ID: 973154614

View in Genome Browser
Species Human (GRCh38)
Location 4:46935331-46935353
Sequence TTATATATTTATTAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 732
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 683}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973154614_973154618 23 Left 973154614 4:46935331-46935353 CCTTCCTCCTAATAAATATATAA 0: 1
1: 0
2: 4
3: 44
4: 683
Right 973154618 4:46935377-46935399 CTTAATGTCTAGCACATAGTAGG 0: 1
1: 1
2: 25
3: 180
4: 1037
973154614_973154617 -7 Left 973154614 4:46935331-46935353 CCTTCCTCCTAATAAATATATAA 0: 1
1: 0
2: 4
3: 44
4: 683
Right 973154617 4:46935347-46935369 TATATAAGATAATGCATGTAAGG 0: 1
1: 1
2: 23
3: 72
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973154614 Original CRISPR TTATATATTTATTAGGAGGA AGG (reversed) Intronic
901299440 1:8188785-8188807 TTATTTATTTATTTAGAGAAAGG + Intergenic
901675641 1:10882118-10882140 TTATTTATTTATTTTGAGGCAGG - Intergenic
902125872 1:14210516-14210538 TAATATATTCATTAGGGAGAAGG - Intergenic
903398112 1:23018450-23018472 TTATATCTTGATTAGGGTGATGG - Intergenic
903408174 1:23116504-23116526 TCATTTATTTATTTGGAGGCAGG - Intronic
903690917 1:25172984-25173006 TTATTTATTTATAAGAAGAAAGG + Intergenic
904257326 1:29262988-29263010 TTATTTATTTATTATTAAGACGG + Intronic
904633668 1:31862932-31862954 ATATATAAATATTAGAAGGAAGG + Intergenic
905401102 1:37703957-37703979 ATATTTATTTATTATGAGGCAGG + Intronic
906788659 1:48639126-48639148 TTCTATTTTTATTAGCAGGCTGG - Intronic
907488822 1:54795750-54795772 TTCTGTATCTATGAGGAGGAGGG + Intronic
908188484 1:61675864-61675886 TTGTATAGTGATTAGGAGGACGG + Intergenic
908971400 1:69837811-69837833 ATATATATTGATTATGAGTAGGG - Intronic
909092097 1:71238939-71238961 TTCTATAATTATTAGTAGGGAGG - Intergenic
910047136 1:82931526-82931548 TTATATATTTTTTTGGGGGGGGG + Intergenic
910145381 1:84074453-84074475 ATATATATATAGTAGGACGAGGG - Intergenic
910219716 1:84878100-84878122 TTCTAAATTTGTTAGGAGCAGGG + Intronic
910361553 1:86417577-86417599 TTATAGGCTTATTAAGAGGAAGG - Intergenic
910410421 1:86937713-86937735 TTATATATATATAAGGTAGAAGG - Intronic
910855600 1:91692183-91692205 GTATATTTCTATTAAGAGGATGG + Intronic
911094365 1:94043633-94043655 TTAAATATCTAATAAGAGGATGG + Intronic
911676990 1:100669328-100669350 TTATATTTTTATTATGTGAATGG - Intergenic
912249872 1:108000116-108000138 TTATTTATTTATTTGCAGAAAGG - Intergenic
914374003 1:147056217-147056239 TTATTTATTTATTTAGAGGTGGG - Intergenic
914597485 1:149167848-149167870 TTATATATTTTTTTGGAGATGGG - Intergenic
914688029 1:149999689-149999711 TTATTTATTTATTAGGGACAGGG - Intronic
914733903 1:150397991-150398013 TTATTTATTTATTTTGAGGCAGG + Intronic
915696091 1:157743596-157743618 TTATTTATTTATTTTGAGGCAGG - Intergenic
916705442 1:167344721-167344743 TTAGCTATCTATTAGGAGGAAGG + Intronic
916710086 1:167397527-167397549 ATATATATATATTGGGGGGATGG + Intronic
917728841 1:177854327-177854349 TTATGTCTTTATTAGCAGCATGG - Intergenic
917808253 1:178633770-178633792 TTATTTATTTATTGAGAGGCAGG + Intergenic
918210578 1:182347595-182347617 TTTTTTATTTTTTAGGGGGATGG + Intergenic
919059014 1:192607193-192607215 TTATTTATTTATTTTGAGGCAGG - Intergenic
919330862 1:196169916-196169938 TCATACTTTTATTATGAGGAGGG + Intergenic
919444127 1:197679975-197679997 TTATATATTTTTTAGAAACAGGG - Intronic
919516478 1:198531909-198531931 TTAAATAATTATTAGGAAAACGG + Intronic
919573876 1:199282409-199282431 TTAAATATTTATTGGATGGATGG - Intergenic
919602992 1:199646151-199646173 TTATTTATTAAGTAGGAGAAAGG + Intergenic
920244189 1:204575757-204575779 TTAAACATTCAGTAGGAGGATGG + Intergenic
921007618 1:211110771-211110793 ATATAATTATATTAGGAGGAGGG + Intronic
921358886 1:214312425-214312447 TTATATATTTATTAGTTGTTTGG - Intronic
921841178 1:219830199-219830221 TTTTTTATTTTTTAGGAGCAGGG + Intronic
922420032 1:225453369-225453391 CTAGATATTCATTTGGAGGAAGG + Intergenic
922459458 1:225803705-225803727 TTATAAATATATTGGGGGGATGG - Intergenic
922871353 1:228904505-228904527 TTATTTATTTTTTAGGGGCAGGG - Intergenic
924747130 1:246846740-246846762 ATATATATTTTTTGGGGGGATGG + Intronic
924811964 1:247410731-247410753 TTATTTATTTATTTGGAGACAGG + Intergenic
1063398916 10:5722280-5722302 TTGTATTTTTATTAGGGAGAGGG - Intronic
1063937222 10:11090424-11090446 TTTTTTATTAATTGGGAGGAGGG - Intronic
1064589817 10:16877765-16877787 TTATATTTTTCTTTGGGGGATGG - Intronic
1064766377 10:18678259-18678281 TTCTATATTCATTAGAAGAAAGG + Exonic
1064766797 10:18683404-18683426 ATACATATTTCTTAGTAGGAAGG - Intergenic
1064788752 10:18931260-18931282 ATGTATATTTATTAGAAAGAAGG + Intergenic
1065197024 10:23276472-23276494 TTATATATTTATAGGGAAGTTGG - Intronic
1065747797 10:28857942-28857964 TTATAGATTTAGTAGGAGATGGG - Intronic
1066179484 10:32945811-32945833 TTATATATTTATTAGTGTAAAGG - Intronic
1067263035 10:44711544-44711566 TTATACATCAATTTGGAGGAGGG + Intergenic
1067466883 10:46507220-46507242 ATATATATGTAATAGGTGGATGG + Intergenic
1067620303 10:47877385-47877407 ATATATATGTAATAGGTGGATGG - Intergenic
1068362853 10:56002184-56002206 TTATATATTTATGAAGGAGAAGG - Intergenic
1068375136 10:56168158-56168180 TTATGTTTTTATTAGCAGCATGG + Intergenic
1068708211 10:60101132-60101154 TGAGATATGTATTTGGAGGAGGG + Intronic
1068735616 10:60410450-60410472 TTAAATATTTGTTGGAAGGATGG + Intronic
1069023612 10:63517077-63517099 AAATATATTTATTTGGAGAAAGG - Intergenic
1069276052 10:66592470-66592492 TTATATATTTGTGACCAGGATGG - Intronic
1069376070 10:67794323-67794345 TTAAATATTTCTTTGGGGGAAGG - Intergenic
1070395902 10:76011114-76011136 TTAACTTTTTTTTAGGAGGATGG + Intronic
1070445742 10:76499875-76499897 TTATATATTTTTTAGAAATAGGG + Intronic
1071033943 10:81219669-81219691 TTTTATATTTTTTAGGAGTTTGG + Intergenic
1071142983 10:82534435-82534457 TTATATTTTTAGTAGAAGCAGGG + Intronic
1071243263 10:83734194-83734216 TTATATATTTTTTAGTGTGAAGG - Intergenic
1071541958 10:86493533-86493555 TTATTTATTTATTAAGAGACAGG + Intronic
1071671487 10:87613039-87613061 TTATGTCTTTATTAGCAGTATGG + Intergenic
1071832528 10:89386033-89386055 TTATTTATTTATTAGAGGCAGGG + Intronic
1071908711 10:90205263-90205285 TTATATACTTCTTATGTGGAAGG + Intergenic
1071982376 10:91016424-91016446 ATATATATATATTAAGAGCAAGG + Intergenic
