ID: 973148388

View in Genome Browser
Species Human (GRCh38)
Location 4:46858383-46858405
Sequence ATAAGCGATGTGGCCAAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973148388_973148390 -6 Left 973148388 4:46858383-46858405 CCACGCTTGGCCACATCGCTTAT 0: 1
1: 0
2: 1
3: 7
4: 145
Right 973148390 4:46858400-46858422 GCTTATATTTTAAGACATATTGG 0: 1
1: 0
2: 4
3: 24
4: 310
973148388_973148391 19 Left 973148388 4:46858383-46858405 CCACGCTTGGCCACATCGCTTAT 0: 1
1: 0
2: 1
3: 7
4: 145
Right 973148391 4:46858425-46858447 CACTAATGCAAGTAGCATGTTGG 0: 1
1: 0
2: 0
3: 4
4: 93
973148388_973148392 26 Left 973148388 4:46858383-46858405 CCACGCTTGGCCACATCGCTTAT 0: 1
1: 0
2: 1
3: 7
4: 145
Right 973148392 4:46858432-46858454 GCAAGTAGCATGTTGGTTTCAGG 0: 1
1: 0
2: 2
3: 25
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973148388 Original CRISPR ATAAGCGATGTGGCCAAGCG TGG (reversed) Intronic
901291357 1:8126725-8126747 AGAAGAGAGGTGGCCCAGCGTGG - Intergenic
902055966 1:13600653-13600675 TTAAGTGATGTGGCCCAACGCGG - Intronic
903348641 1:22704255-22704277 ATAATCCATGTGGACAAGCACGG - Intergenic
903719151 1:25391475-25391497 ATAAGCGTTTGGGCCAGGCGTGG - Intronic
908154185 1:61335550-61335572 ATAAGCTAACTGGCCAGGCGCGG + Intronic
909133210 1:71765883-71765905 ATAAGAGACCTGGCCAGGCGCGG + Intronic
915695397 1:157736191-157736213 ATAACAGATGTGGCCAGGCACGG - Intergenic
922939204 1:229446834-229446856 ATAAGGGATGTGGCCGGGCATGG + Intronic
923478004 1:234355438-234355460 ATAAACTTTGTGGCCAGGCGTGG + Intergenic
1063287409 10:4705602-4705624 ATAAGTAATGTGGCCAGGCATGG - Intergenic
1063626962 10:7699287-7699309 TTAAGTCATGTGGCCAAGAGAGG - Intergenic
1064501116 10:15974419-15974441 ATAAACGATGTGGACACCCGTGG - Intergenic
1069474102 10:68718044-68718066 AAAAGCCCTTTGGCCAAGCGCGG + Intergenic
1070178684 10:73994653-73994675 ATGAGTGTTGTGGCCAGGCGCGG - Intergenic
1070711546 10:78686745-78686767 TTAAACGATGTGGTCAAGCACGG + Intergenic
1076198504 10:128539307-128539329 AGAAGCGATTTGGCCGAGCCTGG - Intergenic
1080580643 11:33640479-33640501 ACAATCTATGTGGCAAAGCGTGG + Intronic
1082188492 11:49212701-49212723 ATAAGCATTTTGGCCAGGCGCGG - Intergenic
1082622980 11:55446721-55446743 ATAAGCAATGTGGAAAAGTGTGG - Intergenic
1084105919 11:66980345-66980367 ATTAGCCAGGTGGCCAGGCGTGG - Intergenic
1085071694 11:73552664-73552686 ATAATGGATGAGGCCAGGCGTGG + Intronic
1086678027 11:89634001-89634023 ATAAGCATTTTGGCCAGGCGCGG + Intergenic
1087242973 11:95800678-95800700 ATAAGAGACTTGGCCAGGCGCGG - Intronic
1089894069 11:121909753-121909775 ATAACAGATGGGGCCAAGTGAGG + Intergenic
1090823462 11:130365936-130365958 ACAATAGATGTGGCCAGGCGCGG - Intergenic
1092376266 12:7957983-7958005 ATAACAGATGTGGCGAGGCGCGG - Intergenic
1092662512 12:10754467-10754489 ATATGCTATGTGGCCAGGCATGG - Intergenic
1094563094 12:31574300-31574322 AAAAGGGAGGTGGCCAGGCGCGG + Intronic
