ID: 973151960

View in Genome Browser
Species Human (GRCh38)
Location 4:46899112-46899134
Sequence GAGGAGAAGGATAATGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 421}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973151960 Original CRISPR GAGGAGAAGGATAATGAGTT GGG (reversed) Intronic
900697822 1:4023149-4023171 GAGGAGAAGGAAAGTCACTTTGG + Intergenic
901147513 1:7076111-7076133 GAGGATAAGGATAATGCATCAGG + Intronic
901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG + Intronic
901755986 1:11441879-11441901 GAGGAGGAGGAAAATGAGGGAGG + Intergenic
902267708 1:15280066-15280088 GATGAGAAGGACACAGAGTTGGG + Intronic
903579229 1:24358447-24358469 GAGGAGACCGATCATGAGTGTGG - Exonic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904341941 1:29841177-29841199 GAGGAGAAGCATAAGGTGATTGG - Intergenic
904372398 1:30058119-30058141 GAGGAGATGGAGAATGAATGAGG - Intergenic
904833824 1:33322268-33322290 GAGGAGGAGGATGCTGAGATTGG - Intergenic
905584530 1:39106030-39106052 GAGGAGGAGGAGGAGGAGTTGGG + Intronic
906011387 1:42530199-42530221 GAGGTGAAGGTGAATGACTTAGG - Intronic
906491986 1:46275691-46275713 GAGTAGAAAGAAGATGAGTTAGG - Intronic
906502441 1:46351430-46351452 GAGGAAGAGGAGAATGATTTTGG + Intronic
906745774 1:48221328-48221350 GAGGAGAGGGATATTGATCTGGG - Intergenic
908230900 1:62103951-62103973 GAGGCAAAGGATTATGAGCTAGG - Intronic
908349165 1:63267111-63267133 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
909938083 1:81577563-81577585 GAGGCGAAGGCTTAAGAGTTAGG - Intronic
910174495 1:84414494-84414516 GAGGAGAAAGATAGTGAGGTTGG - Intronic
910928135 1:92417127-92417149 GAGAAGAAGGAAAATAAGTCTGG + Intergenic
911659219 1:100481320-100481342 AAGGATAAAGATAAAGAGTTCGG + Intronic
911804260 1:102185737-102185759 GAAGAGAGGGATAATCAGTATGG - Intergenic
912109349 1:106321036-106321058 GAGGAGGAGGATAAGGATTGGGG + Intergenic
914387827 1:147188941-147188963 GAGAAGAAGGAAAATGAAGTTGG + Intronic
914684047 1:149962364-149962386 TAGGAGGAGGATAATGAACTGGG - Intronic
915508365 1:156371672-156371694 GAAAAGAAGGATAGAGAGTTGGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915976684 1:160395664-160395686 CTGGAGAAGGCGAATGAGTTGGG + Intergenic
916379318 1:164191050-164191072 GAGGAGATGGAGAAAGAGATAGG + Intergenic
916484243 1:165243995-165244017 GAGGTGAAGGATTAGGGGTTAGG - Intronic
916485321 1:165253696-165253718 GAGGAGAAGCATATCGAGATAGG - Intronic
917046603 1:170867397-170867419 GAGAAGCAGGATACTGAGATAGG - Intergenic
917249728 1:173045041-173045063 GAGGGGAACAATGATGAGTTTGG + Intronic
918342060 1:183576155-183576177 GAAGAGAAGGATTATAAGTAGGG + Intronic
919331600 1:196179268-196179290 GAGGAGGAGGATGAGGAGTAAGG - Intergenic
920971657 1:210748413-210748435 GAGGAGAGGGATTATGGTTTGGG - Intronic
921536308 1:216352871-216352893 GAGGATCAGGATAATGAGAAAGG + Intronic
921734505 1:218612007-218612029 GAGGAGAAGGAGAAGGGGGTAGG - Intergenic
922196092 1:223362206-223362228 GAGGAGAGGTGTAATAAGTTGGG - Intronic
922331696 1:224582605-224582627 GGAGAGAAGGAGTATGAGTTTGG + Intronic
922353001 1:224750164-224750186 TAGGGGAAAGATAATGTGTTCGG + Intergenic
922434988 1:225595652-225595674 GAGCAGTAGGATCATGATTTGGG - Intronic
922595044 1:226807076-226807098 GAGGAGAGGGAGAATCATTTGGG + Intergenic
924376436 1:243414191-243414213 GAGGGGAAGAATTTTGAGTTAGG + Intronic
924866518 1:247987790-247987812 TGGGAGAAGGGTAATGAGTTTGG - Intronic
1062882101 10:987721-987743 GAGGAGAAGGTTGATGAGGATGG - Intergenic
1063802155 10:9592477-9592499 GAGGAGAAGAATAATCACTGTGG + Intergenic
1063889080 10:10610999-10611021 GGGGATGAGGCTAATGAGTTTGG + Intergenic
1064782357 10:18856609-18856631 GAAGAGAAGGACAAGGAATTGGG - Intergenic
1066209190 10:33220268-33220290 GAGGAGAATGATACCGACTTTGG - Intronic
1066511308 10:36099768-36099790 AAGGAGAAGGAAAATGATATAGG + Intergenic
1067545313 10:47188463-47188485 GAGGAGAAGGAGAAGGAAGTGGG + Intergenic
1069859664 10:71462428-71462450 GAGGAGAAGGAGGAAGAGTGGGG + Intronic