1072101820 10:92236573-92236595 TTATATTTTTAGTAGAAGCAGGG - Intronic
1072359072 10:94641039-94641061 TTATATATTTTTTAGTGGCAGGG + Intergenic
1073586798 10:104718139-104718161 TTATTTATTTATTTTGAGGACGG - Intronic
1073795317 10:106981168-106981190 TTATTTATTTATCTGGAGGGAGG - Intronic
1074026359 10:109640079-109640101 TTTTATTTTTATTAAGGGGAAGG + Intergenic
1074563871 10:114558994-114559016 GAATATATTTATTAGGGTGATGG - Intronic
1074620680 10:115117032-115117054 ATATATGTTTCTTTGGAGGAAGG + Intronic
1074670765 10:115788099-115788121 TTACATTTTTGTTAGGAGTATGG - Intronic
1074776726 10:116772696-116772718 TTATTTATTTATTTGGAGACAGG + Intergenic
1074808387 10:117077455-117077477 TTTTTTTTTTATTAGGAGGGAGG + Intronic
1077930409 11:6725350-6725372 TTATTTATTTATTTTGAGGCAGG - Intergenic
1078471044 11:11586981-11587003 TTATTTATTTATTTGGAGATGGG - Intronic
1078595545 11:12683414-12683436 GTTTATATTTTTTAGGAGCATGG + Intronic
1078913287 11:15753644-15753666 TTTTATATTTCTTGTGAGGAAGG + Intergenic
1079221390 11:18564255-18564277 CTATATATTTATTTGGTGGCTGG - Intronic
1079378164 11:19912943-19912965 ATATCAGTTTATTAGGAGGAGGG - Intronic
1080223932 11:29938613-29938635 TTATATATTTATGTGGGGGAGGG - Intergenic
1081216149 11:40401019-40401041 ATAAATATTTATTAAAAGGATGG + Intronic
1081472751 11:43391391-43391413 TTATTTATTTATTTAGAGAAAGG - Intronic
1082063973 11:47883691-47883713 TTATATATTTATTTAGAGACAGG - Intergenic
1082248489 11:49953608-49953630 TTTTACATTTATTAGAAGGAAGG - Intergenic
1082562457 11:54634748-54634770 TTTTACATTTATTAGAAGGAAGG + Intergenic
1082920949 11:58493204-58493226 TTACAAATTTATGAAGAGGATGG + Intergenic
1083913139 11:65721490-65721512 TTTTATATTGATTAGTAGGTAGG + Intergenic
1083931326 11:65847468-65847490 TTATTTATTTATTTGGAGACAGG - Intronic
1083942785 11:65906586-65906608 TTATTTATTTATTAGTAGAGAGG + Intergenic
1084089975 11:66872862-66872884 TTATATTTTTAGTAAGAGGCGGG - Intronic
1085187763 11:74590902-74590924 TTATTTATTTATTTTGAGGGGGG + Intronic
1085285583 11:75358023-75358045 TTATATTGTTATCTGGAGGAGGG - Intergenic
1085544217 11:77301990-77302012 TTATATATTTTTTAAGAGACGGG + Intergenic
1085752736 11:79176084-79176106 TTATTTATTTATTTTGAGGCAGG - Intronic
1086221695 11:84452873-84452895 TTATTTATTTATTTGGAGATGGG - Intronic
1086573942 11:88316468-88316490 TTATTTATTTATTTAGAGAATGG - Intronic
1086791602 11:91046638-91046660 TTTTATAATTATTAGGAATAAGG - Intergenic
1087164224 11:94984487-94984509 TTATTCATTTATTATGAGAAAGG - Intronic
1087559357 11:99765557-99765579 TTATATATTTCTTTGTAGTAAGG + Intronic
1088314652 11:108495662-108495684 TTATTTATTTATTTAGAGAAAGG + Intronic
1088424648 11:109689780-109689802 TTTTATATATAGTAGGAGGTAGG - Intergenic
1088436402 11:109818072-109818094 TTATTTATTTAAAAGGAGGTGGG + Intergenic
1088601821 11:111486429-111486451 TTATTTATTTATTTGGAGGCAGG - Intronic
1089516647 11:119036734-119036756 TTATTTATTTATTTTGAGGCAGG - Intergenic
1089557961 11:119325615-119325637 TTATATATTTATTTTGAGACAGG - Intergenic
1090134272 11:124180413-124180435 TTATATATTTATTTGGTCTATGG + Intergenic
1090569916 11:128034727-128034749 TTATCTATTTATTAGCTGTATGG + Intergenic
1091941525 12:4488018-4488040 TTATATATTTATTATTAGCTTGG + Exonic
1092292165 12:7167016-7167038 ATATAAATTTTTTAGGAGGAGGG + Intergenic
1092580811 12:9838947-9838969 TAATATATAAATTAGGGGGAGGG - Intronic
1093034966 12:14324302-14324324 TTATTTATTTATTTGGAGGCAGG + Intergenic
1093218887 12:16395197-16395219 TTATATATATATTAGAAGGTAGG + Intronic
1093436753 12:19143793-19143815 TTATATATTTATTCAGTAGAAGG + Intronic
1093640200 12:21519090-21519112 TTATATATTTTTTCTCAGGATGG + Intergenic
1093966110 12:25327894-25327916 TTATTTATTTATTTGGAGACAGG - Intergenic
1094538852 12:31346040-31346062 TTGTATTTTTAGTAGGAGCAGGG - Intergenic
1095122904 12:38440556-38440578 TTACATTTTTTTTAGGAGCATGG + Intergenic
1095199323 12:39364010-39364032 TTATTTATTTATTTTGAGGCGGG - Intronic
1095280703 12:40349517-40349539 TTATTTATTTATTTAGAGGCAGG + Intronic
1096141301 12:49244901-49244923 TTATAAAGTTATTATAAGGAAGG - Intronic
1096204509 12:49709465-49709487 TAAAATATTTATTATGAGGGAGG - Intronic
1096388532 12:51211749-51211771 TTATTTATTTATTAGGGACAAGG - Intronic
1096479322 12:51927661-51927683 TTATTTATTTATTTTGAGGCAGG + Intergenic
1096603344 12:52746294-52746316 CTATATGTCTATTAGGAGGCAGG + Intergenic
1096654786 12:53082071-53082093 TTATTTATTTATTTGGGGCAGGG + Intergenic
1097322804 12:58244944-58244966 TTAAATATTTATTTGGGGGATGG - Intergenic
1099792604 12:87355793-87355815 TTTTATCTTTCTTAGGAGGTGGG + Intergenic
1101120000 12:101569515-101569537 TTATTTATTTATTTTGAGAAAGG + Intronic
1101484735 12:105143741-105143763 TGATATTTTTATTTGGAGGGAGG + Intronic
1102340261 12:112115978-112116000 TTATTTATTTATTTTGAGAAAGG - Intergenic
1102517797 12:113462151-113462173 TTATATTTTTAAGAGGAGGTAGG - Exonic
1102572737 12:113837150-113837172 GTGTATATTAAGTAGGAGGATGG - Intronic
1102688160 12:114740283-114740305 TTGTATATTTAGTAGAAGCAAGG - Intergenic
1103234789 12:119362328-119362350 TTATATATTTATTAAGGTCATGG - Intronic
1103307401 12:119976384-119976406 TTATTTATTTATTTTGAGAAAGG + Intergenic
1104080882 12:125429709-125429731 TTATAGGTTTATTGGGAGGTAGG + Intronic
1104191375 12:126485042-126485064 TAATTTATTTATTATAAGGATGG - Intergenic
1104665922 12:130647188-130647210 TTGTATTTTTATTAGGGGCAGGG - Intronic
1104700510 12:130899909-130899931 TCATATATATATGAAGAGGATGG - Intergenic
1107121819 13:36804451-36804473 TTATTTATTTATTTGGAGACAGG + Intergenic
1107215627 13:37915063-37915085 CCACATATTCATTAGGAGGATGG - Intergenic
1107248756 13:38331346-38331368 TTATTTATTTATTTTGAGGCAGG + Intergenic
1107388783 13:39941952-39941974 GTATGTATTTATTTGGAGCAGGG - Intergenic
1107472260 13:40702069-40702091 TTATATTTTTAGTAGGAGTGGGG - Intergenic
1107793474 13:44026435-44026457 TTATGTCATTATAAGGAGGAAGG + Intergenic
1108045815 13:46383445-46383467 TTATGAATTGATGAGGAGGAAGG - Intronic
1108082486 13:46751016-46751038 TTATGTATTTAGTGGGGGGAGGG + Intronic
1108242162 13:48476006-48476028 TTATACATTTAATAGCAGCACGG + Intronic
1108612586 13:52098253-52098275 TTATTTATTTATTTGAAAGAGGG - Intronic
1109092238 13:58062884-58062906 TTATTTATTTATTAGAAACAGGG + Intergenic
