ID: 973148597

View in Genome Browser
Species Human (GRCh38)
Location 4:46860550-46860572
Sequence ATTCACCAGATGTCAAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 315}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973148597_973148602 30 Left 973148597 4:46860550-46860572 CCCTTCTTTGACATCTGGTGAAT 0: 1
1: 0
2: 1
3: 18
4: 315
Right 973148602 4:46860603-46860625 ATTCAAAATCCCCCATAGTTTGG No data
973148597_973148601 4 Left 973148597 4:46860550-46860572 CCCTTCTTTGACATCTGGTGAAT 0: 1
1: 0
2: 1
3: 18
4: 315
Right 973148601 4:46860577-46860599 AAATGAAGTCTCTGGTTAGATGG 0: 1
1: 0
2: 2
3: 21
4: 244
973148597_973148600 -4 Left 973148597 4:46860550-46860572 CCCTTCTTTGACATCTGGTGAAT 0: 1
1: 0
2: 1
3: 18
4: 315
Right 973148600 4:46860569-46860591 GAATCAGGAAATGAAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973148597 Original CRISPR ATTCACCAGATGTCAAAGAA GGG (reversed) Intronic
905571206 1:39007228-39007250 ATTCACCAGGTTTGAAAGATTGG - Intergenic
905784183 1:40739848-40739870 ATTCACCAGATGTGAAGGATGGG + Intronic
906498135 1:46320120-46320142 AATCCCCAGGTGTCAAAGGAGGG + Intergenic
908704745 1:66940018-66940040 ATTCAACAGATGGCTGAGAAGGG - Exonic
908794599 1:67818536-67818558 ATTCAACAGATGTAAAATGATGG + Intronic
909226996 1:73038249-73038271 ATTCAGCATTTATCAAAGAAAGG + Intergenic
914693031 1:150048204-150048226 TTCCACCAGAAGTTAAAGAAAGG + Intergenic
916827845 1:168460406-168460428 CCTCAGCAGATGTAAAAGAACGG - Intergenic
917115755 1:171601431-171601453 ACTCACCACAAGACAAAGAACGG - Intergenic
917181593 1:172303581-172303603 ATTCACCAAAGTTCAAATAAAGG + Intronic
918210918 1:182349993-182350015 ATCCACCAGATGTCAATAAGGGG - Intergenic
918926906 1:190798243-190798265 ATTCAACAGATTTAACAGAAAGG - Intergenic
919294927 1:195685703-195685725 ATTCATCTGATCTCAAAAAATGG - Intergenic
919562743 1:199142401-199142423 ATACATCAAATGTCAAAGATAGG + Intergenic
919779334 1:201212350-201212372 GAAAACCAGATGTCAAAGAATGG + Exonic
921739221 1:218664843-218664865 ATTCACCAGAGGTCAAGGCTTGG + Intergenic
921982029 1:221269386-221269408 CTTCATCAGATGTAAAATAATGG - Intergenic
922084613 1:222334081-222334103 ATTAGCCAGATGACAAAGAGGGG + Intergenic
922410693 1:225372313-225372335 CTTCACCAGATATCAAAACATGG + Intronic
923450702 1:234114719-234114741 CTTCCCCAAATGTCCAAGAAAGG - Intronic
924437801 1:244059015-244059037 ATCAGCCAGATGTCAAAGGAGGG - Intergenic
1064046182 10:12018036-12018058 ATTACTTAGATGTCAAAGAAAGG - Intronic
1066306353 10:34146571-34146593 TTTCATCACATGTCAAAGAAAGG - Intronic
1067475091 10:46559503-46559525 AGTCACCAGGTGACAAAGGATGG + Intergenic
1068117703 10:52752370-52752392 ATTCACCAGGTGCCCAAAAAAGG + Intergenic
1068307585 10:55233740-55233762 ATTCACCAGATGTAAAGCATTGG + Intronic
1068384290 10:56304423-56304445 AGTCACCAGCTGTCAAAGGGAGG + Intergenic
1068647391 10:59482596-59482618 TTTAACCAGATTTCAAAGAATGG - Intergenic
1070993083 10:80750192-80750214 ACTCCCCATATGTCAAGGAAGGG - Intergenic
1071767705 10:88687474-88687496 ATTATCCAGATGTGAAACAAAGG + Intergenic