1070906335 10:80076762-80076784 GAGGAGAAGAATAAAGAGGGTGG + Intergenic
1071140967 10:82509099-82509121 GGGGATATGGAGAATGAGTTTGG - Intronic
1071259942 10:83910587-83910609 GAGGAGATAATTAATGAGTTGGG - Intergenic
1071397643 10:85239011-85239033 AAGGAAAAGGTTAATGAGTGCGG - Intergenic
1072529338 10:96304090-96304112 GAGGAGAATGCAAGTGAGTTGGG + Intergenic
1073508416 10:104023936-104023958 AAGGAAAAGGATGCTGAGTTTGG - Intronic
1074553734 10:114469321-114469343 GAGGTGAATGATAGTGAGATTGG - Intronic
1074553736 10:114469345-114469367 GAGGTGAATGATAGTGAGATTGG - Intronic
1074679583 10:115890862-115890884 GATGAGAAGAATATTCAGTTTGG + Intronic
1077017806 11:404653-404675 GAGGAGAAGGCTAATGACGGAGG + Exonic
1077856327 11:6129801-6129823 GAGGATAGGGAAACTGAGTTGGG + Intergenic
1078184706 11:9041864-9041886 GAGGAGAAGAATTCTGAGATGGG + Intronic
1078396777 11:10988481-10988503 GAGGAGAGAGATAATGGGCTAGG + Intergenic
1078706430 11:13748254-13748276 GAGGAGAAGGATGAGGATTGGGG - Intergenic
1079911133 11:26311596-26311618 GAGGAGAAGGATAAGTTGCTAGG + Intronic
1080672534 11:34394676-34394698 GAGGAGAAGGACCATCAGCTGGG + Intergenic
1081754011 11:45531915-45531937 GAGTAGAAAGAGTATGAGTTAGG - Intergenic
1081831861 11:46121373-46121395 GAGGAGGAGGATGAAGAGTTGGG - Intergenic
1082757210 11:57089634-57089656 TAGGAGATGGACAATGAGTGTGG + Intergenic
1082780710 11:57285462-57285484 GAAGGGAAGGATAATGCCTTTGG + Intergenic
1082995201 11:59248691-59248713 GAGGATCAGGATAAGGAATTTGG - Intergenic
1083002104 11:59301981-59302003 GAGGATCAGGATAAGGAATTTGG - Intergenic
1083319678 11:61838109-61838131 GAGGAGAAGGAAAATGAAACTGG - Intronic
1083952704 11:65965714-65965736 GAGGAGATGGACCAAGAGTTTGG + Exonic
1085073209 11:73567331-73567353 AGGGAAAAGGATAACGAGTTCGG + Intronic
1085762309 11:79252629-79252651 GAGGAGAAGGGTGAAGAATTAGG - Intronic
1085993529 11:81881612-81881634 AAAGAAAAGGATGATGAGTTTGG - Intergenic
1086340483 11:85843498-85843520 GGGGTGGAAGATAATGAGTTTGG + Intergenic
1086954728 11:92924361-92924383 GAGCAGAAGGAAAGAGAGTTGGG - Intergenic
1087986312 11:104685308-104685330 AAGGAGAAGGAAAAGGACTTTGG - Intergenic
1088072315 11:105803984-105804006 GAGGAGAAGAATGAGGAATTTGG + Intronic
1088361847 11:108999798-108999820 GAGGAGATGGAGAAAGAGATAGG - Intergenic
1088592124 11:111412902-111412924 GGGGAGAAGGAAAATGGGTTGGG + Intronic
1088750715 11:112840087-112840109 GAGCAGAAGGAAGATGAATTAGG + Intergenic
1088944313 11:114494293-114494315 GAGGAGGTGGATAACGAGATAGG - Intergenic
1089111118 11:116057491-116057513 GGGGAGGAGGAGAATGAGGTTGG + Intergenic
1090220092 11:125012649-125012671 GGGGATAAGGATGGTGAGTTAGG + Intronic
1090423988 11:126594431-126594453 TAGGAGAAAGAACATGAGTTTGG + Intronic
1091105832 11:132919094-132919116 AAGTAGATAGATAATGAGTTGGG + Intronic
1093209442 12:16290272-16290294 GGTGAGATGGATAAAGAGTTAGG + Intergenic
1093819387 12:23594743-23594765 AAGGAGAATGATAAAGAGTCAGG - Intronic
1094241238 12:28227546-28227568 GAGGTGTAGAATAATTAGTTTGG - Intronic
1095716963 12:45356664-45356686 GAGGAGGAGGAAAAAGAGTAGGG + Intronic
1096113512 12:49042160-49042182 TGGGAGAAGGATGAGGAGTTGGG - Exonic
1096160000 12:49367927-49367949 GATGAGAAGTACAATGAATTAGG + Intronic
1097170130 12:57108101-57108123 AAGGAGAAGGAAGATGAGTTAGG + Intronic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1098754170 12:74337142-74337164 GTGGAGAAGGAAAATGTGGTAGG + Intergenic
1100953436 12:99878639-99878661 GAAGTGAAAGATAATGAGATGGG - Intronic
1102536761 12:113587697-113587719 AAGGAGAAGGAAAAGGAGTGGGG - Intergenic
1102621782 12:114201901-114201923 TAGGAGCAGGATCAGGAGTTAGG + Intergenic
1102822962 12:115923841-115923863 GAGGAGAAGGAGAAGGGGGTGGG - Intergenic
1103113411 12:118303221-118303243 GAGGAGGAGGATAAGGAATGGGG - Intronic
1103317280 12:120066338-120066360 GAGGAGAAGGAAAATAAGTATGG + Intronic
1104471651 12:129034415-129034437 GAGGAACAAGAAAATGAGTTTGG - Intergenic
1106189672 13:27440156-27440178 GATGAGAAGGGCAATGATTTGGG - Exonic