1109240787 13:59884940-59884962 TTACATATTTCATAGGAGAAAGG + Intronic
1110108059 13:71704733-71704755 TTAAATATTTCTTGGGGGGAGGG - Intronic
1110167804 13:72464400-72464422 TTATGTATTTATTTGAAAGAAGG + Intergenic
1110745798 13:79052076-79052098 TAATAAAATTATTAGGAGCAAGG - Intergenic
1110846258 13:80193587-80193609 TTATACAATTATTAAGAGAATGG + Intergenic
1111418705 13:87981136-87981158 ATATATATTAATTAGAAGAAGGG - Intergenic
1111422830 13:88038347-88038369 TTAAAAATTTGTTAAGAGGATGG + Intergenic
1113303389 13:109048323-109048345 TTTTTTATTCTTTAGGAGGAAGG + Intronic
1114444354 14:22776793-22776815 TTATATTTTTAGTAGGAACAGGG - Intronic
1114547091 14:23511038-23511060 TTATTTATTTATTTTGAGGTAGG - Intergenic
1114737515 14:25057702-25057724 TTATTTATTTATTGAAAGGAAGG + Intergenic
1115187008 14:30700268-30700290 TTATTCAGTTATTGGGAGGAAGG + Intronic
1115574441 14:34696909-34696931 TTATTTATTTTTTAAGAGAAGGG + Intergenic
1115980174 14:39042981-39043003 TTATTTATTTTTTTGGAGAAGGG + Intronic
1116087374 14:40257495-40257517 TTATATATTTTTTATGACAACGG + Intergenic
1116293783 14:43077697-43077719 TTCTATATTTATTAGCAATAAGG - Intergenic
1116441234 14:44955778-44955800 TTATTTATTTATTTTGAGGCAGG - Intronic
1116512407 14:45762812-45762834 TTATTTATTTATTATGAGCTAGG - Intergenic
1116666106 14:47777746-47777768 TTATTTATTTATTTTGAGAAAGG + Intergenic
1117060317 14:51955692-51955714 TTAAATATTTTTTAAAAGGATGG + Intronic
1117694422 14:58344876-58344898 TTATTTATTTATTTTGAGGCAGG + Intronic
1117877753 14:60273347-60273369 TTGTTTATATATTTGGAGGAAGG + Intronic
1118079413 14:62340965-62340987 TTAAATATTTTTTTGGATGAAGG + Intergenic
1118100933 14:62601632-62601654 TTATTTATTTTTTTGGAGGGAGG - Intergenic
1118541277 14:66828835-66828857 TTATATATTTTATAGGAATAGGG + Intronic
1118873228 14:69760839-69760861 TGATATAATTATTAGGGGCAAGG - Intronic
1119412418 14:74441510-74441532 TTATATATATATTAGAGGCAGGG + Intergenic
1119550019 14:75502714-75502736 TTATATATTTATTAGAGACAGGG - Intergenic
1119927828 14:78513244-78513266 TATTGTATTTATTAGGAGTATGG + Intronic
1120288110 14:82531233-82531255 TTACATATTTATAAGGTCGAAGG - Intergenic
1120297549 14:82663129-82663151 TTATCTATTTACAAGGAGAATGG - Intergenic
1120683485 14:87509613-87509635 ATATATGTATATGAGGAGGAAGG - Intergenic
1120917329 14:89721533-89721555 GCATGTATTAATTAGGAGGATGG + Intergenic
1121869436 14:97393751-97393773 TTATTTATTTATGGGGAGGAGGG + Intergenic
1122954299 14:105062930-105062952 TTATTTATTTATTTGGAGACAGG + Intronic
1202894373 14_KI270722v1_random:189958-189980 TTAAAAATTTGTTAAGAGGATGG - Intergenic
1124068180 15:26365657-26365679 TTATTTATTTATTTTGAGGTGGG + Intergenic
1124587195 15:31020741-31020763 TTATTTATTTTGGAGGAGGACGG + Intronic
1125153503 15:36561134-36561156 GTATATCTTTATTAGCAGCAAGG + Intergenic
1126757026 15:51934942-51934964 TTATATTTTTAGTAGAGGGAGGG - Intronic
1126991258 15:54378542-54378564 TTATATATTTATTACCAAAATGG - Intronic
1127123774 15:55792978-55793000 TTATTTATTTATTAGGGACAGGG + Intergenic
1127156312 15:56129202-56129224 TTTTATATTTATTATAGGGATGG - Intronic
1127380441 15:58426489-58426511 TTATTTATTTTTTGGGGGGATGG - Intronic
1128278577 15:66375282-66375304 GAATATATTTTTTAAGAGGAGGG - Intronic
1128893276 15:71350106-71350128 TTATATAATTATTATAAGGCTGG - Intronic
1129693256 15:77725555-77725577 TTATTTATTTATTTGGAGACAGG - Intronic
1130007529 15:80114484-80114506 CAATAAATGTATTAGGAGGAGGG + Intronic
1130037651 15:80376390-80376412 CTATATATAAATTAGGAGGGTGG - Exonic
1130956596 15:88631192-88631214 TTATTTATTTATTAACAGCAGGG + Exonic
1131039889 15:89254531-89254553 TTATTTATTAATTATGAGTATGG - Intronic
1131040071 15:89256413-89256435 TTATATATTTAATAGAGAGATGG + Intronic
1131118253 15:89807310-89807332 TTATTTATTTATGAGGAGAGAGG - Intronic
1131243732 15:90771877-90771899 TTATTTATTTATTTAGAGGCAGG + Intronic
1132204539 15:99977339-99977361 ATATATATATATGAAGAGGAGGG - Intronic
1133200829 16:4203525-4203547 TTATTTATTTATTTAGAGAAAGG + Intronic
1133212001 16:4268594-4268616 TTATTTATTTATTTAGAGGCAGG + Intronic
1133471948 16:6083896-6083918 CTGTAGATTTATTTGGAGGATGG + Intronic
1133664611 16:7954283-7954305 TTATAGATTAATTAATAGGAGGG - Intergenic
1133701681 16:8315077-8315099 TTGTATTTTTATTAGAAGCAGGG + Intergenic
1133872686 16:9704085-9704107 TTATACATTTTTAAGGAGGCAGG - Intergenic
1133999485 16:10771527-10771549 TTATATATTTTTTGGGAGACAGG - Intronic
1134010230 16:10846590-10846612 TTATTTATTTATTCGGAACAGGG - Intergenic
1134020719 16:10919520-10919542 TTATTTATTTATTTGGAGATGGG + Intronic
1134458495 16:14411992-14412014 TTATTTATTTATTTGGAGGCAGG + Intergenic
1134559166 16:15192946-15192968 TTATATATTCATGGGGAGGCAGG - Intergenic
1134919701 16:18104559-18104581 TTATATATTCATGGGGAGGCAGG - Intergenic
1135794688 16:25430452-25430474 TTATTTATTTTTTAAGAGAAAGG - Intergenic
1135912387 16:26573107-26573129 TTATTTATTTATTCGTAGGAGGG + Intergenic
1136572837 16:31106936-31106958 TTATTTATTTATTTGGAGATGGG - Intronic
1136984658 16:35088683-35088705 TTATATTTTAAATAGGAGGTAGG + Intergenic
1137857631 16:51811233-51811255 TTATTTATTTATTTTGAGGCAGG - Intergenic
1137873171 16:51970330-51970352 ATATATATTTAATAGGGGAAGGG + Intergenic
1137927215 16:52551586-52551608 ATATATATTTATTATCATGAAGG - Intergenic
1137984044 16:53092782-53092804 TTATTTATTTATTTAGAGAAAGG + Intronic
1138047165 16:53737210-53737232 TTATATATTTATCTGTGGGAAGG + Intronic
1139013588 16:62662967-62662989 TCATATACTTATTAGAAGAAAGG - Intergenic
1139072259 16:63397140-63397162 TTATTTATTTATTAGGACAAGGG - Intergenic
1139898532 16:70308540-70308562 TTATTTATTTTTTAGGAGATGGG + Intronic
1140077382 16:71714110-71714132 TTATATTTTTAGTAGCAGCAGGG + Intronic
1140138856 16:72234564-72234586 TTATATAATTATTCGTAAGAGGG - Intergenic
1140557500 16:75938622-75938644 TTATTTATGTATTAGAAGAAGGG + Intergenic
1140597014 16:76428196-76428218 ATATATATTTTTTGTGAGGAAGG + Intronic
1140652515 16:77104272-77104294 TTATATATTTTTAAGTAGGTAGG - Intergenic
1140804778 16:78523064-78523086 TTATTTATTTTTTTGGGGGATGG - Intronic
1141202671 16:81909985-81910007 TTATATATATAAAAGGGGGATGG + Intronic
1142014418 16:87736951-87736973 TTATATTTTTAATAAGAGGCAGG - Intronic
1142800005 17:2338764-2338786 ATATATATATATTAGGGAGACGG - Intronic
