ID: 973148596

View in Genome Browser
Species Human (GRCh38)
Location 4:46860549-46860571
Sequence TTCACCAGATGTCAAAGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973148596_973148601 5 Left 973148596 4:46860549-46860571 CCCCTTCTTTGACATCTGGTGAA 0: 1
1: 0
2: 1
3: 17
4: 264
Right 973148601 4:46860577-46860599 AAATGAAGTCTCTGGTTAGATGG 0: 1
1: 0
2: 2
3: 21
4: 244
973148596_973148600 -3 Left 973148596 4:46860549-46860571 CCCCTTCTTTGACATCTGGTGAA 0: 1
1: 0
2: 1
3: 17
4: 264
Right 973148600 4:46860569-46860591 GAATCAGGAAATGAAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973148596 Original CRISPR TTCACCAGATGTCAAAGAAG GGG (reversed) Intronic
903427661 1:23266440-23266462 TTCAAAAGATGTGAAAGATGGGG - Intergenic
904011153 1:27391407-27391429 TTCTCCAGATGTGACAGATGTGG - Intergenic
904473517 1:30750227-30750249 TTCCCCAGATATCTAGGAAGTGG - Intronic
905343048 1:37292534-37292556 TTCACCTGAAGTCAAATGAGGGG + Intergenic
908551652 1:65214409-65214431 TTCATCAGATATGAAACAAGGGG - Intronic
908704744 1:66940017-66940039 TTCAACAGATGGCTGAGAAGGGG - Exonic
909102244 1:71362990-71363012 TTCATCATTTGTAAAAGAAGCGG - Intergenic
909498162 1:76303009-76303031 TTCACCTCATGTAAATGAAGTGG + Intronic
910989702 1:93042299-93042321 TTCACCACATGTAAATGAAGTGG + Intergenic
912267198 1:108170340-108170362 TTCAACACATTTCAAAGAACTGG - Intronic
912648483 1:111417503-111417525 TTCCCCAAATGTAAAATAAGAGG + Intronic
913094754 1:115505675-115505697 CTTACCAGATGTAACAGAAGCGG + Intergenic
913155745 1:116096284-116096306 GTCACCAGAGGACAAAGAACAGG - Intergenic
915744861 1:158148073-158148095 TTCACCCCATGTAAATGAAGTGG - Intergenic
916105432 1:161426797-161426819 TACACCAAATGTCACAGAAGAGG - Intergenic
916917994 1:169430855-169430877 TTCACCCCATGTAAATGAAGTGG + Intronic
920318630 1:205099067-205099089 TGCACCAGACTTCAAAGAATTGG - Exonic
921911307 1:220552189-220552211 TCCACCAGATGTCATAGTAATGG - Intronic
921923430 1:220692051-220692073 TTCACCAGATAACAGTGAAGTGG + Intronic
923067299 1:230530153-230530175 ATCACCATTTGTCACAGAAGTGG + Intergenic
923450701 1:234114718-234114740 TTCCCCAAATGTCCAAGAAAGGG - Intronic
1063622844 10:7665462-7665484 TTCTCCACATTTCACAGAAGAGG + Intronic
1063819991 10:9823311-9823333 TTCAGCAGATGGCATAGAATTGG - Intergenic
1064358601 10:14642464-14642486 TTCACTAGATGAGAAAGTAGAGG - Intronic
1066705507 10:38173743-38173765 GTCATGAGATGTGAAAGAAGAGG - Intergenic
1066984984 10:42456907-42456929 GTCAAGAGATGTGAAAGAAGAGG + Intergenic
1067389586 10:45850686-45850708 GTCATGAGATGTGAAAGAAGAGG + Intronic
1067444661 10:46333838-46333860 GTCATGAGATGTGAAAGAAGAGG - Intergenic
1067501880 10:46813150-46813172 GTCATGAGATGTGAAAGAAGAGG - Intergenic
1067550142 10:47228619-47228641 TTCACCCCATGTAAATGAAGTGG - Intergenic
1067592702 10:47526858-47526880 GTCATGAGATGTGAAAGAAGAGG + Intronic
1067639819 10:48034941-48034963 GTCATGAGATGTGAAAGAAGAGG + Intergenic