1096682393 12:53265067-53265089 ATAAAGCATGAGGCCAAGCGCGG - Intergenic
1098267466 12:68737272-68737294 ATTAGAGTTGAGGCCAAGCGTGG + Intronic
1102457462 12:113079497-113079519 AAAAGAGAAGTGGCCAAGAGGGG - Intronic
1103372086 12:120427234-120427256 ATAAAAGACATGGCCAAGCGCGG - Intergenic
1106626237 13:31423761-31423783 AAAAGCAAGGTGGCCAGGCGAGG - Intergenic
1108333548 13:49415224-49415246 ATAAAAAATGTGGCCAGGCGCGG + Intronic
1110850231 13:80237206-80237228 ATAGGAAATATGGCCAAGCGCGG + Intergenic
1112431824 13:99356835-99356857 ATAAGAGATGGGGCAACGCGAGG - Intronic
1115256198 14:31405141-31405163 ATAAACGATGTGACCAGGTGTGG + Intronic
1116040605 14:39681887-39681909 ATAAGCAACGTGGCCTAGCTGGG + Intergenic
1117700467 14:58408124-58408146 GTAAGATATGTGGCCAGGCGCGG + Intronic
1118832126 14:69443893-69443915 AAAGGAAATGTGGCCAAGCGTGG + Intronic
1126726694 15:51638927-51638949 ACAAGAGATGAGGCCAGGCGCGG - Intergenic
1128031371 15:64483540-64483562 ATAAGAAATGTAGCCAGGCGTGG - Intronic
1129231831 15:74201355-74201377 ATAAGGGATGGGGCCAGGCCTGG + Intronic
1131040163 15:89257194-89257216 AAAAGAAATCTGGCCAAGCGTGG - Intronic
1133115708 16:3576958-3576980 AAAAGAGATGTGGCCAGGCACGG - Intronic
1133412328 16:5579136-5579158 ATTAGGGGTGTGGCCAGGCGTGG - Intergenic
1135397290 16:22140900-22140922 TTAAGAGATGTGGCCAGGCGTGG - Intronic
1140435202 16:74941401-74941423 ATAGAAGATGTGGCCAGGCGTGG + Intronic
1144401410 17:14906493-14906515 TTGAGAGATGTGGCCCAGCGCGG + Intergenic
1150743984 17:67801567-67801589 ATATCAGATGTGGCCAGGCGTGG - Intergenic
1151600038 17:75100446-75100468 ATATGCCATGTGGCACAGCGTGG + Exonic
1154989305 18:21585281-21585303 ATAAGGCATGTGACCAAGCCTGG - Intronic
1155221083 18:23686473-23686495 ATAAGAAATGTGGCCAGGTGTGG - Intergenic
1155509357 18:26561699-26561721 ATAAGGGATGTGCCCAAGGATGG + Intronic
1155683045 18:28513396-28513418 ATAAACCATGTGCCCAAGAGTGG + Intergenic
1160309833 18:77778923-77778945 ATGAGTGATGGGGCCAGGCGCGG + Intergenic
1165251556 19:34540626-34540648 ATAAGAAATGGGGCCAGGCGTGG - Intergenic
1165427385 19:35753618-35753640 ATAAGCCATCTGACCCAGCGGGG + Intronic
1165641354 19:37390317-37390339 GTAACAGATGTGGCCAGGCGCGG - Exonic
1165812386 19:38619345-38619367 GGAAGCGCTCTGGCCAAGCGGGG + Intronic
1166362437 19:42259148-42259170 ATCAGAGATGTGGCCAGGCGAGG + Intergenic
1168388329 19:55985011-55985033 TGAAGAAATGTGGCCAAGCGCGG + Intronic
925736699 2:6970048-6970070 ATAAAAGATTTGGCCAGGCGCGG - Intronic
927120424 2:19955238-19955260 ATATAAGATGTGGCCAGGCGGGG - Intronic
930209115 2:48616557-48616579 AGAAGAGTTGTGGCCAAGTGCGG + Intronic
932326958 2:70869631-70869653 ATGAACTATGGGGCCAAGCGTGG - Intergenic
938920168 2:135987603-135987625 ATAAGCCATGTAGGCAAGGGCGG + Intergenic
939146228 2:138418108-138418130 TTAAGAAATCTGGCCAAGCGCGG - Intergenic
941838375 2:170051633-170051655 AGAAGTGATGTGGCCGGGCGCGG - Intronic
1169242705 20:3998148-3998170 ATAAAAAATGTGGCCAGGCGTGG + Intronic