1106553097 13:30788301-30788323 AAGGACAAGGATGATGAGTAGGG + Intergenic
1109295733 13:60528219-60528241 AAGGAGTAAGATAATGAGGTAGG + Intronic
1113441801 13:110334956-110334978 GAGGAGGAAGATAAAGAGCTGGG + Intronic
1113862230 13:113494595-113494617 GAAGAGAAGGAGACTGAATTGGG + Intronic
1115896248 14:38090978-38091000 CATGAGAAGAGTAATGAGTTTGG + Intergenic
1117028021 14:51641601-51641623 GAGGTGAAGGATCATGTCTTTGG - Intronic
1119135019 14:72209760-72209782 GAGGACAAGGATCATGATTTAGG - Intronic
1119584612 14:75821684-75821706 GAGATGAAAGATGATGAGTTCGG + Intronic
1119730599 14:76948601-76948623 GGGCAGAAGGATAAAGAGGTCGG + Intergenic
1119895938 14:78220155-78220177 GAGGAGGAAAACAATGAGTTTGG + Intergenic
1120193981 14:81463372-81463394 GAGGAGAAGGACAATTAGGAGGG - Intergenic
1120262834 14:82209261-82209283 GAGGAGGAGGAGAAAGAGGTGGG + Intergenic
1120953699 14:90063391-90063413 CAGCAGAAGGAAAATGATTTGGG + Intronic
1121901813 14:97699512-97699534 GAGTAGAAAGATAAGGAGATTGG + Intergenic
1122571243 14:102703883-102703905 GAGGTGAAGAAGAATGGGTTGGG - Intronic
1122594764 14:102882234-102882256 GCACAGAATGATAATGAGTTTGG + Intronic
1122853578 14:104549053-104549075 GAGGAGGAGGAAGAGGAGTTGGG + Intronic
1125146706 15:36478454-36478476 TAGAAAAAGGATAATGACTTTGG + Intergenic
1127067654 15:55257200-55257222 GAAGGGAAGGATGATGAGATTGG + Intronic
1128304121 15:66586951-66586973 GAGGAGAAGGAGGAAGAGTGGGG - Intronic
1128370532 15:67036004-67036026 GAGGAGAAGGGAAGTGAGGTGGG - Intergenic
1128372510 15:67050578-67050600 GAGGAGGAAGATAATGTGTGGGG + Intergenic
1129007371 15:72385103-72385125 GGGGAGGGGGAGAATGAGTTGGG - Intergenic
1131862921 15:96673991-96674013 GAGCAGAAGGCAAAAGAGTTAGG - Intergenic
1132039430 15:98512603-98512625 GAGGAAAAGGATAATCTTTTGGG - Intronic
1132192618 15:99881052-99881074 GAAGAGATGGATAATAAGTTAGG - Intergenic
1133506669 16:6418938-6418960 GAGCAGAAGGAAAGTGATTTTGG + Intronic
1134161633 16:11895109-11895131 AAGGAGAAGGGTAATGAACTAGG - Intronic
1135153909 16:20035773-20035795 GGGGAGAAGTATGAAGAGTTGGG + Intronic
1136507148 16:30711969-30711991 GAGGAGGAAGATGATGATTTTGG + Exonic
1137540932 16:49361141-49361163 GAGGAAAAGGCTAAGGGGTTGGG - Intergenic
1137815540 16:51394599-51394621 GAGGAGAAGGTTAGTGTGTTGGG - Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138381546 16:56606355-56606377 GGAGAGAAGGATAATGACTCAGG - Intergenic
1138722210 16:59095605-59095627 GAGAATAATGATAATGGGTTGGG - Intergenic
1139102944 16:63790072-63790094 GAGGAGAGGGATAAAGAGAGAGG + Intergenic
1139279418 16:65757315-65757337 CAGGAAAAGGATATTGTGTTTGG - Intergenic
1140269150 16:73447340-73447362 GAAGAGTAGGACAATGATTTTGG + Intergenic
1140583370 16:76257238-76257260 GGAAAGAAGCATAATGAGTTGGG - Intergenic
1140842759 16:78856205-78856227 GAGGAAAATGATAAGGATTTAGG + Intronic
1140962630 16:79931223-79931245 GAGGAGATGGAAGATGAGTCGGG - Intergenic
1143529871 17:7496548-7496570 GAGGAGATGGACAACAAGTTCGG + Exonic
1143958668 17:10696684-10696706 TACGGGAAGGTTAATGAGTTAGG - Intronic
1144056932 17:11551597-11551619 GAGGAGAAGGATGGAGAGTAGGG - Intronic
1146455229 17:33004456-33004478 GAGGAGAAGGGGAATGGTTTGGG + Intergenic
1149107184 17:52983528-52983550 GAGGAGAAGGATTATGGGGCAGG + Intergenic
1149404014 17:56328723-56328745 AAGGGAAAAGATAATGAGTTTGG - Intronic
1149534428 17:57421531-57421553 GAGGAGGAGGAGAATGAATGGGG - Intronic
1149982607 17:61323274-61323296 GAGGAGAAGAATAATCAGAACGG - Intronic
1150557178 17:66264834-66264856 GAGAAGAATGAGAATGAGTGGGG - Intergenic
1151783138 17:76260934-76260956 GAGGAGAAGGAGAATGGGAAAGG - Intergenic
1152914972 17:83029708-83029730 GTGGAGGAGGATTGTGAGTTAGG - Intronic
1153549131 18:6242386-6242408 GAGGAGAAGGATAATGGCGGTGG - Intronic
1154108244 18:11543607-11543629 GAGGAGAAGGAATATGAATCTGG - Intergenic
1155151259 18:23124807-23124829 GAGGAGAAGGAAAATGCCCTTGG - Intergenic