1067854119 10:49777032-49777054 GTCACCAGATGGCAAAAGAGTGG - Intergenic
1067873679 10:49985369-49985391 GTCATGAGATGTGAAAGAAGAGG - Intronic
1068359018 10:55951952-55951974 TAAACCAGATGTCAAAAAATAGG + Intergenic
1068647390 10:59482595-59482617 TTAACCAGATTTCAAAGAATGGG - Intergenic
1068675262 10:59763658-59763680 TTTACCAGATGGCAAGGCAGAGG + Intergenic
1070136794 10:73701050-73701072 GTCATGAGATGTGAAAGAAGAGG + Intergenic
1070891721 10:79946301-79946323 TCCACCAGCTGGCAAACAAGTGG - Intronic
1070993082 10:80750191-80750213 CTCCCCATATGTCAAGGAAGGGG - Intergenic
1071120911 10:82277828-82277850 TTCACCAGAATTCCAGGAAGTGG + Intronic
1071718783 10:88122364-88122386 ATCCCCACGTGTCAAAGAAGAGG - Intergenic
1072634689 10:97170300-97170322 CTCACCACATTTCCAAGAAGTGG - Intronic
1073344271 10:102770523-102770545 TTGACCAGATGGCAAAGGTGTGG + Intronic
1074664008 10:115697022-115697044 ATCCCCACATGTCAAGGAAGAGG - Intronic
1075028410 10:119003963-119003985 CTCACCAAATGTCACAGCAGTGG + Intergenic
1075969239 10:126638611-126638633 TTCCCCAGATGTCAAGGCACAGG - Intronic
1078053599 11:7988190-7988212 CTAACCAGTTGTCAAAGGAGTGG + Intronic
1078499620 11:11858001-11858023 TTCACCTCATGTAAATGAAGTGG - Intronic
1078779540 11:14423900-14423922 TTATCCAGAGGTCAAATAAGTGG + Intergenic
1080371650 11:31653305-31653327 GTCACCAGTTTTCAAAGAATTGG - Intronic
1082182537 11:49137576-49137598 TTCAACAGATGTTAATGAATGGG + Intergenic
1085207228 11:74743066-74743088 TTCAGGAGATTTCACAGAAGAGG - Intergenic
1085208826 11:74755707-74755729 TTCACCAGATGAGGAAGGAGGGG + Intronic
1087233256 11:95690157-95690179 TGTACAAGAGGTCAAAGAAGGGG + Intergenic
1087557250 11:99736439-99736461 TTCATCAGCTGCCCAAGAAGGGG + Intronic
1087742291 11:101901748-101901770 TTGACAAGATGTCAAAAAATTGG - Intronic
1095429738 12:42120484-42120506 AACACCAGACGTGAAAGAAGTGG - Intronic
1096918094 12:55055010-55055032 TTTGCCAGATATCAATGAAGAGG + Intergenic
1098624713 12:72649745-72649767 CTCACCAGATGACATAGAGGTGG + Intronic
1101226317 12:102691436-102691458 TTCCCCAGATGCCAAAGGAAAGG - Intergenic
1101855661 12:108440704-108440726 TTCAAAATATGTCAAAGAAATGG - Intergenic
1105556846 13:21455302-21455324 TTCTCTACATGCCAAAGAAGAGG + Intronic
1106630722 13:31469156-31469178 TTCAACAGAAGTCAAAGAGGAGG - Intergenic
1106696078 13:32174345-32174367 TTTACCAGATGCCAGAGATGTGG - Intronic
1107106662 13:36650431-36650453 TTCAGCACATTTCAAAGCAGAGG + Intergenic
1107724438 13:43284039-43284061 CTCAACAGATGTCAAAAGAGTGG - Intronic
1107780704 13:43899054-43899076 ATCCCCACATGTCAGAGAAGGGG - Intergenic
1110080505 13:71303978-71304000 TTCACCAGAGGAAAAAGAAGTGG - Intergenic
1110763667 13:79257661-79257683 CTCAACAGATCTCAAAGAATTGG - Intergenic
1112105678 13:96236843-96236865 TACACCAGCTGACAGAGAAGTGG - Intronic
1112404221 13:99103771-99103793 TTCAGCAGCTGCCAAAGGAGGGG - Intergenic
1112638613 13:101245925-101245947 TTCACCCCATGTAAATGAAGTGG - Intronic
1112767816 13:102763997-102764019 TTCACCCCATGTAAATGAAGTGG - Intergenic