1143206790 17:5147884-5147906 TTATTTATTTATTTGGAGAAAGG + Intronic
1143424110 17:6819506-6819528 TTAAATGTTTATTTGCAGGAAGG + Intronic
1143716733 17:8777248-8777270 ATATAAATTTTTCAGGAGGAGGG - Intergenic
1143763153 17:9119507-9119529 TTATTTATTTATTAGAAACAAGG + Intronic
1143906537 17:10213706-10213728 TTATTTATTTTTTTGGAGGCAGG - Intergenic
1143992435 17:10977643-10977665 TTTTGTATTTTTTAGTAGGACGG + Intergenic
1144163621 17:12585843-12585865 TTATTTATTTATTGAGAGGCTGG - Intergenic
1144289457 17:13812695-13812717 TTCAATATTTATCAGTAGGATGG + Intergenic
1144560715 17:16318569-16318591 TTATATATATATAAAGAGTAGGG - Intronic
1145405978 17:22594576-22594598 ATTTATATTTAAAAGGAGGATGG + Intergenic
1145748816 17:27340728-27340750 TTATTTATTTATTTAGAGGCAGG - Intergenic
1145838456 17:27972958-27972980 TTACAAATTTATTAGGAGTCTGG + Intergenic
1147045610 17:37749664-37749686 TTATTTATTTATTTAGAGAATGG - Intergenic
1148048488 17:44758291-44758313 TTATATTTTATCTAGGAGGAAGG + Intergenic
1148939629 17:51197104-51197126 ATATATATATATATGGAGGACGG + Intronic
1149213221 17:54327050-54327072 TTATTTCTTTATGAGAAGGAGGG + Intergenic
1149267335 17:54941292-54941314 TTCTATATTTAAAAGGGGGAGGG + Intronic
1149477373 17:56974427-56974449 TTATATGTTTATTCTGAGAAGGG - Intergenic
1150116551 17:62555790-62555812 TTATATATTTATTTTGAGACAGG + Intronic
1150179292 17:63098749-63098771 TTATGTATTTTCTTGGAGGAGGG + Intronic
1150822772 17:68449040-68449062 TTTTAAATTTATGAGAAGGAAGG - Intronic
1150974596 17:70070508-70070530 TTATGTTTGTATTTGGAGGAGGG - Intronic
1152274145 17:79344557-79344579 TTATTTATTTATTTAGAAGACGG + Intronic
1152967322 18:129145-129167 TTATATATTTAGTAGAAACAGGG - Intergenic
1153030750 18:711163-711185 TTATTTATTTATTTTGAGGCAGG - Intronic
1153032871 18:731648-731670 TTATATAGTTTCTAGGGGGAAGG - Intronic
1153105973 18:1527383-1527405 TTAAACATTTTTTAGGAGGAGGG - Intergenic
1153477902 18:5517402-5517424 TTATTTATTTTTTAAGGGGAGGG - Intronic
1154163950 18:12000176-12000198 TTATATATTTTTTAAGAGATAGG + Intronic
1154926666 18:20942914-20942936 TTATATATTTAGTAGAAACAGGG + Intergenic
1156626108 18:38911310-38911332 TTATTTATTTATTTTGAGAAGGG + Intergenic
1157774651 18:50383026-50383048 TTATTTATTTATTTTGAGGCAGG - Intronic
1158492477 18:57922735-57922757 TTATTTATTTATTTTGAGAAAGG + Intergenic
1158825957 18:61219865-61219887 TGATATATTTATCAATAGGAAGG + Intergenic
1159082343 18:63749703-63749725 TTATTTATTTATTTATAGGAAGG + Intergenic
1159657795 18:71053305-71053327 TTATATTTTAATTAGGCAGATGG - Intergenic
1159765957 18:72488790-72488812 TGATATATTTAGTAGAAGTATGG + Intergenic
1160574239 18:79841287-79841309 TTATTTATTTATTATGAGATAGG - Intergenic
1161534162 19:4808635-4808657 TTATATTTTTAGTAGGAGACGGG - Intergenic
1161644033 19:5442159-5442181 TTATTTATTTATTTTGGGGATGG + Intergenic
1161749381 19:6083576-6083598 TTATTTATTTATTCTGAGGCCGG + Intronic
1161844445 19:6704279-6704301 TTATATATTTATTTAGAGGCAGG - Intronic
1162586712 19:11564045-11564067 TTATATATTTATTTAGAGACGGG + Intronic
1163284212 19:16336095-16336117 TTATTTATTTATTAGAGGCAGGG - Intergenic
1164517873 19:28951358-28951380 TTATATATTTTTTAAAAGCAGGG - Intergenic
1165048893 19:33128687-33128709 TTTTATCTTTATTGGGAAGAAGG + Intronic
1166551008 19:43666081-43666103 TTATTTATTTATTAGAAACAGGG + Intronic
1166908269 19:46131416-46131438 TTTGCTATTTTTTAGGAGGAGGG - Intergenic
1167335706 19:48884436-48884458 TTATATATTTATTTAGAGACAGG - Intronic
1167614112 19:50522171-50522193 TTATTTATTTATTTTGGGGACGG - Intronic
1167870903 19:52369545-52369567 TTATGTATTTATTAGGCGCAAGG + Intergenic
1168511260 19:56975289-56975311 TTATTTATTTATTAGAGGCAGGG + Intergenic
928576831 2:32663688-32663710 TTATTTATTTATTTGGAGACGGG + Intronic
928899178 2:36299303-36299325 TTAAAGATTTATTTGGGGGAGGG + Intergenic
930194769 2:48498010-48498032 TTATATTTTAATTAAGTGGATGG + Intronic
930247370 2:48998259-48998281 TGGTATATTAATGAGGAGGAAGG + Intronic
930315135 2:49788226-49788248 TTATTTATTTATTTTGAGAAAGG + Intergenic
930329364 2:49962944-49962966 TTATTTATTTATTTAGAGGCAGG - Intronic
931149108 2:59553199-59553221 TTACATATTTCTAAGGAAGAAGG - Intergenic
931410112 2:62021297-62021319 TGAGATATTTATTAGGAGTTTGG + Intronic
932077943 2:68683242-68683264 TTCTATATTTATTAAAAAGAGGG + Intronic
932232771 2:70096197-70096219 TTATTTATTTATTTTGAGGCAGG + Intergenic
932759987 2:74432938-74432960 TTATATATTTTTTTAGAGGTGGG - Intronic
932968364 2:76505748-76505770 TTATATATTTAGAAGTAGAAGGG - Intergenic
932971456 2:76548494-76548516 TTATTTATTTATTTTGAGGCAGG + Intergenic
933250409 2:80023034-80023056 TAATATAGTTATTTGGAGCATGG - Intronic
933446201 2:82382999-82383021 TTAAATATTGAGTATGAGGAAGG - Intergenic
933976251 2:87514469-87514491 TTATTTTTTTATTATGAGAAGGG + Intergenic
935116457 2:100141081-100141103 TTATTTAATTCTTAAGAGGAAGG + Intronic
935322694 2:101904482-101904504 TCATATATATTTTAAGAGGAAGG - Intergenic
935642006 2:105299721-105299743 TTATTTATTTATTTTGAGGTGGG - Intronic
936317571 2:111436337-111436359 TTATTTTTTTATTATGAGAAGGG - Intergenic
936467581 2:112766960-112766982 TTATTTATTTATTTGGAGACAGG - Intergenic
937279418 2:120707216-120707238 TTATATATTTTTTGAAAGGATGG + Intergenic
937409818 2:121664323-121664345 TTATGTAGTTAATAGCAGGAAGG - Intergenic
937546355 2:123026329-123026351 TAAGGTATTTTTTAGGAGGAAGG - Intergenic
937643997 2:124245733-124245755 ATATATATATATTTGGAGAAAGG + Intronic
939403454 2:141726223-141726245 TTATAAATTTTTTATGATGATGG - Intronic
939435148 2:142166603-142166625 TTAGATATACATTAGGAGGTGGG - Intergenic
939737594 2:145867984-145868006 TTACATATGTATTAGTAGGTTGG + Intergenic
939994429 2:148906858-148906880 TTATCTATTTATTTTGAGGCAGG - Intronic
941369126 2:164642846-164642868 TTAAATATTTTTATGGAGGAAGG - Intergenic
941938532 2:171008038-171008060 TTACGTATTTATTAGAAAGAAGG + Intronic
942979816 2:182067356-182067378 TTATTTCTTTATTATGAGAAGGG - Intronic
943115690 2:183667138-183667160 TTAAATATATATAAGGAGTATGG - Intergenic
943174472 2:184452469-184452491 TGATATATTTATTTGGAGAGAGG - Intergenic
943341122 2:186683459-186683481 TTTTACATTTAAAAGGAGGATGG + Intergenic
943390202 2:187257055-187257077 ATTTATATTTATTATGAGAAAGG + Intergenic
