-164093694 AGTAGAAGTTTTAGCACTGAAGG + Intronic
983251271 4:165349203-165349225 AATGGAACTTTCTGTAATGATGG - Intergenic
983259719 4:165442706-165442728 AGTAGAACTTTCTGCAGTGGTGG - Intronic
984087301 4:175328587-175328609 ATTAGAACTTTCTGCAGTAATGG - Intergenic
984275850 4:177608083-177608105 AATAGAACTTTCTGCGATGATGG - Intergenic
985032130 4:185800024-185800046 AATAGTATTTTTAGCAGAGACGG - Intronic
985082402 4:186279511-186279533 CATAGATCTTTCTGCAGTGATGG - Intronic
985085283 4:186306907-186306929 AGTAGAACTTTCTGCAGTTATGG + Intergenic
986844719 5:11739148-11739170 AGTAGAACTTTCTGCAGTGATGG - Intronic
986914376 5:12599188-12599210 ATTAGAACTCTGAGCATTGATGG + Intergenic
987154108 5:15070644-15070666 AATAGGATTTTCTGCACTGATGG + Intergenic
987823670 5:22999567-22999589 AATATAACTTCCAGTAGTAAAGG + Intergenic
988271167 5:29019107-29019129 AATAACACTTTCTGCAATGATGG + Intergenic
988280508 5:29140073-29140095 AATATTACTTTCAGCAATGATGG + Intergenic
988534125 5:32050874-32050896 AGTAAAACTTTCAGCAATGATGG + Intronic
988611893 5:32734669-32734691 AATGGAACTTTCTGCAATGATGG + Intronic
989064992 5:37451352-37451374 AATATAACTTTCAGTGGTAATGG + Intronic
989346321 5:40433903-40433925 TCTATAACTTTCAGCAGTAAGGG - Intergenic
989450738 5:41583799-41583821 AACAGAACTTTCTGCGATGATGG - Intergenic
989701587 5:44272326-44272348 AAATGATCTTTCAGTAGTGAAGG + Intergenic
989774100 5:45182041-45182063 AATAAACCTTTCAGGAGTCAGGG + Intergenic
990287794 5:54317339-54317361 AATAAAACTTTCTGTAATGATGG + Intergenic
990309280 5:54522384-54522406 AATAGAACTTTCAGCACTGATGG - Intronic
990318722 5:54609109-54609131 AGTAGAAATTTCTGCAATGATGG + Intergenic
990427469 5:55701166-55701188 AATAGAACTTTCTACAATGATGG - Intronic
990516236 5:56533415-56533437 AGTAGAGCTTTCAGCAATGTTGG - Intronic
990963514 5:61419660-61419682 AATAGAATTTTCTACAATGATGG - Intronic
991098175 5:62761817-62761839 AATAGAACTCTCTGCCATGATGG - Intergenic
991527751 5:67580892-67580914 AATAGGATTTTCTGCAGTAATGG + Intergenic
992243893 5:74797736-74797758 AATAGAACTTTCTGCAGTGATGG - Intronic
992914867 5:81438833-81438855 AATAGAATTTTGTGCAATGATGG + Intronic
992918396 5:81483983-81484005 AATAGAACTTTCTGGGATGATGG - Intronic
992983946 5:82207741-82207763 AATAGAACTTTCTGCAAAGATGG + Intronic
993149368 5:84140898-84140920 AGGAGTTCTTTCAGCAGTGAAGG + Intronic
993345659 5:86778904-86778926 ACTAGAACTTTCTGCAGTGAGGG + Intergenic
993520233 5:88890598-88890620 AGCAGAACTTTATGCAGTGATGG - Intronic
993524481 5:88947413-88947435 AATAGAACTTTCCCCAGCTAAGG - Intergenic
994109756 5:95987940-95987962 TCTAGAACTTTCTGCAATGAAGG - Intergenic
994498497 5:100543495-100543517 AATAGAACTTTCTGCAGTGATGG - Intronic
994670939 5:102760624-102760646 AATAAAACTATCTGCAATGATGG - Intronic
994810837 5:104517780-104517802 GAAAGAACTTTCTGGAGTGATGG + Intergenic