1113316222 13:109182270-109182292 TTGTCCAGCTGTCAAAGCAGGGG - Intronic
1114251338 14:20964352-20964374 GTCACAACATGGCAAAGAAGTGG + Intergenic
1115041177 14:28930549-28930571 TTCTCAAGATGTCAAAAATGTGG - Intergenic
1115756013 14:36526294-36526316 TTGACCAGAGTCCAAAGAAGGGG - Intergenic
1116059953 14:39910360-39910382 TGCACCAGAGTTCAGAGAAGGGG - Intergenic
1117326211 14:54671355-54671377 TTATCCAGATTTCAAAGATGAGG - Intronic
1117588185 14:57235760-57235782 TTTACCAGTGCTCAAAGAAGAGG - Exonic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1122478149 14:102026352-102026374 TTCACCAAAAGGCAATGAAGAGG - Intronic
1123781333 15:23631930-23631952 TCTACCAAAAGTCAAAGAAGCGG + Intergenic
1124694724 15:31854460-31854482 TTCAGAAGCTGTAAAAGAAGAGG - Intronic
1126242566 15:46461933-46461955 TGCACCCAATGTCATAGAAGAGG + Intergenic
1127552311 15:60052982-60053004 TTGATCAGATGTCAAAGAAATGG + Intronic
1128745958 15:70114225-70114247 TTAGCAAGATGTGAAAGAAGAGG - Intergenic
1130721251 15:86387472-86387494 TGGACCAGATGTTAAGGAAGAGG + Intronic
1131352792 15:91717119-91717141 TTCACCAGCTGTCAATGGTGTGG - Intergenic
1131669188 15:94601060-94601082 TTCACATGATGTCTCAGAAGAGG + Intergenic
1134355912 16:13482163-13482185 ATCAGCAGAAGTCAGAGAAGAGG + Intergenic
1134602706 16:15545977-15545999 TTTGACAGAGGTCAAAGAAGAGG + Intronic
1135300010 16:21318446-21318468 TTCTCAAAATGTCAAAGAACTGG - Intergenic
1139659831 16:68413108-68413130 TTCACCTGGTGTCAAAGAGCAGG - Intronic
1140921261 16:79540771-79540793 TTCCCCACATGTCAGAGAAGAGG - Intergenic
1141660462 16:85438534-85438556 TTCCCCATCTGTAAAAGAAGAGG - Intergenic
1141978794 16:87536455-87536477 TTCACCCCATGTAAATGAAGTGG + Intergenic
1144460301 17:15453232-15453254 TTCCCCAGACGTCACAAAAGAGG + Intronic
1145035639 17:19538691-19538713 TTCCTCACATGTAAAAGAAGGGG + Intronic
1145903222 17:28501262-28501284 GGGACCACATGTCAAAGAAGGGG - Intronic
1146444963 17:32926455-32926477 TTCACCCCATGTAAATGAAGTGG - Intergenic
1147026137 17:37585905-37585927 TTCACTAGATATAAAACAAGAGG + Intronic
1148925220 17:51078260-51078282 TTAAGCAGATGTCCTAGAAGAGG - Intronic
1149331398 17:55586343-55586365 ATCCCCACATGTCAAAGGAGGGG - Intergenic
1150008439 17:61484028-61484050 CTCTCCAGAAGTCAAAGGAGTGG - Exonic
1150883078 17:69053162-69053184 ATCCCCAGATGTCCAGGAAGAGG - Intronic
1151520903 17:74628897-74628919 TGCACCAGATGCAAAAGAAGAGG + Intergenic
1151851472 17:76692892-76692914 TTCACCAGGTTCCAAAGAACTGG + Intronic
1152670798 17:81604655-81604677 TTCTCCAGAAGTCAAGAAAGCGG + Exonic
1153800643 18:8665354-8665376 TTCACCCCATGTAAATGAAGTGG + Intergenic
1155928405 18:31681656-31681678 TGCTCAAGATGGCAAAGAAGAGG + Intronic
1156822632 18:41391289-41391311 GTCACCAAATGTAAAAGCAGAGG + Intergenic
1157437485 18:47683097-47683119 CTCACCAAATGTGAAAGAGGTGG + Intergenic
1157769022 18:50328099-50328121 TTCACCACATGTCAAATCAGCGG - Intergenic