1155512711 18:26593758-26593780 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155512724 18:26593816-26593838 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1156449291 18:37257867-37257889 AAGGAGAAGGATGAGGAGGTCGG + Intronic
1156694637 18:39752487-39752509 GAGGACAAGAACAATGAGCTGGG - Intergenic
1156835757 18:41552426-41552448 GAGAAGAAGGTTAAAGACTTGGG + Intergenic
1157137973 18:45076125-45076147 AAGGAAAACAATAATGAGTTAGG + Intergenic
1157434667 18:47658275-47658297 GAGGAGAGAGATAATGACTGTGG + Intergenic
1158308079 18:56128223-56128245 GAGAGGAAGGAGACTGAGTTTGG - Intergenic
1158320772 18:56260391-56260413 AAAAAGAAGAATAATGAGTTGGG + Intergenic
1158963469 18:62604811-62604833 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1159513393 18:69426254-69426276 GAGAGGAAGGAAAATGTGTTTGG - Intronic
1160348800 18:78156297-78156319 GAGGAGAACGAGATTGATTTGGG - Intergenic
1161476150 19:4486740-4486762 GAAGAGGAGGATGAAGAGTTAGG - Intronic
1161842945 19:6693700-6693722 GAGGAGAAGGATATTGAGGGTGG + Intronic
1162101269 19:8340676-8340698 GTGGAGTAGGGTAATGAGTCAGG - Intronic
1162199274 19:9009183-9009205 GAGGAGATCTATAATGAGCTGGG - Intergenic
1164249930 19:23467535-23467557 GAGGAGAAGGAGGAGGAGTGGGG - Intergenic
1164972248 19:32542560-32542582 GAGGAGAAAGAGAATGAAGTAGG + Intergenic
1166335878 19:42106863-42106885 GAGGAGAAGGAAAATTAGCCAGG + Intronic
1166404188 19:42507709-42507731 GAGGAGGAGGATTATAACTTAGG - Exonic
1166652131 19:44582648-44582670 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1167423836 19:49419291-49419313 AAGGAGAAGGATCACGAGATTGG + Intergenic
1168103540 19:54153521-54153543 CAGGAGAAGGAAAATGAGACAGG - Intronic
1168144536 19:54413487-54413509 GAGGAGGAGGATAGTGATATTGG - Intergenic
1168303518 19:55420525-55420547 TGTGAGAAGAATAATGAGTTTGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926763099 2:16296949-16296971 GACACGAAGAATAATGAGTTGGG - Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
926885508 2:17594784-17594806 GAGGAGCAGGATAATGGGAGTGG + Intronic
927144497 2:20153687-20153709 GAGGAGAATGAGAGTGAGATCGG + Intergenic
927222268 2:20724208-20724230 GAGGAGAAGATGAATGAATTTGG - Intronic
928700226 2:33891520-33891542 GAGGATAAGGAAAATAAGTATGG + Intergenic
929124359 2:38509822-38509844 CAGGAGAAGGGTAATGACCTGGG - Intergenic
930199815 2:48542251-48542273 GAGGAGAAGGCCAATGACTATGG - Intronic
930840573 2:55840835-55840857 GGGGAGAAAGATAATGGGTTTGG - Intergenic
932143216 2:69297486-69297508 AAGGAGAAGGAAAATGTGTGTGG - Intergenic
932454710 2:71841928-71841950 CAGGAGAAAGATGATGAGTAGGG - Intergenic
933856666 2:86420727-86420749 GAGCAGCAGGAAGATGAGTTGGG - Intergenic
934133300 2:88970307-88970329 CAGGAGATGGATAGTGAATTTGG + Intergenic
934969161 2:98749142-98749164 TTGGAGAAAGATGATGAGTTTGG - Intergenic
935568480 2:104634686-104634708 GAGCAGGAGGATCATGAGATCGG + Intergenic
935868069 2:107413516-107413538 TAGTAGAAGGAAAATGAATTAGG + Intergenic
936536720 2:113317906-113317928 GAGGAGACAAACAATGAGTTTGG - Intergenic
936779814 2:116018525-116018547 AAGGAGCAGAATGATGAGTTGGG + Intergenic
937600642 2:123727341-123727363 GAGGAGGAAGAAAATGAGATTGG + Intergenic
938135295 2:128751896-128751918 GGGGAGAGGGAGAATGACTTGGG - Intergenic
939370053 2:141287234-141287256 GAGGAGAATGAGAATGAGAATGG - Intronic
940761234 2:157741678-157741700 GAGGAGCAGAATAATGAGAAAGG + Intronic
941144772 2:161831131-161831153 GAAGATGAGGCTAATGAGTTAGG + Intronic
941544668 2:166833987-166834009 GAAGAGAAGATTTATGAGTTAGG - Intergenic
941801654 2:169666112-169666134 GAAGAGGAGGATGATGAATTTGG - Intronic
942579405 2:177401204-177401226 GAGAAAGAAGATAATGAGTTAGG - Intronic
942589513 2:177527019-177527041 GAGGACAAGGATACTGAGGCAGG - Intronic
943898879 2:193406380-193406402 TAGTAAAAGGATAATAAGTTGGG + Intergenic
944141429 2:196461028-196461050 GAGGAGACAGAGAGTGAGTTGGG - Intronic
944155266 2:196600947-196600969 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
944388759 2:199194931-199194953 GAGGAGGAGGAGAATGAGCAGGG - Intergenic