995072600 5:107941909-107941931 AATAGAACTTTCAGCCACGACGG - Intronic
995346491 5:111125854-111125876 AACAGAACTTTCTGCAAAGATGG + Intronic
995519075 5:112983556-112983578 ACGAGACCTTTCAGCACTGAAGG + Intronic
995656942 5:114436798-114436820 AATAGAACTTTCTGCAGTGATGG + Intronic
995996013 5:118300333-118300355 AATAGAGCTTTCTCCAGTGATGG + Intergenic
996091957 5:119360079-119360101 GATAAAAATTTCAGAAGTGAGGG - Intronic
997244404 5:132334443-132334465 AATAGAACTTTCTGCAGTGACGG + Intronic
997467141 5:134095884-134095906 TCCAGAACTTTCTGCAGTGATGG - Intergenic
997726485 5:136124984-136125006 AATAGAGTTTTTAGCACTGAAGG - Intergenic
998787917 5:145732418-145732440 AATAGAACTTTCTACATTGATGG + Intronic
999097686 5:148995028-148995050 CATAGAACATTCATCACTGAAGG + Intronic
999619664 5:153459756-153459778 TAGAGAACTTTTAGAAGTGATGG + Intergenic
999624737 5:153508223-153508245 CATAGAACTTTCTGCAGTGTTGG + Intronic
999927895 5:156399005-156399027 AATAGAACTTTCTGAAATAATGG - Intronic
1000356436 5:160400421-160400443 ATTAGACATTTCAGCAGTGGAGG + Intergenic
1000383420 5:160649532-160649554 AATAGAACTTACTGCAATGATGG + Intronic
1000525687 5:162354792-162354814 AATAGAACTTTCTGCAGTAATGG + Intergenic
1000678492 5:164153407-164153429 AATAGTACTATCATCAGTAAAGG - Intergenic
1001103715 5:168835099-168835121 AATAGAACTTTCTGTGATGAGGG - Intronic
1001126217 5:169021963-169021985 AATAGAACTTTCTGTGATGATGG - Intronic
1001309607 5:170601613-170601635 AATAAATAATTCAGCAGTGAAGG + Intronic
1001744194 5:174078168-174078190 AACAGAACTTTCTGCAATGATGG - Intronic
1002030579 5:176426086-176426108 AATAAAACTTTCAGGACTCATGG - Intergenic
1002987469 6:2204686-2204708 AATAAAATTTTCTGCAATGATGG - Intronic
1003654290 6:7991392-7991414 AGTAGAACTTTCTGCAGTGGGGG - Intronic
1003775952 6:9364571-9364593 GATAGAACTTTTAGAAATGAAGG - Intergenic
1004191966 6:13471787-13471809 AGTAGAACTTTCTGCAATGATGG + Intronic
1004738257 6:18430282-18430304 ATTTGAACTTTCTGCACTGATGG - Intronic
1004826778 6:19430735-19430757 AATGGAACTTTTTGCATTGATGG + Intergenic
1004982174 6:21037534-21037556 AATAGAGCTTTCTGCAGTGATGG + Intronic
1005084985 6:21996480-21996502 AATAGAACTTTCTGCAGTGATGG - Intergenic
1005116255 6:22340899-22340921 AATAGAACTTTCTGCGGTGATGG - Intergenic
1005995505 6:30928708-30928730 AATAGAACTTTCTGTGATGATGG - Intergenic
1006328158 6:33369794-33369816 AATAGAACTTTCTGCAATGATGG - Intergenic
1006483907 6:34322083-34322105 AATAGAACTTTCTGAAGTGAAGG - Intronic
1006596658 6:35198407-35198429 AATAGAACTTTCTGCAGTGATGG - Intergenic
1007283873 6:40733459-40733481 AAAGGAACTTTCTGGAGTGATGG + Intergenic
1008599140 6:53072618-53072640 GATAGAACTCTCAGCAGTTTGGG + Intronic
1008646236 6:53517754-53517776 CACAGAACTTTCTGGAGTGATGG + Intronic