1071882442 10:89914159-89914181 ATTCACTACATTACAAAGAATGG - Intergenic
1073038460 10:100581074-100581096 ATGTAACAGATGCCAAAGAAGGG - Intergenic
1074111545 10:110426287-110426309 ATTGCCCAGATTTAAAAGAAAGG + Intergenic
1076182424 10:128420648-128420670 AATCCCCACATGTCAAAGGAGGG - Intergenic
1078723464 11:13905548-13905570 ATTCACTACATGTGAAAAAAAGG + Intergenic
1080051384 11:27862635-27862657 TTTCCTCAGATGTCAAGGAAAGG - Intergenic
1080321176 11:31011517-31011539 CTTCACCAGTAGTCAGAGAAGGG + Intronic
1082182536 11:49137575-49137597 GTTCAACAGATGTTAATGAATGG + Intergenic
1082821498 11:57547331-57547353 AGTCATCAGATGACAAAGACAGG + Intronic
1085208825 11:74755706-74755728 ATTCACCAGATGAGGAAGGAGGG + Intronic
1085459063 11:76682230-76682252 ATTCACCAGGTGTTGAAAAAGGG + Intergenic
1087302394 11:96450548-96450570 AGACACCAGATGTTAAAGGAGGG + Intronic
1087397877 11:97625421-97625443 ATTTACCACATATCAAAGACAGG - Intergenic
1087497704 11:98910948-98910970 AATCCCCACATGTCAAGGAAGGG + Intergenic
1091416151 12:286602-286624 CTTTACCAGATATCAAAGTAAGG + Intronic
1093322428 12:17729534-17729556 ATTTACCAGATATTCAAGAAGGG + Intergenic
1095184943 12:39190505-39190527 ATGAACCAGATGCCAAGGAAGGG - Intergenic
1097135195 12:56847187-56847209 AATCCCCACATGTCAAAGGAGGG - Intergenic
1097721721 12:63029267-63029289 AATCCCCACATGTCATAGAAGGG - Intergenic
1098425288 12:70357846-70357868 ATTCAAGAGCTGTCAATGAAAGG + Intergenic
1098616891 12:72537329-72537351 AATCCCCACATGTCAAGGAAGGG + Intronic
1099460248 12:82912266-82912288 ATTACCCAGGTGTCAAAGCATGG + Intronic
1099991869 12:89731380-89731402 ATTCAAAAGATGACACAGAAAGG - Intergenic
1100674466 12:96850924-96850946 AATCACCACCTGTCAAGGAAGGG - Intronic
1102757150 12:115351011-115351033 ATTCAGCAGGTCTGAAAGAAGGG + Intergenic
1104468736 12:129011249-129011271 AATCTCCACATGTCAAAGGAGGG - Intergenic
1105489493 13:20873971-20873993 TTTCTCCAGATGTAAAAGAGGGG - Intronic
1105695526 13:22884527-22884549 ACTCACCACAAGACAAAGAACGG - Intergenic
1106046667 13:26148265-26148287 AATCCCCATGTGTCAAAGAAGGG - Intronic
1106881349 13:34134528-34134550 TTTAACCAGGTGTCAAAGAAAGG + Intergenic
1107780705 13:43899055-43899077 AATCCCCACATGTCAGAGAAGGG - Intergenic
1109278940 13:60333245-60333267 TTTCACTATATGTCTAAGAATGG + Intergenic
1109297657 13:60553789-60553811 ATTCCCCACATGTCAATGGAGGG - Intronic
1109734536 13:66465041-66465063 TTTCACCAGATGTTCAAGAAAGG - Intronic
1110022172 13:70489600-70489622 AATCCCCACATGTCAAAGGAGGG + Intergenic
1110632914 13:77730314-77730336 GTTCACCAGATTTCCAAAAAAGG - Intronic
1110852881 13:80264466-80264488 AATCCCCACATGTCAAAGGAGGG - Intergenic
1110927679 13:81175879-81175901 ATTGACAAGATTTCAAATAAAGG + Intergenic
1111859325 13:93681949-93681971 ATTAAGCAGCTGTCAAAAAAAGG - Intronic
1112000848 13:95208402-95208424 TTTCTCCAGATGGCAAAGAGGGG + Intronic
1112404222 13:99103772-99103794 ATTCAGCAGCTGCCAAAGGAGGG - Intergenic
1120456849 14:84741651-84741673 ATTCCCCAGGTGAGAAAGAATGG - Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1123507614 15:20960580-20960602 ATTCACCAGAAGAGATAGAAGGG + Intergenic