943615362 2:190086106-190086128 TGATAGATTTCTTTGGAGGAAGG - Intronic
943868541 2:192961341-192961363 TTATATTTCTATATGGAGGAAGG - Intergenic
944109382 2:196115659-196115681 TTATTTATTTATTTTGAGGCAGG - Intergenic
944907705 2:204279302-204279324 TTATTTATTTATTAAGAGACAGG - Intergenic
944980996 2:205119775-205119797 TTATTTATTTATTTTGAAGACGG - Intronic
945625572 2:212201205-212201227 TAATATATTCATAAGAAGGATGG - Intronic
945751167 2:213785031-213785053 GTATATATTTATTATTAGAAAGG + Intronic
945836763 2:214843093-214843115 TTATTTATTTATTTTGAGGCAGG - Intergenic
946108046 2:217389425-217389447 TTTTGTATTGATTATGAGGATGG - Intronic
947115357 2:226764370-226764392 TTTTATATTTTTTTGGAGAAGGG - Intronic
947800164 2:232924230-232924252 TTATTTATTTATTTTGGGGATGG - Intronic
1168950762 20:1800047-1800069 TTAAAAATCTACTAGGAGGATGG + Intergenic
1169846756 20:10002188-10002210 TTATATATTTATTTGTAGTAAGG + Intronic
1170047750 20:12104121-12104143 TTATATAATTATTAATAGAATGG + Intergenic
1170059404 20:12243825-12243847 TTATATTTTTAGTTGGAAGAAGG - Intergenic
1171072259 20:22083413-22083435 TTATATATGTAATAGGAAGCAGG + Intergenic
1172019438 20:31902867-31902889 TTATTTATTTATTTAGAGAAAGG + Intronic
1172548170 20:35778087-35778109 TTATTTATTTATTTTGAGAAAGG + Intronic
1172730876 20:37086412-37086434 TTATATTTTTAATAGGGAGAGGG - Intronic
1172761151 20:37323416-37323438 TTATATATTTTTTAGAGGCAGGG + Intergenic
1172807382 20:37622154-37622176 GTAAATATTTATCAGAAGGAAGG - Intergenic
1173198425 20:40935101-40935123 TTATTTATATATTTGGGGGATGG - Intergenic
1173323628 20:42012247-42012269 TGATATAAGTATTGGGAGGAAGG - Intergenic
1173372558 20:42450734-42450756 TTATGTATTTAATATGATGAAGG + Intronic
1174220171 20:48947848-48947870 TTATATATTTATTTTGAGATGGG - Intronic
1174710605 20:52701008-52701030 TTTTATATTTCTTAGGAAAAGGG - Intergenic
1175430315 20:58897271-58897293 TTATTTATTTATTGTCAGGATGG - Intronic
1177241307 21:18461719-18461741 CTATATAATTAAAAGGAGGATGG - Intronic
1177466709 21:21493479-21493501 TTAGATATTCATTATCAGGAAGG - Intronic
1177478545 21:21655561-21655583 TTATATATTTAAGAGGAGAGAGG - Intergenic
1177672863 21:24256055-24256077 TTATTTATTTATTTAGAGAAAGG - Intergenic
1178557985 21:33610552-33610574 TTATTTATAAATCAGGAGGATGG - Intronic
1179211439 21:39327896-39327918 TTATTTATTTATTAAGAGACAGG - Intergenic
1179307923 21:40171561-40171583 TTTTTTTTTTTTTAGGAGGAGGG - Intronic
1179365528 21:40755444-40755466 TTATTTATTTTTTAGCAGGTGGG - Intronic
1179450348 21:41464321-41464343 GTATGTCTTTATTAGGAGCATGG + Intergenic
1180613921 22:17115293-17115315 TTATATATGTCTTAGGGGAAAGG + Exonic
1180925840 22:19554314-19554336 TTATTTAGTTATAAGGATGATGG + Intergenic
1182592864 22:31395553-31395575 TTATTTATTTATTATGAGACAGG - Intergenic
1183214417 22:36469955-36469977 TTATTTATTTATTTTGAGGGGGG - Intronic
1183914642 22:41107709-41107731 TTATTTATTTATTTGGAGTTTGG + Intronic
949495072 3:4623540-4623562 TTTAATATTTATTTGGGGGAAGG - Intronic
952441744 3:33337445-33337467 TTATATCCTTATTAGAAGGATGG + Intronic
952557806 3:34553213-34553235 TTCTATATTTCTTGGGAGAAGGG - Intergenic
953408255 3:42671139-42671161 GTTTTTATTTATTATGAGGAAGG - Intergenic
954065254 3:48100693-48100715 TTATTTATTTTTTAGGAACAGGG + Intergenic
955021585 3:55126855-55126877 TTATATTTCCATTTGGAGGATGG + Intergenic
955102846 3:55869012-55869034 TTATATGTTTATAATAAGGAAGG - Intronic
955133123 3:56190174-56190196 TTACATGTTTTATAGGAGGAAGG - Intronic
956339518 3:68206198-68206220 TTATGTGTTTATTAAGGGGATGG + Intronic
956362482 3:68463755-68463777 TTATAAATTTGGAAGGAGGATGG + Intronic
957194517 3:77050302-77050324 TTATATACTTAAGATGAGGAAGG - Intronic
957333332 3:78794581-78794603 TTATTTATTTATTTTGAGGCAGG + Intronic
957431689 3:80117702-80117724 TTAAATATGTTTTATGAGGAAGG - Intergenic
957684107 3:83477779-83477801 TTGTATTTTTACTAGGAGCAGGG - Intergenic
958535934 3:95403035-95403057 ATAAATGTTTATTAGCAGGAAGG - Intergenic
958595742 3:96219366-96219388 ATATACATTTACTAGCAGGATGG + Intergenic
958698433 3:97556330-97556352 GTATGTATTTATTAGCAGCATGG - Intronic
958706047 3:97656950-97656972 TTATACACTGATTAAGAGGATGG - Intronic
959530078 3:107425727-107425749 GAATATATTTATTCTGAGGAAGG - Intergenic
959581199 3:107984172-107984194 TTTACTATTTCTTAGGAGGAAGG - Intergenic
959693225 3:109221619-109221641 GTTTAGATTTATTAGGTGGAAGG - Intergenic
960821412 3:121736896-121736918 TTATTTATTTATTTAGAGGCAGG - Intronic
960981698 3:123234581-123234603 TTATATATTTTTTTTGAGGTAGG - Intronic
961559967 3:127721960-127721982 TTACATATTTAAAAGGTGGAAGG + Intronic
961921687 3:130432891-130432913 TTTTAAGTTTCTTAGGAGGAAGG - Intronic
961978786 3:131054741-131054763 TTATTTATTTATTTAGAGGCAGG - Intronic
962291300 3:134138542-134138564 TTATAGATTTAATAGTAGAAAGG + Intronic
962378724 3:134879644-134879666 TTATTTATTTATTTGGAGACAGG - Intronic
962793341 3:138830985-138831007 TTATTTATTTATTGGGGGCAAGG + Intronic
962896752 3:139722378-139722400 TTATTTAATTATTTGGGGGAGGG - Intergenic
963185292 3:142408690-142408712 TTAGATATTTACCAAGAGGAGGG - Intronic
963332050 3:143925448-143925470 TTATATATTCAGTAAGAGCAAGG - Intergenic
963886722 3:150590967-150590989 TTATTTATTTATTTGGAGACAGG + Intronic
964074923 3:152682304-152682326 TTATTTACTTATTTAGAGGAAGG - Intergenic
964354749 3:155840091-155840113 TTATTTATTTATTTTGGGGATGG + Intronic
964411156 3:156399159-156399181 TCTTGTATTTATTAGGATGAGGG - Intronic
964533630 3:157695565-157695587 TTATATTTTAATTAGAAGTATGG + Intergenic
964585894 3:158301400-158301422 TTATCTATTTATCAGGAGTAAGG + Intronic
966604261 3:181806420-181806442 TTATTTATTTATTTTGAGGCAGG - Intergenic
966606176 3:181823553-181823575 TTATTTATTTTTTAGGAGACAGG - Intergenic
966900865 3:184483340-184483362 TATTATATTTATTAGGATGAAGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
968498869 4:934905-934927 TTATGTATTTATTGGAATGAAGG + Intronic
970971581 4:21990366-21990388 TTATTTATTTATTTAGAGAAGGG - Intergenic
971671783 4:29568055-29568077 TTTTACATTTTTTATGAGGATGG + Intergenic
971802422 4:31309248-31309270 GTGTATATATATTAGAAGGAGGG - Intergenic
971881957 4:32387048-32387070 TTACATATTTATAAGGACCATGG + Intergenic
971997566 4:33984922-33984944 ATATATATTTAAAAGGAGGATGG - Intergenic
973154614 4:46935331-46935353 TTATATATTTATTAGGAGGAAGG - Intronic