1008745760 6:54667794-54667816 AAAACAGCTTTCAGCAGAGAGGG - Intergenic
1008983734 6:57517398-57517420 AATAGAACTTTCTGTGATGATGG + Intronic
1009171792 6:60410307-60410329 AATAGAACTTTCTGTGATGATGG + Intergenic
1009441347 6:63682795-63682817 AATAGTATATTCAGCTGTGAAGG - Intronic
1009886773 6:69632783-69632805 AATACAACTTTGACCAGTCAAGG + Intergenic
1010081532 6:71869600-71869622 CATAGAACTCTCTGCAATGATGG + Intergenic
1010205196 6:73316134-73316156 AATAGACGTTCCTGCAGTGATGG + Intergenic
1010216291 6:73404928-73404950 AGTAAAACTTCCTGCAGTGATGG + Intronic
1010248797 6:73687062-73687084 AATAGAACTTTCTGTGATGATGG - Intergenic
1010734225 6:79425160-79425182 AATAGAACTTCCCGCAATGATGG - Intergenic
1010742175 6:79520966-79520988 AACAGAACTTTCAGCCAGGATGG + Intronic
1010761379 6:79727155-79727177 AAGAAAACTTTCTGCAATGATGG + Intergenic
1011133920 6:84079409-84079431 AATAAAACTTTCTGGAATGAAGG + Intronic
1011543618 6:88460813-88460835 AAGAGAACTTTCTGGAGTGATGG - Intergenic
1011608480 6:89127676-89127698 AATAGAACTTTCTGTAATAATGG + Intergenic
1013144550 6:107375366-107375388 ATTAGAAATATCAGCAATGAAGG + Intronic
1013439682 6:110150546-110150568 AGTACAACTTTCTGCAGTGAAGG - Intronic
1013637261 6:112040991-112041013 AGCAGAACTTTCAGCAATTATGG - Intergenic
1014388699 6:120833755-120833777 TATATAATTTTCAGCAGTTATGG + Intergenic
1014929599 6:127319489-127319511 AACAGAAGTTTAAGCAGTAATGG + Intronic
1015029213 6:128574111-128574133 GATAGAGCTTTCAATAGTGAGGG + Intergenic
1015075753 6:129154868-129154890 GATAAAACTTTCTGGAGTGATGG - Intronic
1015458442 6:133458467-133458489 AATAAAACTTTCCACAGTGTTGG - Intronic
1015830296 6:137361813-137361835 AATAGAACATTCTGAAATGATGG - Intergenic
1016370626 6:143370345-143370367 AATAGAACTTCCTGCAGTGCTGG + Intergenic
1016427593 6:143950793-143950815 AACAGAACTTTCTGCAATGATGG + Intronic
1016432780 6:144005719-144005741 AATATAAATTTCTGCAATGATGG + Intronic
1016745946 6:147580504-147580526 AATAGGACTTTCTGTAATGATGG + Intronic
1016749854 6:147620494-147620516 CAAAGAATTTACAGCAGTGAAGG + Intronic
1016949838 6:149568432-149568454 AGTAGAACTTTCTGCCTTGATGG + Intronic
1017597639 6:156046425-156046447 AATGAAACTTTCAGTAATGATGG + Intergenic
1018148291 6:160914279-160914301 AAAAGTACTTGAAGCAGTGATGG + Intergenic
1019988007 7:4672245-4672267 AACAGAACTTTCTGCAGTGATGG + Intergenic
1020068316 7:5207274-5207296 GAGAGAACTTTCTGGAGTGATGG - Intronic
1020135431 7:5585551-5585573 AATAGAACATTCTGCAATAATGG - Intergenic
1020475561 7:8590008-8590030 AATAGAGCTTTCTGCCATGAGGG - Intronic
1020639578 7:10738778-10738800 AATAGAACTTTCTGTGATGATGG - Intergenic
1020749104 7:12117052-12117074 CATTGAACTTTCTGCAGTGAGGG - Intergenic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1020965764 7:14865920-14865942 AATATAACTTTCATGAGTTAAGG + Intronic