1123564836 15:21534323-21534345 ATTCACCAGAAGAGATAGAAGGG + Intergenic
1123601093 15:21971614-21971636 ATTCACCAGAAGAGATAGAAGGG + Intergenic
1125418604 15:39479247-39479269 AGGCACCAGATGTGAAAGTAAGG + Intergenic
1125978475 15:43977608-43977630 ATTAAGCAGATGACAATGAAAGG + Intronic
1126966997 15:54065468-54065490 ACAAACCAGATATCAAAGAAAGG - Intronic
1128344405 15:66844420-66844442 ATTCCCCACATGTCAAATGAAGG - Intergenic
1130303134 15:82695419-82695441 ATTCCCCAGAGGTCAAATAGTGG - Intronic
1131158834 15:90091384-90091406 GTGGACCAGATGTGAAAGAAGGG + Intronic
1202973201 15_KI270727v1_random:261433-261455 ATTCACCAGAAGAGATAGAAGGG + Intergenic
1133081090 16:3320742-3320764 ATGCAGGAGATTTCAAAGAATGG + Intergenic
1133176167 16:4016403-4016425 ATGCACCAGATGCCACAGACGGG + Intronic
1134919534 16:18103031-18103053 ATTCTCCAGATGCCAAATCAAGG + Intergenic
1135785736 16:25347483-25347505 AATCCCCACATGTCAAAGGAGGG - Intergenic
1135936984 16:26789429-26789451 AATCCCCACATGTCAAAGGAGGG + Intergenic
1136946595 16:34659332-34659354 ATTCATCAAATGTCATAGAATGG - Intergenic
1138334882 16:56245243-56245265 GCTCACCAGATTTCTAAGAATGG - Intronic
1141371932 16:83495774-83495796 ATTCCCCAGATGTCTTAGATAGG + Intronic
1142208880 16:88798033-88798055 ATACACTAGATTTCAAAGACCGG + Intergenic
1143914735 17:10281572-10281594 AATCCCCACATGTCAAAGGAGGG - Intergenic
1145903223 17:28501263-28501285 AGGGACCACATGTCAAAGAAGGG - Intronic
1149331399 17:55586344-55586366 AATCCCCACATGTCAAAGGAGGG - Intergenic
1150865141 17:68841297-68841319 ATTGATCTGATGTCAAAGACAGG - Intergenic
1150885586 17:69082022-69082044 GTTGACCAGATGTCCAAGATTGG + Intronic
1151035758 17:70797328-70797350 AGTCTCCAGATGATAAAGAAAGG - Intergenic
1152108776 17:78345577-78345599 AATCACCAAATGTCAAACACAGG + Intergenic
1153795063 18:8614378-8614400 ATACAGGAGAAGTCAAAGAAAGG + Intronic
1156448961 18:37255801-37255823 ATCCACCTGAGCTCAAAGAAGGG + Intronic
1158727723 18:59989516-59989538 AATCCCCACATGTCAAAGGAGGG + Intergenic
1159358479 18:67368626-67368648 AATCACCACATGTCAAGGGAGGG + Intergenic
1160573958 18:79838170-79838192 AATCACCACATGTCAAGGGAGGG - Intergenic
1165206985 19:34198284-34198306 ATTCACAAAATAACAAAGAATGG + Intronic
1166943846 19:46385132-46385154 TTTCAGCAGATGGCAAACAAGGG + Intronic
926364565 2:12121424-12121446 GTTTACCAGATGCCCAAGAAGGG + Intergenic
926539921 2:14163180-14163202 AATCTCCACATGTCAAAGATGGG - Intergenic
928344350 2:30477074-30477096 ATTCACTAAACATCAAAGAATGG - Intronic
928811989 2:35238981-35239003 TTTCACTAAATGTAAAAGAAAGG + Intergenic
928911981 2:36430845-36430867 ATTGACAAGATGGCATAGAATGG - Intronic
930454846 2:51593721-51593743 ATTCAACATATTTAAAAGAAGGG + Intergenic
936757570 2:115733385-115733407 AGTCTCCAGAGGTCAAACAAGGG + Intronic
937434946 2:121872545-121872567 ATACTCCAGATGTGAAAGAATGG - Intergenic
937608683 2:123834120-123834142 ATTTACCTGGTGTCAAAAAATGG - Intergenic
938520641 2:132067309-132067331 ATTCACCATAGGTGAAAGGAAGG - Intergenic
938890891 2:135704329-135704351 CTTCAGCAGATGTCAGAGTATGG - Intronic