945543290 2:211116254-211116276 GAAGAGAATGATATTGATTTAGG + Intergenic
945944856 2:215985308-215985330 GAACATAAGGATAATGATTTAGG + Intronic
946402515 2:219475978-219476000 GAGGAGAAGTAGGATGAGTCAGG - Intronic
946431317 2:219628447-219628469 GAGGAGGAGGACGATGACTTGGG + Exonic
946532366 2:220585255-220585277 GAGAAAAATGATAATGAGATGGG + Intergenic
946539249 2:220665804-220665826 GAGGAGAGGGATAAAGAGGTTGG - Intergenic
946970307 2:225083587-225083609 GAGGAGAAGGATGCAGAGGTAGG + Intergenic
946983885 2:225249562-225249584 CAGGAGAAGGAGAATGAACTGGG + Intergenic
948713739 2:239844473-239844495 GAGCAGACTGATAATGAGTGAGG - Intergenic
948939224 2:241187826-241187848 GAGGAGGAGGAGGAGGAGTTGGG + Intergenic
1169069260 20:2712511-2712533 GAGGAGAAAGATCTGGAGTTTGG + Intronic
1169486093 20:6034079-6034101 GGGTAAAAGGGTAATGAGTTAGG - Intronic
1169561215 20:6802838-6802860 GAGGAGAAGGAGAAGGAGAACGG - Intergenic
1169596595 20:7206819-7206841 AAGGAGAAAGTTCATGAGTTTGG + Intergenic
1170051496 20:12150538-12150560 GAGAAGAAGGAGAATCAGTAGGG + Intergenic
1170311474 20:14997151-14997173 AAGGAGAAGGAAAAGGAGTGGGG + Intronic
1171032897 20:21692923-21692945 GATGAAAAAGATAAGGAGTTTGG - Intergenic
1172044076 20:32067000-32067022 GAGCAGCAAGATAATGAGTTGGG - Intronic
1172856632 20:38009352-38009374 GAGGAGCAAGAGAAGGAGTTTGG - Intronic
1172956561 20:38763841-38763863 GAGGAGGAGGAAGATGGGTTGGG - Intronic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1182332306 22:29559960-29559982 CAGGAGAGGGGGAATGAGTTGGG - Intronic
1182806159 22:33072282-33072304 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
1184670392 22:46009283-46009305 GAGGAAAAGTATGATGAGCTTGG - Intergenic
949369157 3:3316311-3316333 GAGGAGAAGGAGGAAGAGATAGG - Intergenic
949835923 3:8269948-8269970 TAGGAAAAGGACAATAAGTTGGG - Intergenic
949879935 3:8653241-8653263 GAGGACAATGAAAGTGAGTTTGG - Intronic
950356008 3:12409887-12409909 CAGGAGAAGGAAGATTAGTTGGG - Intronic
950729987 3:14948243-14948265 GAGGAGGAGGATAAGGAGGAAGG - Intronic
951054633 3:18133443-18133465 GAGGGGAAAGACCATGAGTTTGG + Intronic
951597198 3:24331230-24331252 GAGGAGTAGACTTATGAGTTTGG - Intronic
951663725 3:25098835-25098857 GAGGAGGAAGATAATATGTTAGG - Intergenic
951751795 3:26044207-26044229 GAGAAGGTGGAGAATGAGTTTGG - Intergenic
952002140 3:28798254-28798276 GAGCAGAAGCCTAGTGAGTTAGG + Intergenic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
952505065 3:33999760-33999782 GCTGAGAGGGATAATGAGGTGGG - Intergenic
952715369 3:36474521-36474543 GAGGAGAAGGGAAGTGAGCTGGG + Intronic
953618815 3:44514807-44514829 GAGGAGGAAGATAAAGAGTAGGG - Intergenic
954043357 3:47907504-47907526 TATGGGAAGGATAATGGGTTTGG - Intronic
954152028 3:48662563-48662585 GAGGAGAAGGAGCAGGAGTATGG + Exonic
954154093 3:48675226-48675248 GATGGGAAAGATCATGAGTTTGG - Intronic
955020907 3:55120205-55120227 GAGGAGTATGAAAATGAGTATGG + Intergenic
956238668 3:67104657-67104679 CAGGAGCAGGATAATGAGTTTGG + Intergenic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957559399 3:81802951-81802973 AAGGAGTAGGGGAATGAGTTGGG - Intergenic
960129827 3:114043980-114044002 GAGGAGGAAGATTAGGAGTTCGG + Intronic
960156087 3:114298361-114298383 GAAGATTATGATAATGAGTTTGG - Intronic
960826344 3:121789098-121789120 GAGGGGTAAGATAATGACTTTGG + Intronic
962193763 3:133338106-133338128 GAGGAGATGGAGAAAGAGATGGG + Intronic
962498405 3:135965681-135965703 GAGGAGGAGGAGAAGGAGGTAGG + Exonic
962842835 3:139251426-139251448 GAGGAGAAGGAAATGGAGTTGGG - Intronic
963721219 3:148864432-148864454 GAAGAGAAGGGCAAAGAGTTAGG + Intergenic
964741658 3:159972753-159972775 GAGGAAGAGGTTAATGATTTGGG - Intergenic
965697876 3:171428181-171428203 AAGGAGAAGGGAGATGAGTTCGG + Intronic
966544651 3:181132057-181132079 AAGGGAAAAGATAATGAGTTTGG + Intergenic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
968359929 3:198139690-198139712 GGGGAGAAGGAGGAGGAGTTGGG + Intergenic
968424614 4:514185-514207 AAGGAGAAGGGAAATGAGTGTGG - Intronic