1158727724 18:59989517-59989539 ATCCCCACATGTCAAAGGAGGGG + Intergenic
1159338586 18:67103641-67103663 TTCAACGGATGTGAAAGGAGTGG - Intergenic
1159374958 18:67581355-67581377 ATCTCCAGATGGCAAAGGAGAGG - Intergenic
1161207432 19:3048470-3048492 ATCAGCAGCTGTCACAGAAGTGG - Intergenic
1161210472 19:3062723-3062745 TTCCCCATCTGTCAAAGAAAAGG + Exonic
1165193868 19:34086007-34086029 TTAACCAGCTGCCTAAGAAGGGG + Intergenic
1166952974 19:46442580-46442602 TTCACCCCATGTAAATGAAGTGG - Intergenic
1167967250 19:53157963-53157985 GTAACCAGATGGCAAAGTAGAGG - Intronic
1168180425 19:54658951-54658973 TTCTACAGATGCCAAGGAAGGGG - Intronic
925996135 2:9294823-9294845 TTCAAGAGATGACAAAGGAGGGG - Intronic
926408464 2:12577850-12577872 TTAACCAGATGACAACAAAGGGG - Intergenic
926539920 2:14163179-14163201 ATCTCCACATGTCAAAGATGGGG - Intergenic
928703315 2:33921124-33921146 TTGAATAGATGTCAAAGAAATGG + Intergenic
929691276 2:44076062-44076084 TTCTCCTTCTGTCAAAGAAGAGG - Intergenic
932259375 2:70314200-70314222 TACACCCGATGTAAATGAAGAGG - Intergenic
933174312 2:79158765-79158787 TTCACCTGAGGTGGAAGAAGAGG + Exonic
933315820 2:80713747-80713769 TTTAAAAGATGTCAAGGAAGAGG + Intergenic
934558501 2:95300118-95300140 TTAACCAGATGGCAGAGGAGGGG + Intronic
935350431 2:102147689-102147711 GTCACCAGATGCCACAGATGGGG - Intronic
935516473 2:104046777-104046799 TTCAACAGAGTTCAAAGCAGGGG - Intergenic
939394805 2:141614699-141614721 TTCACCAAAAGCTAAAGAAGAGG + Intronic
939468170 2:142584990-142585012 TCCCCCACATGTCAAAGATGGGG + Intergenic
939783678 2:146481504-146481526 GTCACCATATATCAAACAAGAGG + Intergenic
941250991 2:163162203-163162225 TTCACCCCATGTAAACGAAGTGG + Intergenic
943297981 2:186161827-186161849 ATCCCCATATGTCAGAGAAGGGG + Intergenic
947156548 2:227167506-227167528 TTATCCAGAAATCAAAGAAGGGG - Intronic
947328986 2:229008639-229008661 TTTCCCAGATGTGAAAGAACAGG - Intronic
1169622356 20:7521783-7521805 TTCCCCTGTTGTCAAAGAAAAGG - Intergenic
1169881291 20:10350318-10350340 TTCACCACAAGTCAAAGTACAGG + Intergenic
1170564780 20:17592498-17592520 TTCACCATATCTCAAGGATGTGG + Intronic
1171213725 20:23336602-23336624 TTCACCCGGTGTAAATGAAGTGG - Intergenic
1172216169 20:33237396-33237418 TCCACCACATTCCAAAGAAGAGG - Intronic
1172707558 20:36893456-36893478 TCTACAAGATGGCAAAGAAGGGG + Exonic
1172732483 20:37099652-37099674 TGAACCAGATATCAAAGAATTGG + Intergenic
1173132371 20:40406555-40406577 TTCACCAGGTATCAAAGACCTGG + Intergenic
1173485617 20:43438842-43438864 TTCACCTCATGTAAATGAAGTGG - Intergenic
1174118164 20:48242150-48242172 TTAAGCAGATGTCGAAGAGGGGG + Intergenic
1176942084 21:14937226-14937248 TTCAGCGAATGTAAAAGAAGAGG - Intergenic
1177556977 21:22703576-22703598 ATCCCCAGGTGTCAAAGGAGGGG + Intergenic
1178447445 21:32658870-32658892 TTAATCAAATGTCAAACAAGTGG - Intronic
1178911928 21:36681704-36681726 ATCACCAGGTGTCAAGGGAGGGG + Intergenic
1180648890 22:17362503-17362525 TACACCAGATTTCAAAGACTTGG + Intronic