938898799 2:135780258-135780280 AATCTCCAGATGGCAAGGAATGG - Exonic
939031534 2:137081463-137081485 AATAACAAGATGTCCAAGAAAGG - Intronic
939468169 2:142584989-142585011 ATCCCCCACATGTCAAAGATGGG + Intergenic
940232074 2:151466177-151466199 ATTCACCAGAGGTCACTGTATGG - Intronic
940830663 2:158461688-158461710 ATGCCTCAGATGTCAAAGAAAGG - Intronic
942290991 2:174470578-174470600 ATTTACCTGATATCAAAGCATGG + Intronic
942886956 2:180937559-180937581 AATCCCCACATGTCAAAGGAGGG + Intergenic
943297980 2:186161826-186161848 AATCCCCATATGTCAGAGAAGGG + Intergenic
943924748 2:193759762-193759784 ATTCACCATGTTTCAAGGAAGGG - Intergenic
943938962 2:193965368-193965390 AATCCCCACATGTCACAGAAGGG + Intergenic
944948511 2:204718549-204718571 AATCCCCACATGTCAAGGAAGGG - Intronic
946905901 2:224415928-224415950 ATTCAAGGGATGTCAAATAATGG - Intergenic
948520355 2:238532732-238532754 AATCCCCACATGTCATAGAAGGG - Intergenic
1168937297 20:1676439-1676461 ATTCTGCAGCTGTCAAAGAGTGG + Intergenic
1169922209 20:10747381-10747403 ATTCAACACATGCCAAGGAAGGG + Intergenic
1169986454 20:11450519-11450541 AATCCCCAGATGTCAAGGGAAGG - Intergenic
1170401168 20:15985254-15985276 ACTCACCACAAGACAAAGAACGG + Intronic
1173766524 20:45615282-45615304 GTTCACCAAATGTCAGGGAAGGG + Intronic
1174099328 20:48115164-48115186 AATCACCACATGTCAAGGGAGGG + Intergenic
1174118163 20:48242149-48242171 ATTAAGCAGATGTCGAAGAGGGG + Intergenic
1174849356 20:53977214-53977236 AATCCCCAGGTGTCAAAGGAGGG - Intronic
1174968388 20:55245716-55245738 CTTCACCAAATGGGAAAGAATGG + Intergenic
1175790276 20:61736361-61736383 ATTCCCCAGATGTCCACGGAAGG + Intronic
1177556976 21:22703575-22703597 AATCCCCAGGTGTCAAAGGAGGG + Intergenic
1178060097 21:28843411-28843433 AATCACCACATGTCAAGGGAGGG - Intergenic
1178198656 21:30378144-30378166 AATCCCCACATGTCAAGGAAGGG + Intronic
1178911927 21:36681703-36681725 AATCACCAGGTGTCAAGGGAGGG + Intergenic
1179431375 21:41323467-41323489 ATTGAGTAGATGTGAAAGAAAGG + Intronic
1180018529 21:45103758-45103780 ATTGAGCAGATGTGACAGAAAGG - Intronic
1180281150 22:10697531-10697553 ATTCAAAAGATGTCAAACACAGG + Intergenic
1181328833 22:22073718-22073740 GCTCCCCAGATGTCAAAGCAGGG + Intergenic
1181913387 22:26258443-26258465 ATTAACCAGATGCAAAAGAGAGG + Intronic
1182290431 22:29273957-29273979 ATTCCCCAGATGCCAAGGTATGG - Intronic
1182792537 22:32964987-32965009 ATTCAACAGATGAGATAGAAAGG + Intronic
1184297487 22:43534131-43534153 AATCACCAGTTGTCAAGGGAGGG + Intronic
1203238234 22_KI270732v1_random:29000-29022 ATTCAAAAGATGTCAAACACAGG + Intergenic
949643321 3:6065099-6065121 ACTCACCTGGTGTCAAAGAAGGG - Intergenic
950428878 3:12939527-12939549 AATCACCAGATGAAAAAGTAGGG - Intronic
950623894 3:14230280-14230302 ATTCACCAAATGACAAATGATGG - Intergenic
950713721 3:14832728-14832750 ACTCTCCAGCTGTCAAATAAGGG + Intronic
950903589 3:16517678-16517700 ATTCTACAGATGTCAAAATAAGG + Intergenic
951836153 3:26985753-26985775 TTTCCCCACATCTCAAAGAAAGG + Intergenic
952117133 3:30196229-30196251 ATTCAGCAGTTCTCAAAGAATGG - Intergenic
952777797 3:37062923-37062945 AATCTCCAGATGCCAATGAAGGG + Intronic