973253729 4:48087439-48087461 TTATTTTTTTTTTTGGAGGAAGG + Intronic
973634245 4:52847100-52847122 TAATAGATTTATAGGGAGGATGG - Intergenic
973734643 4:53859091-53859113 TTATTTATTTATTTAGAGGCAGG + Intronic
973949799 4:56000182-56000204 TTATTTATTTATTTAGAGGCAGG - Intronic
974394866 4:61321872-61321894 ATATAAATTGGTTAGGAGGAAGG + Intronic
974684777 4:65213341-65213363 ATATATATTTATAGGAAGGAAGG - Intergenic
974758299 4:66242380-66242402 TTATTTATTTATTTTGAGGGGGG + Intergenic
974894608 4:67924278-67924300 ATATAGATTAATTAGGAGAATGG + Intronic
975027850 4:69575103-69575125 ATATTTATATATTAGGAGAAAGG + Intergenic
975237523 4:72016725-72016747 TTATATATTTTTTTAGAGAAAGG + Intergenic
975255151 4:72226109-72226131 CTATATATTCATTAGAAGAAAGG - Intergenic
976339069 4:83925050-83925072 TTATTTATTTATTTTGAGAAAGG - Intergenic
976853003 4:89570298-89570320 TTATATTATTTTGAGGAGGAAGG - Intergenic
976857524 4:89622533-89622555 ATATATATTTTTTAGGACAATGG + Intergenic
976950335 4:90820766-90820788 TTATAAAATTATTAAGTGGAGGG + Intronic
977299038 4:95246552-95246574 TTATTTATTTATTTGGAGAGAGG - Intronic
977428141 4:96895740-96895762 TTATATTCTTATCAGTAGGATGG - Intergenic
977466482 4:97388188-97388210 TTACATATATATTAGGACCAAGG - Intronic
977894504 4:102348378-102348400 TTATTTATTTTTTAAGAGGCAGG + Intronic
978072978 4:104493938-104493960 TTATTTATTTATTTGGAACAAGG - Intronic
978625012 4:110675456-110675478 TAGTATATGTATTTGGAGGAAGG + Intergenic
978981346 4:114950020-114950042 TGATATATTAATTAGGAACACGG + Intronic
979014129 4:115410538-115410560 TTATTTATTTATTTTGAGAAAGG - Intergenic
979717338 4:123856598-123856620 TTACATATTTATTCAAAGGATGG + Intergenic
979807459 4:124992343-124992365 TTGTATTTCTATTAGCAGGAAGG + Intergenic
980801460 4:137756124-137756146 TTATATATTTAATTCCAGGATGG + Intergenic
980838262 4:138224699-138224721 TTAAATATTTATTACAAGAAAGG + Intronic
981386210 4:144133561-144133583 TTATTTATTTATTTTGAAGATGG - Intronic
981510248 4:145548582-145548604 CTATCTATTTATTATGAGTATGG - Intronic
981587106 4:146315940-146315962 ATAAATATTTATTGGAAGGAGGG - Intronic
981647951 4:147021039-147021061 TTATTTATTTATTTGAAAGAGGG + Intergenic
981903689 4:149895221-149895243 TTATGTAGTTATTAGAAGGTGGG + Intergenic
981950066 4:150395553-150395575 TAATTTATTCATTAGGAAGATGG - Intronic
982634323 4:157873458-157873480 TAATAAATGTATTAGGAAGAAGG - Intergenic
982934531 4:161455245-161455267 TAATATATTGATTTTGAGGATGG - Intronic
982938881 4:161522778-161522800 TTATACTTTTATTAGCAGTATGG - Intronic
983022493 4:162695593-162695615 ATCTATATTAATTAGGAGTATGG + Intergenic
983047769 4:163007141-163007163 TTATAAAATTATTAGGAGGAAGG - Intergenic
983104171 4:163665005-163665027 TTTAATATTTTTTTGGAGGAGGG + Intronic
983229677 4:165116466-165116488 TTATTTACTTATGAGGAGTAAGG + Intronic
984047797 4:174823208-174823230 TTGTTTTTTTATTAGGTGGATGG - Intronic
984090344 4:175365876-175365898 TTTTATATATACTAGGAGAAAGG + Intergenic
984733153 4:183087165-183087187 TTATGTATTTATTTTGAGGCAGG + Intergenic
984991925 4:185389211-185389233 TTATTTATTTATTTTGAGAACGG + Intronic
985010071 4:185573350-185573372 GTATATATTTTATAGGAGAAAGG + Intergenic
985155325 4:186982003-186982025 TAACATATTTATTAGCAGTAAGG + Intergenic
985419318 4:189767863-189767885 TGAGAAATTTATAAGGAGGAAGG + Intergenic
985989758 5:3545964-3545986 TTACTTATTTGTCAGGAGGAAGG + Intergenic
986019520 5:3788343-3788365 TTTTATGTTATTTAGGAGGAAGG - Intergenic
986092833 5:4527150-4527172 TTATTTATTTTTTTGGAGGAGGG - Intergenic
987107908 5:14659093-14659115 TTATTTATTTATTTGGAGACAGG + Intergenic
987381294 5:17288433-17288455 GTATATCTTTATTAGCAGCATGG - Intergenic
987678058 5:21101074-21101096 TTATATATTTATAAGAAAGAAGG + Intergenic
987730121 5:21759408-21759430 TTATTTATTTATTTAGAGGGAGG - Intronic
987807824 5:22792871-22792893 TTATATATTTATTTAGATAAAGG + Intronic
987968597 5:24910365-24910387 TTATATATATATTAGGTTGGTGG + Intergenic
988535879 5:32067819-32067841 TTCTATATTTATTAGTATCATGG - Intronic
989377670 5:40781772-40781794 ATATAACTATATTAGGAGGATGG + Intronic
989400417 5:41002058-41002080 TTTTAGATTTATTAGGAATAAGG + Intronic
990224651 5:53635512-53635534 TTATTTATTTATTTTGAGAAAGG - Intronic
990539996 5:56763145-56763167 TTATATTTTTAGTAGGATGGGGG - Intergenic
990757057 5:59084714-59084736 TTATTTATTTTTTAGGAGACAGG - Intronic
990796385 5:59546277-59546299 TTTTGTATTTTTTATGAGGAGGG + Intronic
990814761 5:59771124-59771146 TTATTTATTTATTTTGAGGCTGG - Intronic
990905697 5:60800931-60800953 TTATGTATTTATTTGGAGACAGG + Intronic
990970039 5:61495592-61495614 TTACATTTTGATTAGGGGGAAGG - Intronic
991073204 5:62509520-62509542 TTATAATTTTGTTAAGAGGATGG - Intronic
991358993 5:65800688-65800710 TTATTTATTTATTTTGAGGCAGG + Intronic
991384476 5:66070047-66070069 TTATTTATTTATTTTGAGGCGGG + Intronic
991470719 5:66966411-66966433 TTGTATATTTATTTGGTGGTTGG - Intronic
991491618 5:67189198-67189220 TTATATATTCAGGAGAAGGAGGG - Intronic
992518710 5:77524584-77524606 TTATCTATTTATTTGGAGACAGG - Intronic
992652801 5:78877392-78877414 TTATTTATTTATTTTGAGGCAGG + Intronic
992839690 5:80675898-80675920 TTATATCTAGATTTGGAGGAGGG + Intronic
993197799 5:84771885-84771907 TTAAATATTTAAAAGGAGAAAGG - Intergenic
993260952 5:85657537-85657559 TTATTTATTTATTTTGTGGATGG + Intergenic
993382566 5:87224536-87224558 TTATTTATTTATTTAGAGAAAGG + Intergenic
994278603 5:97870710-97870732 TTATATTATTATTAGAAGAAAGG - Intergenic
994660706 5:102650588-102650610 TTATATGCCTATTAGGATGATGG + Intergenic
994715263 5:103314139-103314161 TTAAATATTTAATAATAGGAGGG + Intergenic
995840995 5:116443108-116443130 TTACATATTAATAAGGTGGAGGG - Intergenic
996649236 5:125853497-125853519 TTAAATAATTATTAGTAGGAGGG - Intergenic
996758825 5:126966244-126966266 TTATATATTTATTGGGATGATGG + Intronic
996796913 5:127357580-127357602 TTATTTATTTATTTTGAGGCAGG - Intronic
997388312 5:133492371-133492393 GTATATATACTTTAGGAGGAAGG - Intronic
998343338 5:141438658-141438680 GTATATATATATTTGGAGTAGGG + Intronic
998436462 5:142113507-142113529 TTATAAAAATATTAGGAAGATGG + Intronic
998550177 5:143069832-143069854 TTTTGTATTTATTATGATGATGG - Intronic
998638575 5:143984431-143984453 TTATATTTTTTTTAGGAGGAGGG - Intergenic