1181404990 22:22677908-22677930 CTCACCACTTGTCAAGGAAGTGG - Intergenic
1181914285 22:26266995-26267017 TTCACCAGATGGCCAATTAGAGG + Intronic
1181968481 22:26672765-26672787 TACACCGGAAGTCAATGAAGCGG + Intergenic
1182807872 22:33090876-33090898 ATCACCAGGTGTCCAAGAACAGG - Intergenic
1184673153 22:46026234-46026256 TTCACCAGAGCTAAAAGAGGAGG - Intergenic
952026493 3:29088588-29088610 TTGATCAGATGTCAAAGTAATGG - Intergenic
952117132 3:30196228-30196250 TTCAGCAGTTCTCAAAGAATGGG - Intergenic
955691254 3:61592734-61592756 TTCACCAGAATTCAAGGAGGTGG - Intronic
956227964 3:66980887-66980909 TGAACCAGAAGTCAAAGAAATGG + Intergenic
957225953 3:77446892-77446914 TCAAACAGATGTCAAAGATGAGG - Intronic
957690437 3:83558889-83558911 ATCTCCAGATTTCAGAGAAGTGG + Intergenic
961249827 3:125492282-125492304 GTCACCAGAGGCCAAGGAAGAGG - Intronic
962652878 3:137514018-137514040 TTGAACATTTGTCAAAGAAGTGG + Intergenic
962823685 3:139079239-139079261 TTCACCAGCTATTAAAGAAAAGG + Intronic
963230791 3:142907103-142907125 TTCACCCCATGTAAATGAAGTGG + Intergenic
965834681 3:172838315-172838337 TTCACAAGATCTCAAGGACGTGG - Intergenic
966173495 3:177110530-177110552 TTCAGCAGAAGACAAAGAGGAGG + Intronic
966477820 3:180370122-180370144 TTCAGCAAATGTAAAAGAACAGG + Intergenic
967267793 3:187706106-187706128 TTCCCCAGTTGTCAAACAATTGG + Intronic
969147651 4:5138076-5138098 TTCACCAAAGATCAGAGAAGAGG - Intronic
969169358 4:5347652-5347674 ATCCCCACATGTCAAAGAAGGGG + Intronic
970546347 4:17134100-17134122 TTCTTCTGATTTCAAAGAAGGGG + Intergenic
972230249 4:37064077-37064099 TTCACCAAATGTCGAATTAGCGG + Intergenic
973148596 4:46860549-46860571 TTCACCAGATGTCAAAGAAGGGG - Intronic
974266135 4:59588066-59588088 TTCACTGGATGCCAAAAAAGGGG - Intergenic
975077509 4:70230239-70230261 TTCACACCATGACAAAGAAGAGG + Intronic
975228777 4:71906751-71906773 TTGACCAGATGTCAATAAAGTGG + Intergenic
975243329 4:72088804-72088826 TTCCCCACATGTCAAGGGAGGGG - Intronic
975743475 4:77453191-77453213 TTGACCAGATGAACAAGAAGTGG + Intergenic
977059990 4:92246037-92246059 TACACCAGATTTCAAAGAATTGG + Intergenic
978266036 4:106825610-106825632 TTCGCCAAATTTCAAAGAAATGG + Intergenic
979089654 4:116465875-116465897 TTCCCCAGATGTAGAAAAAGGGG - Intergenic
980267866 4:130543177-130543199 TTCACCCCATGTAAATGAAGTGG + Intergenic
981286192 4:143021602-143021624 TATACCAGTGGTCAAAGAAGAGG - Intergenic
982226926 4:153174955-153174977 TGCACCAGTTGACAAAGATGTGG - Intronic
982991060 4:162274622-162274644 TTCTCTAGCTGTCACAGAAGGGG - Intergenic
984503773 4:180591361-180591383 TTTTGCAGATGCCAAAGAAGTGG + Intergenic
985798767 5:1987172-1987194 ATCCCCACATGTCAGAGAAGGGG + Intergenic
988787149 5:34575560-34575582 TTAAGAAGCTGTCAAAGAAGAGG - Intergenic
989744429 5:44810533-44810555 TTCCCCAGTTGAGAAAGAAGTGG + Intronic
990174481 5:53091864-53091886 TTCACCAGAAGTTACAGATGAGG + Exonic
990485069 5:56250115-56250137 TTCACCAGAAGGCATTGAAGAGG - Intergenic