1021059535 7:16093473-16093495 AAGAGCACTTTAAGCAGAGATGG - Intronic
1021083530 7:16391696-16391718 AATAAAACATTCTGCAGTGATGG - Intronic
1021320313 7:19201874-19201896 AAAAGATCTTTCTGCAGTGGTGG + Intergenic
1021613539 7:22480056-22480078 GACAGAACTTGCTGCAGTGATGG - Intronic
1021642992 7:22758390-22758412 AATAGATATTTCTGCAGTGATGG - Intergenic
1021806004 7:24356123-24356145 ACTAGAACGTTCTGCAATGATGG + Intergenic
1021968109 7:25941904-25941926 AATGGACCTTTCTGCAATGATGG + Intergenic
1022022080 7:26410315-26410337 ATGAAACCTTTCAGCAGTGATGG - Intergenic
1022255046 7:28647714-28647736 AGTAGAACTTTCAGCAATAATGG + Intronic
1022461263 7:30610089-30610111 AACGGAACTTTCTGCAGTGATGG + Intronic
1022636260 7:32138925-32138947 AGTAAAACTTTCTGCAATGATGG + Intronic
1022774430 7:33510782-33510804 AACAGAACTTTCTGCAATAACGG - Intronic
1022838343 7:34137999-34138021 AATAGCACTCTCTTCAGTGATGG + Intronic
1023853645 7:44166149-44166171 AAAACAGCTTTCAGCAGAGAAGG + Intronic
1024986925 7:55202294-55202316 AGCAGAACTTTCCGCAGTGAGGG - Intronic
1025699672 7:63806076-63806098 GAGAGAACTTTCTGGAGTGATGG - Intergenic
1026494478 7:70890576-70890598 AAAACAGCTTTCAGCAGAGAGGG - Intergenic
1027550879 7:79593553-79593575 AACAGAACTTTCTGCAATGATGG - Intergenic
1027723685 7:81775725-81775747 AATATAGCTTTCTGCAATGATGG - Intergenic
1027906791 7:84195466-84195488 AATACAACTTTAACCACTGAAGG + Intronic
1027972840 7:85108048-85108070 AATTGAACTTTGAGCACTGGAGG - Intronic
1028012578 7:85666981-85667003 GAAGGAACTTTCTGCAGTGAGGG + Intergenic
1028264729 7:88709014-88709036 AACAGCACTTCCAGCAGTGAGGG + Intergenic
1028795265 7:94895216-94895238 AATACAACTTCCAACAGAGATGG - Intergenic
1028956051 7:96691860-96691882 AATAGAACTTGCTGTAGTGATGG - Intronic
1028975587 7:96909513-96909535 AGTACCAATTTCAGCAGTGATGG - Intergenic
1029257642 7:99280309-99280331 AGCAGAACTTTCTGCAGTGACGG - Intergenic
1029843645 7:103391284-103391306 AGTAGAACTTTCCGCAATGATGG - Intronic
1029897041 7:103994074-103994096 AATAGGACTTTCTGCAGTAATGG - Intergenic
1030098373 7:105921873-105921895 AACAGAACCTTTTGCAGTGATGG - Intronic
1030692529 7:112550827-112550849 AATAGAACTTTTGGTAATGATGG - Intergenic
1030788529 7:113694018-113694040 AATAGAACTTTGTTCAGTGATGG + Intergenic
1030964652 7:115975970-115975992 AGTAGAAATTTCTGCAATGATGG + Intronic
1031015799 7:116575190-116575212 AACAGAACTTTCTGCAATAAGGG + Intergenic
1031056776 7:117000287-117000309 AATAGAACTTTCTGCAATAATGG + Intronic
1031847156 7:126819910-126819932 AATATAACCTTCAGCAATGATGG + Intronic
1031907296 7:127474810-127474832 AATAGAACTTTCTGCAATGATGG + Intergenic
1032031445 7:128487003-128487025 AATAGAACTTTGTGCAGTGATGG + Intronic
1032177590 7:129644649-129644671 GGTAGAACTTTCTGCAATGATGG - Intronic
1032295280 7:130631969-130631991 AAAATAACTTTCAAAAGTGAAGG - Intronic