970118949 4:12731284-12731306 GGGGAGAGGGAGAATGGGTTGGG - Intergenic
970642617 4:18084281-18084303 GAGGAGAAAGCTCAGGAGTTTGG - Intergenic
971244410 4:24915098-24915120 GATTAAAAAGATAATGAGTTAGG - Intronic
971340902 4:25767682-25767704 GAGGTTAAGGATAATGAATTGGG - Intronic
972532083 4:39970484-39970506 GAAGAGAATGAGAGTGAGTTTGG - Intronic
972837340 4:42889001-42889023 GAGGAGAGGGAAAAAGACTTGGG - Intergenic
972884994 4:43474945-43474967 GAGGAGATAGAAAATGAGATGGG - Intergenic
973151960 4:46899112-46899134 GAGGAGAAGGATAATGAGTTGGG - Intronic
973700826 4:53535318-53535340 AAGGAGAAAGATAATGACTACGG - Intronic
973909974 4:55570424-55570446 GAGGAGAGTGATTATGAGCTTGG + Intronic
973989541 4:56390163-56390185 TAGGAGAGGAATACTGAGTTTGG - Intergenic
974193864 4:58543316-58543338 GAAGAGAAAGAAAATGTGTTTGG + Intergenic
974913482 4:68150524-68150546 GAGGAGAATGAAAAAGACTTGGG - Intergenic
975594118 4:76031445-76031467 GTGGAGGAGGAAAATCAGTTGGG - Intronic
975857795 4:78642878-78642900 GGTTAGAAAGATAATGAGTTTGG - Intergenic
978350723 4:107818120-107818142 GAGGAGGAGGCTAATGAATAAGG - Intergenic
978701091 4:111647115-111647137 GAGGAGAAGGAGAGTGTGTCAGG + Intergenic
978798118 4:112728798-112728820 GAGCAGATTGATAATGAGTAAGG + Intergenic
979274906 4:118804370-118804392 GAGGAGAAAGACGATGAGATTGG + Intronic
979548639 4:121965107-121965129 GAAGAGAGTGATAATGAGTCAGG - Intergenic
979993591 4:127404729-127404751 GAGGAGGATGATTATGAGTTAGG + Intergenic
980238760 4:130144925-130144947 AAGGAGTAGGATAATGGTTTGGG + Intergenic
980652460 4:135736412-135736434 GAGCAGAAGTATAATCAGCTTGG + Intergenic
980875914 4:138661975-138661997 GAGGACTAGGAAAATGAGGTTGG - Intergenic
981025047 4:140069453-140069475 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025062 4:140069514-140069536 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981221119 4:142236291-142236313 CAGTAGAAGCATAAGGAGTTTGG - Intronic
982051149 4:151503630-151503652 TAAGAGAAAGAGAATGAGTTGGG - Intronic
982875667 4:160646416-160646438 GATGAGAAAGAAAATGAATTGGG - Intergenic
983898641 4:173108793-173108815 GAGGAGTAGATTAGTGAGTTAGG + Intergenic
984279333 4:177650122-177650144 TAGGAGAACGATCAAGAGTTTGG - Intergenic
985526305 5:404258-404280 GATGAGAAGGGCAATGATTTGGG - Intronic
987474533 5:18374629-18374651 GAAGAGAAGAAAAAGGAGTTAGG - Intergenic
989411903 5:41129210-41129232 GAGGAGAAGGAGAAGAAATTTGG - Intergenic
991483632 5:67111418-67111440 GAGGAGAAAGGTAGGGAGTTGGG + Intronic
991956320 5:71998806-71998828 GAGGAGAAGGAGGCTGAGGTAGG + Intergenic
992379826 5:76226207-76226229 GGGCAGAAGGAAAATGAGTTGGG + Intronic
992713766 5:79488348-79488370 GAGGAAAAGGATAGTGGATTGGG - Intronic
994491829 5:100457380-100457402 GATGATAATGTTAATGAGTTTGG - Intergenic
995323865 5:110869182-110869204 AAAGAGAAGGATAGAGAGTTTGG + Intergenic
996165745 5:120220734-120220756 GAGGAGGAGGAAAAGGAGGTGGG - Intergenic
997001485 5:129767110-129767132 GAAGAGAAAGGTAATGAGATGGG - Intergenic
997363053 5:133307284-133307306 GAGGAGAAGACCATTGAGTTGGG + Intronic
997899122 5:137747795-137747817 GAGTAGTAGGCTAAGGAGTTTGG - Intergenic
998107120 5:139475771-139475793 GAGGAGGAGGAGGCTGAGTTTGG - Intronic
998468370 5:142363972-142363994 GAGGAAAAGGATAAAGGGGTGGG + Intergenic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999913399 5:156231054-156231076 GAAGTGAAAGGTAATGAGTTTGG + Intronic
1000252847 5:159511558-159511580 GTGGAGAAGGAGCATGGGTTTGG - Intergenic
1002093640 5:176818376-176818398 TAGCAGAAGGAGAATGAATTTGG - Intronic
1002655647 5:180744605-180744627 TAGGGGGAGGATGATGAGTTCGG - Intergenic
1002972372 6:2036980-2037002 GAGGCGAAAGGTAATGAGGTAGG + Intronic
1003337330 6:5186164-5186186 GAGGAGAAGGGGAAAGAGCTGGG + Intronic
1003513463 6:6800393-6800415 AAGGAGAGGGAGAATGAGTGTGG - Intergenic
1005042498 6:21611764-21611786 GTGGAGAAGGATAATTAATTGGG - Intergenic
1005791565 6:29307877-29307899 AAGGAGAAAGACAATTAGTTTGG + Intergenic