992068560 5:73129267-73129289 TTCACCTCATGTAAATGAAGTGG + Intronic
992180160 5:74188137-74188159 TGGACCAGAGGTCTAAGAAGTGG + Intergenic
993133669 5:83930195-83930217 CTCACCAGATGCCAGATAAGAGG + Intergenic
993727518 5:91384993-91385015 TCCACCAGGTGTCAACCAAGAGG - Intergenic
994011513 5:94909000-94909022 TTCTCCAGATGTCAAAGTTATGG - Intronic
994149993 5:96436041-96436063 TTCAAGAGATGTTAAAGAATGGG + Intergenic
995139860 5:108723243-108723265 TTGACCAGATGTCAAAAAAGAGG + Intergenic
995523860 5:113035261-113035283 TTGAACAGATGTCAAGGATGAGG - Intronic
995893008 5:116977827-116977849 TGCACAAGATGTTAAATAAGTGG - Intergenic
996486138 5:124037099-124037121 TACACCAGGTAGCAAAGAAGAGG + Intergenic
996545177 5:124670434-124670456 TTTACCAGAAGTCAAATAACTGG + Intronic
997611781 5:135220669-135220691 TTCGCCAGATGTCCCAGAAGTGG + Intronic
997619036 5:135272921-135272943 TTCAGCACAGGTCACAGAAGTGG + Intronic
997750341 5:136338476-136338498 TTCACCAGCTCTCAATAAAGTGG - Intronic
998314426 5:141168693-141168715 TCTACCATATGTCCAAGAAGGGG - Intergenic
998506780 5:142678753-142678775 TTCAAATGATGCCAAAGAAGGGG + Intronic
1000067198 5:157704734-157704756 TGCACCAGAAGTCCAAAAAGAGG - Intergenic
1000592589 5:163176553-163176575 TCCACCTGATGTGAAAGAGGAGG + Intergenic
1007679079 6:43621957-43621979 TTCTCCAGAGGTCAGAAAAGAGG - Intronic
1008717539 6:54307226-54307248 TTCAGTAGATGGCAAGGAAGTGG + Intergenic
1009211813 6:60871272-60871294 TTCACCCCATGTAAATGAAGTGG + Intergenic
1012211743 6:96527239-96527261 TTTTCCTGATGTCAAATAAGTGG - Intronic
1012232066 6:96771657-96771679 TCCACCAGAAGTAAAAGAGGAGG + Intergenic
1012731564 6:102888447-102888469 TGCCCCGGAAGTCAAAGAAGGGG + Intergenic
1013652786 6:112212808-112212830 TTCATCAGGTGTCGAAGAACAGG - Intronic
1015014722 6:128398222-128398244 TTCACCTCATGTAAATGAAGTGG + Intronic
1019442458 7:1054305-1054327 TTCACCAGGTATCAATGATGAGG - Intronic
1019478101 7:1253829-1253851 GTCACCTGAGGTCACAGAAGGGG - Intergenic
1021045020 7:15912261-15912283 TTCCCCAGGTGTTAAAGATGAGG + Intergenic
1021348846 7:19563649-19563671 TTCATCAGATGGAAAAGAAGGGG - Intergenic
1023153064 7:37220802-37220824 TTCCCCATCTGTGAAAGAAGAGG - Intronic
1023854877 7:44176704-44176726 TTCACCTGATGTCACTCAAGGGG + Intronic
1026342000 7:69442569-69442591 ATCCCCACATGTCAAAGATGGGG + Intergenic
1027484263 7:78740268-78740290 TTAACCAAATGGCAAAGATGAGG - Intronic
1027974564 7:85134753-85134775 TCCATCATATGTCAAAGAAGTGG - Intronic
1028238991 7:88396782-88396804 ATCACCAGACTTGAAAGAAGAGG + Intergenic
1029164287 7:98575895-98575917 TTCAGCAGAGGTGAAAGAAAGGG - Intergenic
1029676410 7:102072276-102072298 TTCACCCCATGTAAATGAAGTGG + Intronic
1030374478 7:108739056-108739078 ATCACCAAATGTCAATGAACAGG - Intergenic
1031556595 7:123184050-123184072 TTCTTCAGATGTGAAAAAAGGGG - Intronic
1032700966 7:134378731-134378753 TTCACCCCATGTAAATGAAGTGG + Intergenic
1033026643 7:137780919-137780941 TTCACCTCATGTCAAGAAAGAGG + Intronic
