ID: 973150899

View in Genome Browser
Species Human (GRCh38)
Location 4:46887219-46887241
Sequence TATCCCACCCTAAAGGGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 38}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973150895_973150899 -6 Left 973150895 4:46887202-46887224 CCATTGAAAGATACTAGTATCCC 0: 1
1: 0
2: 0
3: 8
4: 98
Right 973150899 4:46887219-46887241 TATCCCACCCTAAAGGGTATGGG 0: 1
1: 0
2: 0
3: 5
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973150899 Original CRISPR TATCCCACCCTAAAGGGTAT GGG Intronic
905386128 1:37605562-37605584 AACCACACCCTAAAGGGTATTGG - Intergenic
906648606 1:47494030-47494052 TATCCAGCCCTAAATGCTATAGG - Intergenic
909169690 1:72280358-72280380 ATTTCCACCCTAAAGGGTTTAGG - Intronic
1065339913 10:24695222-24695244 TAGCCCACACTCAAGGGTAGGGG - Intronic
1071271849 10:84014825-84014847 TAACCCACCCTACAGTATATAGG + Intergenic
1087149091 11:94842440-94842462 AGGCCCACCCTAAAGGCTATAGG - Intronic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1091306977 11:134542601-134542623 TATCCCGCCCTTCCGGGTATAGG + Intergenic
1094676911 12:32629182-32629204 GATCACACCTTAAAGGGAATTGG + Intronic
1103381543 12:120497335-120497357 TCTCCCACCCTAAGAGGTACTGG - Intronic
1104001431 12:124863290-124863312 TGACCCGCCCTAAAGGGTCTGGG - Intronic
1105996110 13:25673670-25673692 TATCCCACCCAAACAGCTATTGG + Intronic
1114781747 14:25545947-25545969 TATCACACCCTGCAGGATATGGG - Intergenic
1137703384 16:50515672-50515694 TATCCCACCCAAGAGAGTAGGGG - Intergenic
1147631050 17:41931878-41931900 CATCCCACCCTAAGGGGATTGGG + Intronic
932929520 2:76017424-76017446 TATCACAACTTAAAGGCTATTGG - Intergenic
932980815 2:76663614-76663636 TATTCCACCCACATGGGTATAGG + Intergenic
939060680 2:137418375-137418397 TATCCCATTCTAAGGGGTCTGGG - Intronic
941907985 2:170735452-170735474 TATCAGACCCTAAAGGATACCGG - Intergenic
1169647192 20:7825562-7825584 TATTCCACCAGAAAGAGTATTGG + Intergenic
1171802950 20:29644009-29644031 CATCCCTCCCTCCAGGGTATAGG - Intergenic
1174900391 20:54493476-54493498 TATCCCAGTCTAAATGGTAGGGG + Intronic
1182317428 22:29457338-29457360 GATCCCACCCTGAAGGATATGGG + Intergenic
955837226 3:63069428-63069450 TTTCCAATCCTAAAGGGCATGGG + Intergenic
961141487 3:124560133-124560155 TAACCCACCCTAGAGGGAAGTGG + Intronic
965921623 3:173923384-173923406 TACCCCACCCTAAAATGAATTGG + Intronic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
972805025 4:42520645-42520667 ACTCCCACCCTAAATGTTATAGG - Intronic
973150899 4:46887219-46887241 TATCCCACCCTAAAGGGTATGGG + Intronic
974869953 4:67629304-67629326 TATCCCCCCATAAAGGTTATGGG + Intronic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
980842208 4:138277593-138277615 CATCCCTCCCTAAAGTGTTTGGG + Intergenic
982619645 4:157688373-157688395 TCTCCCTCTCTGAAGGGTATTGG + Intergenic
987520645 5:18978869-18978891 TATTCCACCCTAAACGGTGAAGG - Intergenic
989751492 5:44899657-44899679 TTTCGCACCCTGAAGGGTAAAGG + Intergenic
993556409 5:89345234-89345256 TACCCCACCCTGAAAGGTATAGG + Intergenic
1006601933 6:35231993-35232015 AATCACACCCTAAAGGATCTAGG + Intronic
1010022782 6:71180401-71180423 TATCTGACCTTAAAGGTTATTGG - Intergenic
1011776154 6:90733018-90733040 TAGCCCATCCTAGTGGGTATGGG + Intergenic
1023847064 7:44128330-44128352 TAACCAACCCTACAGGGTGTAGG - Intergenic
1046018251 8:108632128-108632150 TATCCCAGCCTAGAGAATATTGG + Intronic
1046262034 8:111781099-111781121 AATCCCTCCCCAAAGGGCATTGG - Intergenic
1189052532 X:37661535-37661557 TATCCCCACCTCAAGGGTATTGG + Intronic
1195213248 X:102670721-102670743 TGTGCCACCCTAAAAGGCATTGG - Intergenic