999103843 5:149051455-149051477 TTATTTATTTATTTTGAGGCAGG + Intronic
1000191298 5:158913619-158913641 TTATGTATTGCTTGGGAGGAGGG + Intronic
1000227021 5:159272915-159272937 TTAAATATTTGTGGGGAGGAGGG - Intronic
1000241761 5:159415212-159415234 TTATGTATTTTGTAGGAGAATGG - Intergenic
1000565166 5:162837445-162837467 TTATATATATATAAGAAGAAAGG - Intergenic
1001276843 5:170357534-170357556 TTATTTATTTATTTTGAGGCAGG + Intronic
1002896721 6:1383977-1383999 ATATTTATTTATTTGGGGGAAGG + Intergenic
1003235683 6:4293619-4293641 TTATTTATTTATTTTGAGAAAGG - Intergenic
1003703843 6:8501095-8501117 TTATTTATTTTTTTGGGGGAGGG - Intergenic
1003781852 6:9437487-9437509 ATATATATTTTTTAGGGGGAAGG + Intergenic
1004050520 6:12073684-12073706 TTTTATTGTTATTAGAAGGAGGG + Intronic
1004552929 6:16667137-16667159 TTCTTTATTTATTAGAAGGCGGG - Intronic
1004558321 6:16721619-16721641 TTATTTATTTTTTAAGAGGCAGG - Intronic
1004747296 6:18523720-18523742 TGTTATTTTTATTAGGAGCATGG - Intergenic
1005495112 6:26381681-26381703 TTATTTATTTATTTTGAGGCAGG + Intergenic
1005588476 6:27300273-27300295 TTATGTATTTATTATCAGTATGG + Intronic
1006624378 6:35386952-35386974 TTATATATTTGTCAGGAGGTGGG + Intronic
1006624384 6:35386990-35387012 TTATATATTTGTCAGGAGGTGGG - Intronic
1006875803 6:37295106-37295128 TTATTTATTTATTTGGAGACAGG + Intronic
1007042758 6:38739633-38739655 TTATTTATTTATTTTGAGGCTGG - Intronic
1007649449 6:43409257-43409279 TTATATATTTATTAGAGATAGGG - Intergenic
1008064422 6:47032162-47032184 TTTTATTTTTTTAAGGAGGAGGG - Intronic
1008284466 6:49630581-49630603 TAATATATTTAGAGGGAGGAAGG - Intronic
1008366384 6:50685647-50685669 TTATATATTTCCTATGAAGAAGG - Intergenic
1008410232 6:51169597-51169619 TGATATATTTTTCAGGAAGAGGG + Intergenic
1008904077 6:56657102-56657124 TTAAATAATTATTAGAAAGAAGG - Intronic
1009434563 6:63603088-63603110 TTATATTTTTATTAGGCACAGGG + Intergenic
1009605381 6:65860663-65860685 TTTTTTATTTTTTTGGAGGAAGG - Intergenic
1009611475 6:65947153-65947175 TTATTTATTTATTTAGAGAAAGG + Intergenic
1009638524 6:66299916-66299938 TTATTTATTTATTACGGAGATGG + Intergenic
1009698143 6:67137090-67137112 ATATATATATATTTGGAGGGGGG - Intergenic
1009723936 6:67511462-67511484 TTATTTATTTATTTTGAGGCAGG + Intergenic
1009771453 6:68147503-68147525 TTATTAAATTATTAAGAGGATGG + Intergenic
1010394596 6:75376037-75376059 TTATATATTTTTTAAGTGGAGGG - Intronic
1010921834 6:81691999-81692021 TTATTTATTTATTTGGAGACAGG + Intronic
1010985931 6:82424035-82424057 TTAAATATTAATTAAGAGGCTGG - Intergenic
1011143119 6:84182487-84182509 TTAGATATTTATTAATAGGAAGG - Intronic
1011175080 6:84551254-84551276 TTATTTATTTATTTGGAGGTTGG + Intergenic
1011579301 6:88841488-88841510 ATTTATATTTTTTGGGAGGAGGG - Intronic
1011594245 6:89001194-89001216 TTATTTATTTATTAAGAGACAGG + Intergenic
1012271476 6:97217598-97217620 TTATATAATTATTAGGAACTGGG + Intronic
1012291378 6:97459584-97459606 TTATTTATTTATTAGAGAGACGG - Intergenic
1012403733 6:98868971-98868993 TTATATATTTTTTATAAGTAGGG - Exonic
1012874591 6:104711777-104711799 TTATGTATTTATTTTGAGGCAGG + Intergenic
1013242464 6:108259236-108259258 TTATTTATTTATTTAGAGAAGGG + Intronic
1013277519 6:108600020-108600042 TTTTATATGTATAAGGAGGGTGG + Intronic
1013402326 6:109810751-109810773 TTTTATATTTAATAAGATGAGGG - Intronic
1013557252 6:111269197-111269219 TTATTTATTTATTAGGGGTGGGG + Exonic
1014964483 6:127730095-127730117 TTATTTATTTATTAGAAACAGGG - Intronic
1015179038 6:130342189-130342211 ATATATATTTATTAGACAGAGGG - Intronic
1015357546 6:132296755-132296777 TTTTATATTTTTTAAAAGGAAGG + Exonic
1015361421 6:132343988-132344010 TTCTATATCTATTAAGAGAAAGG + Intronic
1015397794 6:132754481-132754503 ATAAATATTAATTAAGAGGAGGG - Intronic
1015846811 6:137529020-137529042 TTCTAGATTTTTTAGGGGGAGGG + Intergenic
1016006115 6:139090900-139090922 TTATTTATTTATTTTGAGGCAGG - Intergenic
1016255976 6:142105824-142105846 TTATAATTTTTTTAGAAGGATGG + Intergenic
1016587614 6:145707753-145707775 GTATATCTTTATTAGCAGCATGG + Intronic
1017291129 6:152738864-152738886 TTATATATTTTTTATCAGCATGG - Intergenic
1017786290 6:157759683-157759705 TTCTATATTTATTTGGAGACAGG - Intronic
1017924170 6:158896493-158896515 GGATGTATTTATTAGAAGGACGG - Intronic
1019371311 7:663396-663418 TTTTTTAATTTTTAGGAGGAGGG + Intronic
1020192069 7:6008161-6008183 TCAGATATTTATTTTGAGGAGGG + Intronic
1020264325 7:6550393-6550415 TTATATATTGATCAAGAGGGTGG + Intronic
1020340382 7:7103708-7103730 TTATTTATTTATTTGGAGACAGG + Intergenic
1020465201 7:8470698-8470720 TTACATATGTATTAGTATGATGG + Intronic
1020766392 7:12327007-12327029 TTATTTATTTATTAGGAATAAGG - Intergenic
1021243045 7:18228710-18228732 TTATGTTTTCAGTAGGAGGAAGG + Intronic
1021482963 7:21138226-21138248 TTATTTATTTATTATGAATAGGG + Intergenic
1021608383 7:22432364-22432386 TTATTTATTTATTAGGTATAGGG - Intronic
1021906526 7:25339344-25339366 TTATATTTTTAGCAGGAGAACGG + Intergenic
1022203249 7:28138158-28138180 TTATGTATTTATTACCAGAAGGG + Intronic
1022279306 7:28890154-28890176 TTGTATTTTTAGTAGAAGGAGGG + Intergenic
1023650182 7:42361252-42361274 TTATTTATTTATTTAGAGGCTGG - Intergenic
1024791624 7:52971086-52971108 TTATTTATTTATTTAGAGGCAGG + Intergenic
1025105432 7:56167262-56167284 TTATATATTTTTTATAAAGATGG + Intergenic
1025266517 7:57463680-57463702 TTATTTATTTATTTAGAGGCTGG + Intronic
1025720453 7:64006837-64006859 TTATTTATTTATTTAGAGGCTGG + Intergenic
1026897941 7:74021366-74021388 TTATTTATTTATTTGGAGACAGG - Intergenic
1027183854 7:75958120-75958142 TTATTTATTTATTTTGAGGCAGG + Intronic
1027353210 7:77332740-77332762 TTACATGTTTTTTAGGAGGGGGG + Intronic
1027813005 7:82929875-82929897 GTAAATATTTATTAGACGGATGG - Intronic
1028345292 7:89773260-89773282 TTATTTATTTATTTTGAGGCAGG + Intergenic
1028440531 7:90854521-90854543 TTATGTATTTATTTAGAGGCAGG - Intronic
1028445133 7:90913547-90913569 ATATATTCTTATTAGGAGAAAGG + Intronic
1029622924 7:101701223-101701245 TTATTTAATTATTTGTAGGAAGG + Intergenic
1029858422 7:103542933-103542955 TTATATTTTTAAAAGGAGTATGG + Intronic
1030135977 7:106248634-106248656 TTATATCTTAAATAGGAGGTAGG - Exonic
1030244019 7:107360993-107361015 TTGATGATTTATTAGGAGGATGG - Intronic
1030283173 7:107798040-107798062 TTCTATAATTAGTAAGAGGAAGG - Intronic