955148911 3:56347521-56347543 ATTCAGCAGCTGCCACAGAAAGG - Intronic
955529449 3:59858104-59858126 AGTGAGTAGATGTCAAAGAATGG + Intronic
958025743 3:88046888-88046910 AATCCCCACATGTCAAAGGAGGG + Intergenic
958884272 3:99708534-99708556 ATTCTTCAGAGATCAAAGAAGGG - Intronic
959178062 3:102942655-102942677 ATTCATCAGAAGCCAAGGAAAGG + Intergenic
959606148 3:108243924-108243946 AATCCCCACATGTCACAGAAGGG + Intergenic
960185577 3:114634047-114634069 ATTCAACATATGTTAACGAATGG - Intronic
960399638 3:117180482-117180504 ATTCCCCACATGTCAAGGGAGGG - Intergenic
960407482 3:117279440-117279462 ATTCACCAGATGTTAATAACTGG + Intergenic
964690289 3:159442539-159442561 ATTTACCAGAAGTGAAGGAAAGG + Intronic
965365500 3:167794068-167794090 ATTCACCTGATTTTTAAGAAGGG - Intronic
965443186 3:168742110-168742132 ATAAAACAGATGTCAAAAAATGG - Intergenic
967618221 3:191599891-191599913 AATCCCCACATGTCAGAGAAGGG + Intergenic
969169357 4:5347651-5347673 AATCCCCACATGTCAAAGAAGGG + Intronic
969172064 4:5372067-5372089 ATACAGCAGATGGCACAGAAGGG + Intronic
970114046 4:12673047-12673069 ATTGCCCAGAAGTCCAAGAAGGG - Intergenic
970347204 4:15163945-15163967 TTTCAGCAGATGTCATAGATAGG - Intergenic
971599931 4:28580006-28580028 TTTCAAAAGATTTCAAAGAATGG + Intergenic
971957859 4:33445607-33445629 ATTCCCCAGTTATTAAAGAAAGG + Intergenic
971984046 4:33795935-33795957 ATTCACCAGACTTTAAAAAATGG - Intergenic
972094892 4:35335741-35335763 AATCCCCACATGTCAAGGAAGGG - Intergenic
972823485 4:42729439-42729461 AATCTCCACATGTCAAAGGAGGG - Intergenic
972864979 4:43220742-43220764 AGTCACCAGTTGACAGAGAAGGG + Intergenic
973148597 4:46860550-46860572 ATTCACCAGATGTCAAAGAAGGG - Intronic
974072356 4:57135884-57135906 ATTCACCAGTTTTTAAGGAAAGG + Intergenic
975074481 4:70188037-70188059 ATTTTCAAGATGTCTAAGAATGG - Intergenic
975291432 4:72682038-72682060 ATTCCTCAAATGTAAAAGAATGG + Intergenic
976655660 4:87486443-87486465 CCTCAGCAGATGTGAAAGAATGG - Intronic
977407167 4:96614361-96614383 ATTCACGACATGTCAAAGAGAGG - Intergenic
977471486 4:97448418-97448440 AATCCCCACATGTCAAAGGAGGG + Intronic
978210533 4:106131027-106131049 AATCCCCACATGTCAAAGATAGG + Intronic
978617109 4:110608960-110608982 AGTCACCTGATGTAGAAGAAGGG + Intergenic
978625755 4:110683632-110683654 ATACACCAGAACTCAGAGAAGGG - Intergenic
979052404 4:115951465-115951487 ACTCACCACAAGACAAAGAACGG - Intergenic
979072694 4:116229748-116229770 AATCCCCACATGTCAAGGAAGGG - Intergenic
979089655 4:116465876-116465898 ATTCCCCAGATGTAGAAAAAGGG - Intergenic
979805018 4:124960610-124960632 ATTCCCCACATGTCAAGGGAGGG - Intergenic
979820581 4:125165457-125165479 ATTAACCAGATGAAGAAGAAAGG + Intergenic
980430631 4:132689424-132689446 ATTCCCCACATGTCAGAGGAAGG + Intergenic
980537202 4:134142325-134142347 ATCCAGCAGATGGCAATGAAAGG + Intergenic
982226821 4:153174245-153174267 AGTCACCAGAAGTGTAAGAACGG + Intronic
983331719 4:166338216-166338238 ATTGACCAGAGGTCTGAGAAAGG + Intergenic
983379468 4:166973042-166973064 AATCCCCAGATGTTAAGGAAGGG + Intronic
984197090 4:176671167-176671189 ATTCACCAGAGGAAAAAAAATGG + Intergenic