1032316716 7:130844899-130844921 AATAGAACCTTCCGGAGTGATGG - Intergenic
1032695472 7:134332310-134332332 GGTAGAACTTTCTGCAATGATGG - Intergenic
1033423597 7:141223789-141223811 AATAGAACTCCCTGTAGTGATGG + Intronic
1033470446 7:141642544-141642566 AACAGAACCTTCTGCACTGACGG - Intronic
1033517471 7:142122479-142122501 AAGATAACTTTCTGAAGTGATGG - Intronic
1033564890 7:142569042-142569064 AAAAAAAATTTCACCAGTGAAGG - Intergenic
1033760961 7:144436200-144436222 AATAGAACTTTCTGTGATGATGG + Intergenic
1033808504 7:144981862-144981884 AACCAAACTTTCTGCAGTGATGG + Intergenic
1034004767 7:147459046-147459068 AACAGAATTTTCAGCAGTGATGG + Intronic
1034367827 7:150567265-150567287 AATAGAACTTTCTGCAGGGATGG - Exonic
1034486444 7:151367447-151367469 AATAGACATTTCAGCAGTAATGG + Intronic
1034833368 7:154329243-154329265 CATAGAGCTTTCAGCAATGGTGG + Intronic
1035030543 7:155854541-155854563 AATATAAAATTCAGCAGTAAAGG + Intergenic
1036198245 8:6742556-6742578 AATGGAACTTTCTGCAATAATGG + Intronic
1036505413 8:9350387-9350409 AATGGAACTTTCTGCAGTGATGG - Intergenic
1036908860 8:12734865-12734887 AATAGAATTTTCTGCATTGATGG - Intronic
1037273058 8:17151124-17151146 AACAGAACTTTCTTCAATGATGG + Intergenic
1037353254 8:17987752-17987774 AGTAGAACTTTCTATAGTGATGG + Intronic
1037851413 8:22332742-22332764 AAAATAACTTTCACTAGTGAAGG + Intronic
1038061046 8:23913144-23913166 ATTAGAACTTACTGCAATGATGG + Intergenic
1038140261 8:24837565-24837587 AGTAGAACTTGAAGCACTGAGGG - Intergenic
1038513078 8:28158862-28158884 AGTGGAACTTTCTGCAGTGTTGG + Intronic
1039134849 8:34309936-34309958 AATAGAAATTTCCACAGTGATGG - Intergenic
1039367067 8:36939930-36939952 AATATAACTTTAAGCTGGGAAGG + Intergenic
1039828187 8:41192505-41192527 AAAAGAACTTTCTGCAATGGTGG + Intergenic
1041215061 8:55592248-55592270 AATAGCACTTTGAGTAGTGAAGG - Intergenic
1041380651 8:57251253-57251275 AATAGAACTTTTTGCATTGATGG - Intergenic
1041449260 8:57989984-57990006 AATAGAACTTTCTGCAATGATGG + Intergenic
1041528823 8:58839170-58839192 AATGGAACTTTCTCCAATGATGG + Intronic
1041978843 8:63831920-63831942 AAAATAGCTTTCAGCAGAGAGGG - Intergenic
1042280939 8:67055362-67055384 AACAGAGCTTTAAGAAGTGAAGG + Intronic
1042610362 8:70592791-70592813 AATAGAACTTTCTGCAATCATGG + Intronic
1043455859 8:80411471-80411493 AATAGAACTTTCTGCAATGATGG + Intergenic
1043503835 8:80883399-80883421 GCTAGAACATTCTGCAGTGATGG + Intergenic
1043505118 8:80894975-80894997 AATAGAACTTTCTGCAGTTATGG + Intergenic
1043515013 8:80988045-80988067 AATAGAACTTTCTGCAGTGCTGG - Intronic
1044096500 8:88072768-88072790 AATAGAAATTTCATGAGAGATGG - Intronic
1044193226 8:89343758-89343780 AATAAAACTTTATGCATTGATGG + Intergenic
1045230437 8:100301211-100301233 AATAGAACTTTCTGTGGTGAAGG - Intronic