1170159655 20:13298404-13298426 ATAAGTGATGAGGCCAGGCACGG - Intronic
1174167972 20:48598526-48598548 ATGAGCGAGGTGCCCAAGGGTGG + Intergenic
1175393903 20:58645511-58645533 ATTAGCTATGTGGCCATGCATGG - Intergenic
1181581061 22:23828339-23828361 AGAAGTCATGTGGCCGAGCGCGG - Intronic
1182425581 22:30270134-30270156 AGAAGAGATAAGGCCAAGCGCGG - Intergenic
1182899431 22:33885738-33885760 ATAAAAGATGTGGCCGGGCGTGG + Intronic
949291369 3:2470363-2470385 ATAAGCAACATGGCCAGGCGCGG - Intronic
950026223 3:9821710-9821732 ATTATCAAGGTGGCCAAGCGTGG + Intronic
950913489 3:16618820-16618842 ATATGTGATGTGTCCAAGCTTGG + Intronic
957157877 3:76568594-76568616 AAAAGCAATGTGGCCAGGCGCGG - Intronic
957466733 3:80603422-80603444 AGAAGGGATGTGGGCAAGCCTGG - Intergenic
957847820 3:85761663-85761685 ATAAGTTTTGTGGCCAGGCGTGG - Intronic
958600795 3:96294143-96294165 ATAAGCATTGAGGCCGAGCGTGG - Intergenic
958777929 3:98507693-98507715 TTAAGAGATGAGGCCAGGCGTGG - Intronic
959549262 3:107636176-107636198 ATAAGCTGAGTGGCCAAGCCTGG + Intronic
959732474 3:109619648-109619670 ATAAGCTATATTGCCAAGCAAGG - Intergenic
962210812 3:133476108-133476130 AGAAGCAAGGTGGCCAGGCGCGG + Intergenic
962865332 3:139443809-139443831 ATCAGCCATGTGGTCAATCGTGG + Intergenic
965599917 3:170444433-170444455 ATATTGGATGTGGCCAGGCGTGG + Intronic
965673677 3:171173092-171173114 ACAGGAGATGTGGCCAGGCGCGG + Intronic
967476303 3:189924573-189924595 ACAATAGATGTGGCCAGGCGCGG + Intergenic
968183651 3:196615920-196615942 ATAACCCATGTGGCCAGGTGCGG - Intergenic
969263923 4:6052019-6052041 CTAAGAGATGTAGCCAAGAGAGG + Intronic
972603277 4:40591390-40591412 ATCAGATATGTGACCAAGCGTGG + Intronic
973148388 4:46858383-46858405 ATAAGCGATGTGGCCAAGCGTGG - Intronic
974483176 4:62472020-62472042 ATAAGTTATGTGGCCAACCCCGG + Intergenic
974763686 4:66311922-66311944 ATAAGAGAGCTGGCCAGGCGGGG + Intergenic
977870127 4:102081206-102081228 ATAAGATCTGTGGCCAGGCGCGG - Intergenic
984153938 4:176170603-176170625 ATAATTGATTTGGCCAGGCGTGG - Intronic
985562201 5:593889-593911 AAAAGCAATGTGGCCAGGCCAGG + Intergenic
987087704 5:14485693-14485715 ATAAGAGATGGGGCCAAGCATGG + Intronic
987104457 5:14623639-14623661 ACAAAAGATGAGGCCAAGCGTGG + Intergenic
988951265 5:36263815-36263837 AGAAGTGAAGTGGCCAGGCGTGG - Intronic
991331058 5:65492369-65492391 ATATGCAATTTGGCCAGGCGTGG - Intergenic
992664004 5:78988048-78988070 ATAAGCGTTCTGGCCAGGCGTGG - Intergenic
993091633 5:83433630-83433652 GTAAGCTTTGTGGCCAGGCGTGG + Intergenic
995653457 5:114397676-114397698 ATAATAGATGTGGCCAGGCATGG - Intronic
996840941 5:127846758-127846780 ATAGGCACTATGGCCAAGCGCGG - Intergenic
998912182 5:146971891-146971913 ATATGAGATGTTGCCAAGAGGGG - Intronic
999407107 5:151316448-151316470 AAAAGAGATCTGGCCAGGCGAGG + Exonic
1001162761 5:169335982-169336004 ATGATTGCTGTGGCCAAGCGTGG - Intergenic
1004085349 6:12442316-12442338 ATTAAAGATGTGGCCAGGCGCGG - Intergenic