1006427335 6:33974673-33974695 AGGGAGAAGGCTAATGTGTTTGG - Intergenic
1006834210 6:36986688-36986710 GAGGAGATGGAAAATGCGATCGG - Intergenic
1007650804 6:43419838-43419860 AATGAGAAGAATAATGATTTTGG + Intergenic
1009611643 6:65950318-65950340 AAGGAGAAGGAAAATGTGGTTGG - Intergenic
1009711244 6:67324475-67324497 GAGGAAAATGATAATAAGTCGGG + Intergenic
1009778210 6:68233702-68233724 GAGGAGAAGGACAGAGAGTGAGG - Intergenic
1010284170 6:74055701-74055723 GAGGAGAAAGAAAAGGAGATGGG + Intergenic
1011027137 6:82881404-82881426 GAGGAGGAGGATTATGAGGAGGG + Intergenic
1011112145 6:83850488-83850510 CAGGAAAAAAATAATGAGTTTGG - Intergenic
1011483222 6:87815852-87815874 GAGGAGGAAGAAAATAAGTTTGG + Intergenic
1012250039 6:96969918-96969940 GAAGAGAATGATGATGAATTTGG - Intronic
1012814447 6:104004344-104004366 GGGGAGAAGGATTCTGAGGTTGG + Intergenic
1012842585 6:104347786-104347808 GAGGAGAGGGGTAAAGAGTAAGG + Intergenic
1013141547 6:107341095-107341117 AAGGAGAAGGAAGATCAGTTAGG + Intronic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1015063392 6:128996209-128996231 CAGGAGAATGAGAAAGAGTTTGG + Intronic
1015159444 6:130136150-130136172 CAGAAGCAGGAAAATGAGTTTGG - Intronic
1015327420 6:131938623-131938645 GGGGAGAAAAATAAGGAGTTGGG + Intergenic
1016616302 6:146052464-146052486 GGGGAGAAGGATGGGGAGTTAGG + Intronic
1016627503 6:146189588-146189610 GAGGAGAATGTAAATGACTTTGG - Intronic
1018440970 6:163813061-163813083 CAGGAGTAGGAGAAAGAGTTGGG - Intergenic
1018477542 6:164158387-164158409 GAGGAGAAGATGAAAGAGTTTGG + Intergenic
1020779159 7:12496439-12496461 GAGAAGAAGGGAAAGGAGTTTGG - Intergenic
1021222843 7:17993081-17993103 GAAGAGGGGAATAATGAGTTTGG - Intergenic
1021923763 7:25514705-25514727 GAGAGTAAGGAGAATGAGTTTGG - Intergenic
1022091557 7:27110980-27111002 GGGGAGAAGGAGAATGAGTGAGG + Intronic
1022553996 7:31273185-31273207 GACAAGAAGGATAAGGAGTGGGG - Intergenic
1024104352 7:46067066-46067088 GAGGAGGAGGAAAAGGAGATGGG - Intergenic
1024161798 7:46683521-46683543 CAAGAAAAGGATAAGGAGTTTGG + Intronic
1024429223 7:49266530-49266552 GAGGAGGAGGAAAGAGAGTTTGG + Intergenic
1025770538 7:64501237-64501259 GAGGAGGAGGAAAATGTGCTGGG - Intergenic
1026467138 7:70663784-70663806 CTGTAGAAGGATCATGAGTTTGG + Intronic
1026574401 7:71560300-71560322 AAGGAGGAGGAGAATGAGATAGG - Intronic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1027853898 7:83484398-83484420 GAAGAGAAGGATAGTAAGCTAGG - Intronic
1028733232 7:94177450-94177472 GAATGGTAGGATAATGAGTTAGG + Intergenic
1028829355 7:95310578-95310600 GAGGATGAGGAAAATGAGATTGG - Intronic
1028933092 7:96436066-96436088 GAGGAATAGGAAATTGAGTTTGG + Intergenic
1029495546 7:100894167-100894189 GAGGAGGAGGAGAAGGAGTGGGG + Exonic
1029854976 7:103505719-103505741 AACGAGATGGAGAATGAGTTTGG + Intronic
1029958243 7:104662056-104662078 GAGTAGAATGATAATGTTTTGGG - Intronic
1030223994 7:107128458-107128480 CAGGAGAGGAATATTGAGTTTGG + Intronic
1030566931 7:111169270-111169292 GAAGGGAAGGAGAAAGAGTTGGG - Intronic
1030583075 7:111384174-111384196 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
1030781442 7:113605504-113605526 GAGGAGGAAGATAAGGAGTTTGG + Intergenic
1031469465 7:122151724-122151746 TAGGAGAAAGATCAGGAGTTTGG + Intergenic
1031744197 7:125472743-125472765 GAGGAAAGGGAAAATGAGGTGGG + Intergenic
1031812796 7:126392859-126392881 GTGGAGAAGAACAAGGAGTTTGG - Intergenic
1032479228 7:132233245-132233267 GAGGACAAGGATAATGAATTAGG - Intronic
1033997505 7:147369309-147369331 GGGGAGACAGAGAATGAGTTTGG - Intronic
1034475136 7:151277201-151277223 GAGGAGCTTAATAATGAGTTAGG + Intronic
1034505540 7:151486937-151486959 GAGAGGAAGGGAAATGAGTTGGG + Intronic
1034994994 7:155571545-155571567 GAGGAGAAGGAGAGTGGGATAGG - Intergenic
1037378490 8:18258708-18258730 TGGGAGAAGGATAGTGAGATGGG + Intergenic
1038010972 8:23475518-23475540 GAGGCGTAGGAGAATGAGTCAGG - Intergenic
1038350564 8:26772425-26772447 GCGGAGAAGGAAAAGGAGCTTGG - Intronic