984684744 4:182654619-182654641 ATTAACCAGATGACAGAAAAAGG - Intronic
984807520 4:183765392-183765414 CTTCAGCACATTTCAAAGAATGG - Intergenic
985064421 4:186106116-186106138 ATTAACTAGATGTCACACAAAGG - Intronic
985076631 4:186222918-186222940 AATCCCCAGGTGTCAAAGGAGGG + Intronic
985198174 4:187455678-187455700 ATTCACCAGATGACACTGAATGG - Intergenic
985341336 4:188957635-188957657 AATCACCAGATTGCAATGAAGGG + Intergenic
985798766 5:1987171-1987193 AATCCCCACATGTCAGAGAAGGG + Intergenic
986250567 5:6053977-6053999 AATCACCACATGTCAGAGGAGGG + Intergenic
986439727 5:7769577-7769599 ATACACCAGATGTTAAAAATTGG - Intronic
986878374 5:12138988-12139010 GTTCAACTGATGTCAAAAAATGG - Intergenic
987662559 5:20895350-20895372 AATCACCACATGTCAAGGGAGGG + Intergenic
989476432 5:41879339-41879361 AATGACCAGATGTGGAAGAAAGG + Intergenic
990026884 5:51203090-51203112 AATCCCCACATGTCAAGGAAGGG + Intergenic
990883337 5:60564461-60564483 ATGCACCAGATGTCAGTGGATGG - Intergenic
991948418 5:71924493-71924515 CTTCACTAGAGGCCAAAGAAAGG - Intergenic
992281190 5:75178494-75178516 CCTCAGCAGATGTAAAAGAATGG + Intronic
992287792 5:75253368-75253390 CCTCAGCAGATGTAAAAGAACGG - Intergenic
992989761 5:82272650-82272672 ACACACCAGAAGACAAAGAACGG + Intronic
993037096 5:82770127-82770149 AATCCCCATATGTCAAAGGAGGG + Intergenic
993787410 5:92160197-92160219 AATCCCCACATGTCAAGGAAGGG - Intergenic
994047912 5:95330096-95330118 AATCCCCAGGTGTCAAGGAAGGG + Intergenic
994149992 5:96436040-96436062 CTTCAAGAGATGTTAAAGAATGG + Intergenic
995812673 5:116125489-116125511 ATTCACCAGAGTTGAAACAAAGG - Intronic
996194078 5:120581897-120581919 ATTCAGCAAATGCAAAAGAACGG - Intronic
996453851 5:123657485-123657507 AATCATCACATGTCAAAGGAGGG - Intergenic
996850002 5:127941116-127941138 ATTTCCCAGAAGTCAAAGCAAGG - Intergenic
997775736 5:136602574-136602596 AATCCCCATATGTCATAGAAGGG + Intergenic
998114665 5:139526952-139526974 ACTCACCACAAGACAAAGAATGG - Intronic
1000202474 5:159025220-159025242 TAGCACCTGATGTCAAAGAAAGG - Intronic
1000604986 5:163318417-163318439 ACTCACCACAAGACAAAGAATGG + Intergenic
1001530589 5:172458729-172458751 ATTCACGAGTTTTCTAAGAAAGG - Intergenic
1003733292 6:8850197-8850219 ATTCAACATTTGTCAAAGAAGGG + Intergenic
1006020607 6:31115532-31115554 GTTGACTAGATGTCGAAGAAAGG + Exonic
1009489295 6:64267944-64267966 ATTAACCAAATTTCAAAAAAAGG - Intronic
1010815605 6:80354710-80354732 ATTCACTATATGCAAAAGAATGG - Intergenic
1011041284 6:83032713-83032735 AATCCCCAGGTGTCATAGAAGGG + Intronic
1011121536 6:83959010-83959032 ATTCACCAGTTTTCAAAGAAAGG - Intronic
1011384854 6:86784515-86784537 ATTCATTAAATGTCACAGAATGG + Intergenic
1011618185 6:89217204-89217226 GTCCACGAGATGTCTAAGAAAGG - Exonic
1011844740 6:91549702-91549724 ATTCACCAGAAGTCTTAGATTGG - Intergenic
1012430274 6:99156853-99156875 ATTCTCCAGCTGCCAAAGACTGG - Intergenic
1012731563 6:102888446-102888468 ATGCCCCGGAAGTCAAAGAAGGG + Intergenic
1014387482 6:120819415-120819437 ATTCACCAGAGGTGAAATGAAGG + Intergenic