1004591131 6:17052903-17052925 ATAAAAAATGGGGCCAAGCGCGG - Intergenic
1005673551 6:28131304-28131326 ATTAGAGATGTGGCCAGGTGTGG - Intergenic
1007553915 6:42750452-42750474 AAAAGGGAAGTGGCCAGGCGTGG - Intronic
1012327402 6:97938921-97938943 TTAAGAGATGAGGCCAGGCGCGG - Intergenic
1013585853 6:111578348-111578370 ATAAGGGATCTGGCCCAGCACGG + Intronic
1014112725 6:117637653-117637675 ATAAGGCTTGTGGCCAGGCGCGG - Intergenic
1014715438 6:124859734-124859756 ATAATAGATGGGGCCAAGAGTGG - Intergenic
1015984119 6:138868874-138868896 AAATGCAATGTGGCCAGGCGTGG + Intronic
1021511727 7:21440557-21440579 AGAAGTGGTGTGGCCAGGCGTGG + Intronic
1022294473 7:29037252-29037274 ATAAGAAAAGTGGCCAGGCGTGG + Intronic
1025981979 7:66414152-66414174 AAAAGCGATCGGGCCAGGCGTGG + Intronic
1025990671 7:66494255-66494277 ATAAGCGATCGGGCCGGGCGCGG + Intergenic
1026231828 7:68490535-68490557 AAAAGAGATGTGGCCAGGCACGG + Intergenic
1026856581 7:73759061-73759083 ATGAGAGAGGTGGCCACGCGTGG - Intergenic
1027001987 7:74659831-74659853 AAAAGAGATGAGGCCCAGCGTGG - Intronic
1027052052 7:75026729-75026751 AAAAGGGAGGTGGCCAAGTGGGG + Intergenic
1027389944 7:77694882-77694904 ATAAGGAATGTGGCCGGGCGCGG - Intergenic
1028490028 7:91400853-91400875 ATCAGCCATCTGGCCAGGCGTGG + Intergenic
1030998356 7:116385764-116385786 AAAAGCCATGTGGCCAAGCACGG + Intronic
1032313755 7:130814590-130814612 ATAAGGGATATGGCCAGGCGTGG - Intergenic
1033214759 7:139485083-139485105 AGAAGGGATGAGGCCAGGCGTGG + Intergenic
1036427903 8:8663394-8663416 ATATGCAAGGTGGCCAGGCGTGG + Intergenic
1038396140 8:27246962-27246984 ATGATCTATGTGGCCAGGCGTGG + Intronic
1040569746 8:48597143-48597165 GTAAGCCACCTGGCCAAGCGTGG - Intergenic
1041516572 8:58705937-58705959 ATAGGCAATCTGGCCAGGCGCGG - Intergenic
1041518961 8:58733595-58733617 AAAAGACATGTGGCCAGGCGTGG + Intergenic
1043138174 8:76554202-76554224 AAATGCGATGTGGCCGGGCGCGG + Intergenic
1054095232 9:60894694-60894716 ATAAAAGATATGGCCAGGCGCGG + Intergenic
1054110179 9:61099755-61099777 ATAATGGTTGTGGCCAGGCGTGG + Intergenic
1054610678 9:67231370-67231392 ATAATGGTTGTGGCCAGGCGTGG - Intergenic
1057888080 9:98846220-98846242 ATCAGGGATGTGGCCATGCATGG + Intronic
1058852168 9:109023542-109023564 ATAAGCAATGTGGCCAGGCGCGG + Intronic
1059072643 9:111154828-111154850 ATAAGAGTTGTGGCCAGGCATGG + Intergenic
1059977054 9:119728783-119728805 ATAAAAGATGTGGCCCAGGGCGG - Intergenic
1060145892 9:121252132-121252154 AAAAGAGATGTGGCCAAACCAGG + Intronic
1061049278 9:128184958-128184980 ATTATTGGTGTGGCCAAGCGTGG - Intronic
1189046511 X:37597805-37597827 ATAAGTGCTGTGGCCAGGCTTGG - Intronic
1189470468 X:41310005-41310027 ATAAGAGTTTTGGCCAGGCGAGG + Intergenic
1192483787 X:71507518-71507540 AAAATTGGTGTGGCCAAGCGTGG - Intronic
1192744976 X:73929758-73929780 ATAAGGGATATGGCCAGGCCCGG - Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic
1201305133 Y:12543215-12543237 GTAAGCCATGGAGCCAAGCGAGG + Intergenic