1045375355 8:101568069-101568091 AGTAGAGCTTTCTGCAATGATGG + Intronic
1045458575 8:102406957-102406979 AAGAGAACTTTCAGTGATGATGG + Intronic
1045505886 8:102778207-102778229 AATAGAACTTCCAGAAGGGAAGG + Intergenic
1045626108 8:104052790-104052812 GATAGAGCCTTCAGCATTGATGG + Intronic
1045633370 8:104154312-104154334 AATAGAACTTTTGGCAGTGATGG + Intronic
1045714422 8:105025086-105025108 AATAGAACTTTCTGCAGTGATGG - Intronic
1045818514 8:106306745-106306767 AAGAGAACTTTCTGGAGTAATGG + Intronic
1046341068 8:112854901-112854923 AATAGAAATCTCAGTGGTGATGG + Intronic
1046564565 8:115882737-115882759 ATTAGAACTTTCTGCGATGATGG - Intergenic
1046583990 8:116128856-116128878 AACAGAACTTTCTGCAATGATGG + Intergenic
1046679687 8:117154873-117154895 AATAGAACTCTCTGCTGCGAGGG + Intronic
1047564659 8:126030740-126030762 AATAGAACTTTCTTCAGTGATGG + Intergenic
1047696657 8:127410185-127410207 AAAAGGACTTTCTGCACTGATGG + Intergenic
1048260269 8:132939165-132939187 AATGGAACCTTTGGCAGTGATGG + Intronic
1048743751 8:137590698-137590720 TATGGAACTTGCATCAGTGAAGG - Intergenic
1049009021 8:139875122-139875144 AATAGAAGATTGAGGAGTGAAGG + Intronic
1050162564 9:2733579-2733601 AATAGAACTTTCTGTAATGATGG + Intronic
1050375403 9:4967387-4967409 AATAGAAATGTCTGCTGTGATGG - Intergenic
1050430971 9:5561284-5561306 AGTAGAACTTTCTGCAATGATGG - Intronic
1050870409 9:10560876-10560898 AGCAGAACTTTCCACAGTGATGG - Intronic
1051530455 9:18096397-18096419 AATGGAACTTTCTGCAGCAATGG + Intergenic
1051618557 9:19029647-19029669 AACAGAACTTTCCGCAGTGATGG + Intronic
1052418718 9:28212817-28212839 AGTAAAACTTTCTGCAATGATGG - Intronic
1052454522 9:28678261-28678283 AATGAAACTTTCAGCACAGATGG - Intergenic
1052476219 9:28963199-28963221 AACAGAACTTTCTGCAGTGTTGG + Intergenic
1052803775 9:32994150-32994172 AATAGAATTTTCTGCAATGACGG + Intronic
1052838300 9:33268077-33268099 AATAGAACTTTTTGCCATGATGG + Intronic
1053129420 9:35606495-35606517 AATAGAATTTTCTTCAGTGACGG + Intronic
1054781734 9:69172349-69172371 AACAGAACTTTCTGCATTGATGG + Intronic
1054898804 9:70345317-70345339 AATATAAGTTTCAGCTGAGAAGG - Intronic
1055344560 9:75321608-75321630 AATAGAACTTTTTGCAATGATGG - Intergenic
1055355997 9:75437598-75437620 GATAGAACTTTCTACAGTGATGG + Intergenic
1055423982 9:76174005-76174027 CATAGAACATTCTGCAATGATGG + Intronic
1055894509 9:81159708-81159730 AATAGAACTTTGAGAGGTCAAGG - Intergenic
1056266621 9:84903189-84903211 AACAGACCTTTCTGCAGTGATGG - Intronic
1056422480 9:86442724-86442746 AATAGAACTTCTAGAAATGAAGG - Intergenic
1056754705 9:89374408-89374430 AGTAGGACCTCCAGCAGTGAAGG + Intronic
1056887197 9:90454877-90454899 AAGGGAACTTTCAGGAGTGATGG - Intergenic
1057525245 9:95793406-95793428 AGTAGAAATTTCTGCAGTGATGG + Intergenic
1057583709 9:96310699-96310721 AGTAAAACTTTCTGCACTGAGGG - Intergenic