1038568519 8:28639571-28639593 GAGGGGAAGTATAAAGAGGTAGG - Intronic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1040750061 8:50694404-50694426 GAAGAGAACAATAATGAGTGAGG + Intronic
1041021483 8:53642956-53642978 GAGCAGAAGGAAGTTGAGTTAGG - Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042321576 8:67481181-67481203 GAGGAGAAAGGTAAAGGGTTTGG - Intronic
1042767283 8:72337337-72337359 GAGGAGAAGGAAAATCAGTGAGG - Intergenic
1043457734 8:80429135-80429157 GATGAGAAGGATAAAGAATCAGG - Intergenic
1043873344 8:85459609-85459631 GAGGTAAAGAATAATGAGTGAGG - Intergenic
1044747893 8:95388993-95389015 GAGGAGAAGCATCATGTGCTTGG + Intergenic
1044950683 8:97432895-97432917 TAGAAGCAGGAAAATGAGTTAGG + Intergenic
1046629362 8:116608076-116608098 GAGGGGAAGAACAAGGAGTTTGG - Intergenic
1046673583 8:117084212-117084234 GAGGAGAAGAATAAAGAAATTGG + Intronic
1047109492 8:121773363-121773385 GAGGATAATGATAAGGAGATTGG + Intergenic
1047155716 8:122315735-122315757 GGGGAGATGTATAAAGAGTTTGG + Intergenic
1047343080 8:124001404-124001426 GAGAAGCAGGATAATTAGATGGG - Intronic
1047688685 8:127328662-127328684 GAGGAGGAGTATAATGAGAGAGG - Intergenic
1048535906 8:135294302-135294324 TAGGAGAAGGAAAGTGTGTTGGG - Intergenic
1050626467 9:7509257-7509279 GTGGAGAAGGGTAAAAAGTTAGG + Intergenic
1051011011 9:12414433-12414455 AAGGAGAGGGAGAAAGAGTTGGG - Intergenic
1051919094 9:22243219-22243241 GATGGGAAGGATAATGAGGAAGG + Intergenic
1052204756 9:25826416-25826438 GAGGAGGTAGATAATGAGGTAGG - Intergenic
1052483115 9:29057573-29057595 GAGGAGACAGAGACTGAGTTTGG + Intergenic
1053099529 9:35359535-35359557 CAGAAGAAGGATCAGGAGTTTGG - Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1054327709 9:63722544-63722566 GAGGGAAAGGAAAATTAGTTGGG + Intergenic
1055379034 9:75685980-75686002 GAGGAGGAGGAGAAGGAGTTGGG + Intergenic
1056941509 9:90960425-90960447 GAGGAGCAGGACCATGAGTCAGG + Intergenic
1057522366 9:95770220-95770242 GAGGACAAGGAAAACGAGATGGG - Intergenic
1058323304 9:103661113-103661135 GGGAAGAAGGATTATGATTTAGG - Intergenic
1060705204 9:125792371-125792393 GAGGTGAAGGAAAATGAGAATGG + Intronic
1060733750 9:126053414-126053436 AAGGAGAAGGAAATTGAGATGGG - Intergenic
1061775187 9:132958257-132958279 GAGGAGAAAGAGGATGTGTTAGG + Intronic
1061783235 9:133008001-133008023 GAGGAGAAGGAAAGGGAGATGGG - Intergenic
1061783243 9:133008027-133008049 GAGGAGAAGGAAAGGGAGATAGG - Intergenic
1186178422 X:6949371-6949393 GAGGAAAAGGATAAGGAGGAGGG - Intergenic
1187196751 X:17093660-17093682 GAGGAGAAAGATAATGGGGGAGG - Intronic
1187940098 X:24372997-24373019 GAAGAGGATGATAATGAGTCAGG + Intergenic
1188118704 X:26278260-26278282 GAGGAGACAGGTAATTAGTTGGG - Intergenic
1188525799 X:31086422-31086444 GAGGAAGAAGATAATGACTTGGG + Intergenic
1188607239 X:32046326-32046348 GAGGAGAAGGGTAATGAATGTGG - Intronic
1189474133 X:41335480-41335502 GAGGAGAAGGTTATGGACTTTGG + Intronic
1189906636 X:45767342-45767364 GAGTAGGAGGATAATGAGAAGGG - Intergenic
1190259686 X:48790085-48790107 GAGGAGAAGGATGAAGAAATTGG + Intronic
1193194679 X:78618260-78618282 GAGGAGGTGGAAAATGACTTAGG - Intergenic
1193471768 X:81913205-81913227 GTGGAGATGAAGAATGAGTTAGG - Intergenic
1193763818 X:85500633-85500655 AAAGAGAAGGAGAATGAGTTTGG + Intergenic
1193837601 X:86364584-86364606 GAGGAGAAGCATGATGTGATGGG + Intronic
1195250466 X:103039495-103039517 GAGCAGAACAATAATGAGTAAGG - Intergenic
1195598510 X:106720207-106720229 AAGGAGAGGGATAAAGAGTGGGG - Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196143033 X:112286261-112286283 GAGGAAAAGCATAATGACTGGGG + Intergenic
1197275089 X:124468525-124468547 GAGGATAGGGATAAGGAGATGGG - Intronic
1197416535 X:126180993-126181015 CAGTGGAAGGATATTGAGTTGGG - Intergenic
1198829274 X:140731413-140731435 GAGCACAAGGAATATGAGTTTGG + Intergenic
1199559023 X:149142916-149142938 CAGAAGAAAAATAATGAGTTTGG + Intergenic
1199901535 X:152177361-152177383 GAGGATAAGGATAAGAAGTGAGG + Intronic
1201942440 Y:19474326-19474348 GAGGAGAAGGGAAAGGAGTGTGG + Intergenic