1016155035 6:140795453-140795475 AGTTACCAGAAGCCAAAGAATGG - Intergenic
1017337379 6:153277472-153277494 ATTCAACAGATGGAACAGAATGG + Intergenic
1017375405 6:153762245-153762267 AATCCCCATATGTCAAAGAAGGG - Intergenic
1017984040 6:159426925-159426947 AATCCCCACATGTCATAGAAGGG + Intergenic
1018517236 6:164597689-164597711 ATTTAGAAGATGTCAAAGAACGG + Intergenic
1018701735 6:166432660-166432682 TTACACTAGTTGTCAAAGAAAGG - Intronic
1019816068 7:3201842-3201864 AATCACTAGTTGTCAAGGAAGGG - Intergenic
1021122605 7:16814161-16814183 CTTCCCCAGATGTCAAAGATGGG - Intronic
1021348847 7:19563650-19563672 TTTCATCAGATGGAAAAGAAGGG - Intergenic
1021472543 7:21021609-21021631 ATTCTCTAGATAGCAAAGAATGG - Intergenic
1022028227 7:26468192-26468214 ATTCAGCAGCTGTTAAAAAAAGG + Intergenic
1023147176 7:37163078-37163100 ATTCTACACATTTCAAAGAAAGG + Intronic
1023258908 7:38338946-38338968 ATACACCAGATGAGAAATAAAGG - Intergenic
1024671233 7:51597381-51597403 CTTCAGCAAATGTAAAAGAACGG - Intergenic
1025748607 7:64270766-64270788 AATCCCCACATGTCAAGGAAGGG + Intergenic
1026341999 7:69442568-69442590 AATCCCCACATGTCAAAGATGGG + Intergenic
1027536945 7:79415174-79415196 ATTCATGAGATGTGAAAAAATGG + Intronic
1027894317 7:84021573-84021595 ATGCACCAGATGCCAGGGAAAGG - Intronic
1027963359 7:84974861-84974883 AATCCCCACATGTCAAGGAAGGG - Intergenic
1029164288 7:98575896-98575918 TTTCAGCAGAGGTGAAAGAAAGG - Intergenic
1030018966 7:105253464-105253486 AGTGACCAGGTGGCAAAGAAAGG - Intronic
1030722563 7:112886173-112886195 AATCCCCACATGTCATAGAAGGG - Intronic
1030763536 7:113380562-113380584 ATAAAGCAGATTTCAAAGAATGG - Intergenic
1030861219 7:114632132-114632154 AATCACCACATGTTAAAGAGAGG + Intronic
1031792313 7:126121717-126121739 AATTACCAGAAGGCAAAGAATGG - Intergenic
1032539237 7:132689570-132689592 ATTTTCCAGATGGGAAAGAAAGG - Intronic
1033835525 7:145305986-145306008 ATACACAATATGTCAGAGAAAGG - Intergenic
1037024556 8:14018000-14018022 TTTCATCAGATTTCAAAGAGAGG - Intergenic
1037419478 8:18687085-18687107 AATGACCAGCTGTCAAATAAAGG + Intronic
1039406278 8:37315475-37315497 AATCCCCACGTGTCAAAGAAGGG - Intergenic
1040684567 8:49856496-49856518 ATTCAACAGTTGTCAAGGGATGG - Intergenic
1043198132 8:77326843-77326865 AATCCCCACATGTCAAGGAAGGG + Intergenic
1043236333 8:77872539-77872561 ATGCACCATATATCAAAGCAAGG - Intergenic
1043287694 8:78554683-78554705 TTTCACCAGCTTTCTAAGAAAGG + Intronic
1043661387 8:82746638-82746660 ATTCAGCACATATTAAAGAATGG - Intergenic
1044545130 8:93450792-93450814 AATCTCCACATGTCAAAGGAGGG + Intergenic
1044971116 8:97621190-97621212 ACTCAAAAGATGTCATAGAATGG + Intergenic
1046020608 8:108660192-108660214 ATTCACCAGTCATCAAAGACTGG + Intronic
1046183784 8:110687042-110687064 AGTCACCTAATATCAAAGAAAGG + Intergenic
1046790842 8:118320136-118320158 ATTCTACAGATGTCATGGAAAGG + Intronic
1047555907 8:125930116-125930138 ATTCAACAGATGAAACAGAAAGG + Intergenic
1048527463 8:135216177-135216199 AATCCCCACATGTCAAGGAAGGG - Intergenic
1048606322 8:135972194-135972216 ATTCTCAAGATGTCAAGGCAGGG - Intergenic
1050715040 9:8514811-8514833 AATCCCCATGTGTCAAAGAAGGG + Intronic