1057935739 9:99237262-99237284 TATAGAACTTGGACCAGTGAAGG + Intergenic
1058142880 9:101376619-101376641 ACTAGAACAGTCAGCAGAGAAGG + Intronic
1058668681 9:107342623-107342645 AATGCAACTTTGAGCAATGATGG + Intergenic
1058886681 9:109326923-109326945 TATAGAACTTCCTGCAATGATGG + Intergenic
1058888043 9:109337830-109337852 AACAGAACTCTCTGCACTGAAGG - Intergenic
1059251072 9:112888638-112888660 AATAGAACTTTCTAGAATGATGG - Intronic
1059304478 9:113342957-113342979 AACAGAACTTTCAACAATTATGG + Intergenic
1059762614 9:117353319-117353341 AATAGAACTTTCTGCAACAATGG + Intronic
1059821211 9:117974204-117974226 AACAGAACTTTCTGCAGCGATGG - Intergenic
1059873386 9:118603182-118603204 ATAAGAACTTTAAGCAGTTATGG + Intergenic
1060062430 9:120472790-120472812 AATAGAACTTTCTCCAGTGATGG + Intronic
1060137837 9:121174502-121174524 AACAGAACTTTCTGCAATGATGG - Intronic
1060332722 9:122688570-122688592 ACTACAACTTTGAGCAGTGAAGG + Intergenic
1060360517 9:122952092-122952114 AATTGAACTTTTAGGTGTGATGG + Intronic
1060432776 9:123564610-123564632 AACAGAACTTTCTGCAGTGATGG + Intronic
1060897530 9:127226938-127226960 CGTGGAACTTTCCGCAGTGATGG + Intronic
1060903537 9:127283250-127283272 AATAGAACTTTCTACAATTATGG + Intronic
1060927360 9:127464273-127464295 ACTGGAACTTTCTGCAATGATGG + Intronic
1061078900 9:128358277-128358299 AACAGAACTTTCTGCAGCGATGG + Intronic
1061333482 9:129912783-129912805 AACAGAACTTTCTACAGTGATGG + Intronic
1061599446 9:131657558-131657580 AACAGAACCTTCTGCAGCGATGG + Intronic
1186513898 X:10151600-10151622 AATAGAATTATCTGCAATGATGG + Intergenic
1186719632 X:12289521-12289543 AACAGAACTTTCAGCGAGGAGGG - Intronic
1186894241 X:13990170-13990192 AATAGAAATTTCTTCAATGATGG - Intergenic
1187060406 X:15781558-15781580 AATAGAACTTTCTGCAATGACGG - Intronic
1187174467 X:16883530-16883552 AATGGAACTTTCTGCAATGATGG + Intergenic
1187218101 X:17296633-17296655 AATAAAACTTTCTGCAATGATGG + Intergenic
1187279797 X:17849350-17849372 AGTAGAACTTTCTGCAATGATGG - Intronic
1187458791 X:19466850-19466872 AAAAGAATTTTCATCAGTTATGG - Intronic
1187983396 X:24783936-24783958 AATAGTACTTCCTGCAATGATGG - Intronic
1188339708 X:28984088-28984110 AATAGAATTTTCTGCAGTAATGG + Intronic
1188439715 X:30203658-30203680 AATAGAATTTTCTGCACTAATGG + Intergenic
1189100552 X:38184847-38184869 AATGCAACTTTCTGCAATGATGG + Intronic
1189123099 X:38415996-38416018 AATAGAGCTCTCGGCAGTGATGG - Intronic
1189222873 X:39387902-39387924 AATAGAACTTTCTGAGATGATGG - Intergenic
1189285041 X:39846019-39846041 AATAGAACTTTCTGCAAAGTAGG + Intergenic
1189453229 X:41159147-41159169 AATAGAAATTTCTGCAAAGAAGG + Intronic
1189635412 X:43003051-43003073 CATAGAACTGAAAGCAGTGAGGG - Intergenic
1189649033 X:43169042-43169064 AATAGAACTTTCAAAAGAGTTGG - Intergenic
1189965109 X:46364729-46364751 AATAGAACTTTCTGCAATTATGG - Intergenic