1033382132 7:140831901-140831923 GTCAGCAGATTACAAAGAAGTGG - Intronic
1034042446 7:147893819-147893841 TTTTCCACATGTAAAAGAAGAGG + Intronic
1036435890 8:8732938-8732960 TAAACCAGATATCAAAGAAGTGG + Intergenic
1038148159 8:24917403-24917425 TGCACCTGAAGTTAAAGAAGAGG + Exonic
1040138974 8:43888135-43888157 TTCACAAGATCTCCAAAAAGAGG - Intergenic
1042538781 8:69886461-69886483 TTTACCACATAGCAAAGAAGTGG + Intergenic
1043796925 8:84554538-84554560 ATCACCAAATGTCAAAGAGATGG + Intronic
1044515712 8:93136065-93136087 TTCACCTAATGTGAAGGAAGGGG + Intronic
1047782586 8:128122366-128122388 TTCAAGAGATGTCACACAAGTGG - Intergenic
1048378231 8:133841702-133841724 TTTAAAAGATGTCAGAGAAGAGG - Intergenic
1050618925 9:7432865-7432887 GTCTCCAGATGTGAAAGAATTGG - Intergenic
1051785693 9:20740792-20740814 TTCTACAGATGACAAAGAAAAGG - Intronic
1051949095 9:22609105-22609127 TTCACCAGATTCCAAAGTAGAGG + Intergenic
1052085343 9:24258538-24258560 TACAACATATATCAAAGAAGTGG - Intergenic
1055241127 9:74187835-74187857 TTCTCCACAAGACAAAGAAGGGG + Intergenic
1056628544 9:88274083-88274105 TTAACCAGATCTCAAGGAACAGG + Intergenic
1056762560 9:89425622-89425644 TGCCCCTGATGTCAAAGCAGCGG - Intronic
1059492493 9:114680491-114680513 TTCACCATTTGTCAAACCAGAGG - Intergenic
1060860904 9:126954130-126954152 TTCACCGGAGCACAAAGAAGTGG - Intronic
1061640418 9:131950230-131950252 TTCACCAGATCTGACAGAAATGG - Intronic
1186766549 X:12776331-12776353 TTCAAGAGATGTCAAAGATTTGG + Intergenic
1187605797 X:20881439-20881461 TTTTCCAGATCTTAAAGAAGAGG - Intergenic
1187793134 X:22972479-22972501 TTCTCCAATTGTAAAAGAAGTGG - Intergenic
1188616636 X:32165774-32165796 ATCCCCAGGTGTCAAAGGAGAGG + Intronic
1189087697 X:38044182-38044204 TTCAACAAATTTCAAAGAAATGG + Intronic
1189092506 X:38101542-38101564 TTCACCTGGTGTGAAAGGAGGGG + Intronic
1189361425 X:40355842-40355864 TTCTCCTGATCTCAAAGAAAAGG - Intergenic
1192083163 X:68067689-68067711 TTCAAGAGAGGTTAAAGAAGTGG + Intronic
1192479406 X:71471809-71471831 TTCACCCCATGTAAATGAAGTGG + Intronic
1193668672 X:84356268-84356290 TTTACCATATGTTACAGAAGAGG + Intronic
1193960615 X:87920738-87920760 TTTACCAGATGGCAAAGAGAAGG + Intergenic
1194045898 X:89002966-89002988 ATCAACAGCTGTCAAAGAAATGG + Intergenic
1194095775 X:89636896-89636918 TTCACCAGAATTGAATGAAGTGG + Intergenic
1194752944 X:97704925-97704947 TTCTCCTCATGCCAAAGAAGCGG - Intergenic
1196781704 X:119389438-119389460 TTCACCCCATGTAAATGAAGTGG - Intergenic
1196854570 X:119970681-119970703 TTCACCTTATGTAAATGAAGTGG + Intergenic
1197108824 X:122747913-122747935 TTCACCAGCTGTAAAATGAGTGG + Intergenic
1197716983 X:129716542-129716564 TTCACCCCATGTAAATGAAGTGG + Intergenic
1197739763 X:129880905-129880927 TTCACCTCATGTAAATGAAGTGG + Intergenic
1198317074 X:135478620-135478642 CTCACCACATATAAAAGAAGGGG - Intergenic
1199526422 X:148797270-148797292 TTTCCCAGATGTAAAACAAGCGG - Intronic
1200448775 Y:3298268-3298290 TTCACCAGAATTGAATGAAGTGG + Intergenic