1051798571 9:20904742-20904764 ATTCAGCAGATGATAAAGTAGGG - Intronic
1052477073 9:28973425-28973447 AATCCCCACATGTCAAAGACAGG + Intergenic
1052552169 9:29966126-29966148 AATCACCACATGTCAGGGAAGGG - Intergenic
1052742620 9:32408108-32408130 TTTGACCAGATTTCAAGGAATGG - Intronic
1056326444 9:85483395-85483417 ATCCACCAGATGTCAGCAAAGGG - Intergenic
1057441913 9:95089552-95089574 CTTCAGCAGATGTCAACGAAGGG - Intergenic
1057990104 9:99759745-99759767 TTTCAGCAGAGGTCCAAGAAAGG - Intergenic
1058993139 9:110273906-110273928 ATTTACCAGTTGTCATGGAATGG - Intergenic
1059178734 9:112191925-112191947 AATCCCCACATGTCAAGGAAGGG - Intergenic
1059515844 9:114894407-114894429 ATTAACAAGATGTGAATGAAGGG + Intronic
1059626424 9:116071987-116072009 ATTCAGCAGATAACTAAGAATGG - Intergenic
1060327854 9:122634646-122634668 AATCACCACATGTCAAGGGAGGG - Intergenic
1060593743 9:124835373-124835395 ATTCCCCAGAGGTCAAAGTCTGG - Intergenic
1060900587 9:127254053-127254075 ACCCACCAGATGCCAATGAAAGG - Intronic
1060954079 9:127625372-127625394 ATTAACCAGATCTTGAAGAATGG + Intronic
1203582373 Un_KI270746v1:21773-21795 ATTCAAAAGATGTCAAACACAGG + Intergenic
1186257795 X:7741487-7741509 ATCCACTACATGTCACAGAATGG - Intergenic
1186897980 X:14024067-14024089 ATCCACCAGATGGCTAAGAGAGG + Intronic
1186900096 X:14045288-14045310 ATTTACCAGTTGTCATAGATTGG + Intergenic
1187105556 X:16237920-16237942 AATCACCAGGTTTCAAATAAAGG + Intergenic
1188305596 X:28557386-28557408 AATCCCCATGTGTCAAAGAAAGG - Intergenic
1189140694 X:38602587-38602609 TTTAACCAGTAGTCAAAGAAAGG + Intronic
1190246297 X:48692758-48692780 ATTCACCAGATTTCAGAAATCGG - Intergenic
1190567896 X:51749790-51749812 ATGCCCCAAATGTGAAAGAAGGG - Intergenic
1190759521 X:53427986-53428008 ATCCACCTGATCCCAAAGAAAGG - Exonic
1190953426 X:55168853-55168875 ACTCACAAGTTCTCAAAGAATGG - Intronic
1190995440 X:55603903-55603925 CCTCACCAAATGTAAAAGAATGG - Intergenic
1191119987 X:56893415-56893437 ACTCAGCAAATGTAAAAGAATGG + Intergenic
1193445933 X:81602575-81602597 CCTCACCAAATGTAAAAGAATGG - Intergenic
1193705141 X:84812415-84812437 CTTCAGCAAATGTAAAAGAATGG - Intergenic
1195300024 X:103520017-103520039 ATTCATGAGATGTCAAAAACTGG + Intergenic
1195386693 X:104320310-104320332 ATACAACAGTTGTCAAAAAAAGG + Intergenic
1195481437 X:105350296-105350318 ATTCACCAGTTGCCAAACTATGG + Intronic
1195565298 X:106333117-106333139 AATCACCACATGTCAAGGGAGGG + Intergenic
1195787028 X:108537152-108537174 ATTAACCAGATGTCAAACTGGGG + Intronic
1196318225 X:114255091-114255113 AATCTCCACATGTCAAAGGAGGG + Intergenic
1197346784 X:125333858-125333880 AATCCCCACATGTCAAGGAAGGG - Intergenic
1197692386 X:129515774-129515796 TTTCACCAGATGTGAAAGGGGGG - Exonic
1197921712 X:131601627-131601649 AATCCCCACATGTCAAGGAAGGG - Intergenic
1199024930 X:142925414-142925436 ATTCAGCAGATGTCAATGGTTGG + Intergenic
1199908907 X:152263147-152263169 AATCCCCACATGTCACAGAAGGG - Intronic
1201069287 Y:10129735-10129757 ATACACCAGCTGTGAAAGATGGG - Intergenic
1201665549 Y:16449495-16449517 AATCCCCACATGTCAAAGGAGGG - Intergenic