1190038870 X:47052653-47052675 AAAAAAACTTTCCACAGTGATGG + Intronic
1190429223 X:50362651-50362673 AAAATAACTTTCAGGAATGAAGG + Intergenic
1190764913 X:53467962-53467984 AATAAAACATTCAGCAATTATGG - Intergenic
1191730698 X:64332009-64332031 AATAGAACTTTCTGCAATGATGG + Intronic
1192456731 X:71282545-71282567 AATAGAACTGTGTGCAATGATGG - Intergenic
1193150498 X:78119318-78119340 AATAGAAATTTCAGAATTGAGGG + Intronic
1193290966 X:79771664-79771686 AATCAAACTTTCAAAAGTGAAGG - Intergenic
1193402242 X:81059143-81059165 AATAGAACTTTCATGCTTGAAGG - Intergenic
1193488348 X:82115643-82115665 AAGAGAACTTGCAGCCTTGAAGG - Intergenic
1193521409 X:82534228-82534250 TATACAGCCTTCAGCAGTGAGGG + Intergenic
1193716228 X:84937443-84937465 AATAAAACTTTCTGCAATGGCGG + Intergenic
1193861766 X:86676505-86676527 AATAGAACTTTCTGCGATGATGG + Intronic
1194618321 X:96135636-96135658 AACAGCACTTTCAGAAGTGGGGG - Intergenic
1195734060 X:107995274-107995296 AATAGAACTTTCTGTGGTGATGG - Intergenic
1195843482 X:109200842-109200864 AATAGTATTTTCTGCAATGATGG + Intergenic
1195997195 X:110743165-110743187 AATAGAACTTTTTGCAATGATGG - Intronic
1196669317 X:118348600-118348622 AAAAGAACTGGCAGCACTGAGGG + Intronic
1196974538 X:121143993-121144015 AGTAGAAGTTTCAGGAATGAGGG + Intergenic
1197777768 X:130130690-130130712 AATAGAACTTTCTGCTGCGATGG - Intronic
1198326546 X:135579323-135579345 TATAGAACTTTCAGCACTAATGG + Intronic
1198341716 X:135720474-135720496 TGTAGAACTTTCAGCAGTAATGG + Intronic
1198346280 X:135762887-135762909 TATAGAACTTTTAGCAGTAATGG - Intronic
1198348186 X:135780172-135780194 TATAGAACTTTTAGCAGTAATGG - Intergenic
1198350090 X:135797435-135797457 TATAGAACTTTCAGCAGTAATGG - Intronic
1198352000 X:135814708-135814730 TATAGAACTTTCAGCAGTAATGG - Intronic
1198353906 X:135831976-135831998 TATAGAACTTTTAGCAGTAATGG - Intronic
1198355816 X:135849226-135849248 TATAGAACTTTCAGCAGTAATGG - Intronic
1198357727 X:135866505-135866527 TATAGAACTTTCAGCAGTAATGG - Intergenic
1198359643 X:135883787-135883809 TATAGAACTTTTAGCAGTAATGG - Intronic
1198366497 X:135945565-135945587 TATAGAACTTTCAGCAGTAATGG - Intergenic
1198366995 X:135951159-135951181 TATAGAACTTTCAGCACTAGTGG - Intergenic
1198374280 X:136022418-136022440 AACAGAACTTTCTGCAATGATGG - Intronic
1198697682 X:139360347-139360369 AATAGAGCTTTCTGTAGTGATGG + Intergenic
1198810516 X:140531424-140531446 AACAGAACTTTCTGCAATGATGG - Intergenic
1199761403 X:150907034-150907056 ACTAGATCTTTCAGCAGTGGTGG + Intergenic
1202169001 Y:22021060-22021082 GATAGCACTATCAGCAGAGATGG + Intergenic
1202222360 Y:22565308-22565330 GATAGCACTATCAGCAGAGATGG - Intergenic
1202320755 Y:23630353-23630375 GATAGCACTATCAGCAGAGATGG + Intergenic
1202550012 Y:26039703-26039725 GATAGCACTATCAGCAGAGATGG - Intergenic