1030587895 7:111443864-111443886 TTTTTTATCTATTAGAAGGAAGG + Intronic
1031038429 7:116813690-116813712 TTATTTATTTATTTGGAACAGGG + Intronic
1031067076 7:117116600-117116622 TTCAATATTTATTAGAAGGACGG + Intronic
1032046280 7:128611630-128611652 TTATATATTTATTTTGAGACAGG + Intergenic
1032168059 7:129561380-129561402 TTATATATTTATTGAGGGCAGGG + Intergenic
1033051270 7:138006628-138006650 TTATTTATTTATTTGGAGACAGG + Intronic
1033214960 7:139486729-139486751 TTTTATATATATTATAAGGATGG + Intergenic
1033735390 7:144216661-144216683 TTATATATTTATGAGTAATATGG + Intergenic
1033747665 7:144334308-144334330 TTATATATTTATGAGTAATATGG - Intergenic
1034646721 7:152654021-152654043 TTATATTTTTAGTAGAAGCAGGG - Intronic
1036979983 8:13459870-13459892 TTATAATTTTATGAGTAGGAGGG + Intronic
1037069951 8:14632021-14632043 TTATTTATTTATTTGGAGATAGG + Intronic
1038144488 8:24882398-24882420 TCATATATTAACTAGGAGAAGGG - Intergenic
1039800594 8:40951411-40951433 TTATTTATTTATTTGGAGATGGG + Intergenic
1039918556 8:41876972-41876994 TTATTTATTTATTTTGAAGATGG - Intronic
1039952647 8:42183946-42183968 TTATGTATTTATTTTGAGGCAGG + Intronic
1040810501 8:51447397-51447419 TTAAAAATTCATTAGGAGGCTGG - Intronic
1040886994 8:52275669-52275691 TTTAATATTTTTTAGGAGGAAGG + Intronic
1041074671 8:54158527-54158549 TTATATATTTATTAGAGACAGGG + Intergenic
1041199149 8:55433715-55433737 TTAAATGAGTATTAGGAGGAAGG + Intronic
1041253222 8:55954827-55954849 TTATTTATTTATTTTGAGGCAGG - Intronic
1041698412 8:60761778-60761800 TAATCTATTTATTAACAGGAAGG - Intronic
1041858888 8:62488526-62488548 ATAAATATTTATTGAGAGGATGG - Intronic
1041952531 8:63519811-63519833 ACATATATTTATTAGGAATAGGG + Intergenic
1041989627 8:63970885-63970907 TTTCATATTTTTTAGGTGGATGG - Intergenic
1042041008 8:64588442-64588464 TCATTTTTTTATTAGGAGGATGG + Intronic
1042064811 8:64862860-64862882 TAATGTAGTTATTAGGAGCATGG + Intergenic
1042172261 8:66003253-66003275 TGATATATTTTTCAGGAGGATGG + Intergenic
1042214748 8:66419051-66419073 TCATATATTTGATAGGAGAAGGG + Intergenic
1042439139 8:68804772-68804794 TTATTTATTTATTTTGAGGCAGG - Intronic
1042604390 8:70531096-70531118 TTATATATGTATTTGGGAGATGG - Intergenic
1042664052 8:71187043-71187065 TTGTATATTCATTTGGAGGCAGG + Intergenic
1043274805 8:78379527-78379549 TTATATTTTTATTAGAGGCAGGG - Intergenic
1043280791 8:78463687-78463709 TTATGTATTTATTTGAAGTAGGG - Intergenic
1043281837 8:78477987-78478009 TTATATATTGACTAGGAAAAAGG - Intergenic
1043308231 8:78823629-78823651 TCATGTATTTATTAGCAGTATGG + Intergenic
1043345991 8:79297848-79297870 GTATATCTTTATTAGCAGCATGG + Intergenic
1043373408 8:79619765-79619787 TTGAATATTTATTATGAGAAGGG - Intronic
1043409091 8:79973484-79973506 TTATTTATTTATTTGGAGATGGG - Intronic
1043704795 8:83334749-83334771 TTATATATTTAATAAGAAAATGG + Intergenic
1043763924 8:84105038-84105060 TTATTTATTTATTTGGAGACAGG - Intergenic
1044034864 8:87288370-87288392 TTATATTTTTATTAAAAGCATGG - Intronic
1044337157 8:91000125-91000147 CTTTATATTTATCAGGAAGATGG - Intronic
1044372740 8:91432508-91432530 TTAGATATTTTTAAGAAGGATGG - Intergenic
1044797369 8:95917647-95917669 TTATTTACTAATTAGGTGGAGGG + Intergenic
1044802528 8:95972020-95972042 GTATTTATTTATTAGGAGCTGGG + Intergenic
1044936126 8:97295027-97295049 TTCTATTTTTATTTTGAGGATGG - Intergenic
1045106121 8:98894335-98894357 TCAGATATTTTTTTGGAGGAAGG - Intronic
1045142050 8:99297010-99297032 ATATATATATATGAGGGGGAGGG + Intronic
1045670886 8:104552334-104552356 TTATACATTTATTAGATTGATGG - Intronic
1046017189 8:108619137-108619159 TTATATAGTTATTAAGTGGTAGG + Intronic
1046164975 8:110420714-110420736 TTTTAAATTTATTAGGTGAATGG + Intergenic
1046165196 8:110424563-110424585 TTATTTATTTATTTAGAGGCAGG - Intergenic
1046262851 8:111792900-111792922 TTATATATTAAATAGCATGATGG - Intergenic
1047271913 8:123368425-123368447 TTATTTATTTATTTTGGGGAGGG - Intronic
1047450355 8:124960031-124960053 TTGTATATTTATTAGAGAGAGGG - Intergenic
1047453031 8:124983680-124983702 TTATTTATTTATTTAGAGAAAGG - Intergenic
1047752889 8:127895464-127895486 TTATTTATTTATTTGGGAGATGG - Intergenic
1047822531 8:128537112-128537134 TTATATTGTTATTAGGTAGAAGG + Intergenic
1047926579 8:129688472-129688494 TTGCCTATTTGTTAGGAGGAGGG + Intergenic
1048165177 8:132055883-132055905 TTATATGTTTAACAGGGGGACGG + Intronic
1048659943 8:136587886-136587908 TTATATATTTATAAATAAGAAGG - Intergenic
1050225128 9:3445243-3445265 TTATAAATTTATTGAGAGAAGGG + Intronic
1050593395 9:7182671-7182693 GTATGTATTTATTAGCAGCATGG + Intergenic
1050607632 9:7317879-7317901 TTCTATATATTTTAGGAAGATGG + Intergenic
1051084038 9:13327040-13327062 GTCCATATTTAATAGGAGGAAGG + Intergenic
1051875379 9:21787609-21787631 TTATTTATTTATTAGAGGCAAGG - Intergenic
1051993300 9:23180418-23180440 TTATATATTGATAAGGAAGATGG - Intergenic
1052417228 9:28191590-28191612 TTAAATATTTTTAAAGAGGAAGG - Intronic
1052983704 9:34468933-34468955 TTATATATGTATTTGGAACATGG + Intronic
1053216827 9:36278568-36278590 GGATATTTTTATTGGGAGGAGGG - Intronic
1053387494 9:37705952-37705974 TTATTTATTTATTTTGAGGGAGG - Intronic
1054772138 9:69093009-69093031 TTATGTAGTTATTAGGAAAAAGG + Intronic
1054812321 9:69444764-69444786 ATATTTATTGATTAGGTGGATGG - Intronic
1055456273 9:76474916-76474938 TAATATATTTATCTGGAGGCTGG + Intronic
1055472691 9:76629014-76629036 TTATATATTTAGTAGGAATGGGG + Intronic
1056014677 9:82371330-82371352 GTATATATTTATTAGCAGAGTGG + Intergenic
1056139767 9:83664578-83664600 TTATTTATTTATTAAGAGATCGG - Intronic
1056340200 9:85622228-85622250 TTATAGATTTATTGAGAGCAGGG + Intronic
1056828898 9:89898407-89898429 TCATATATTTTTTAGGAGGTGGG + Intergenic
1057330325 9:94108409-94108431 TTTTATATTTGTTACGAAGAAGG + Exonic
1058042766 9:100322619-100322641 ATATATATTTTTTGGGGGGATGG + Intronic
1058327834 9:103720246-103720268 GTATTTCTTTATTAGGTGGATGG - Intergenic
1058344186 9:103940268-103940290 TAATATATTTACTAGAAGGTTGG + Intergenic
1058635144 9:107031359-107031381 TTATATTTTTATCAGGAGTGTGG - Intergenic
1058769585 9:108217158-108217180 TTATATATTTATTTAGAGATGGG - Intergenic
1058972503 9:110096437-110096459 TTATTTATTTATTAAGATGGGGG + Intronic
1061756290 9:132814758-132814780 TTAAATTTTAAATAGGAGGAAGG + Intronic
1203491382 Un_GL000224v1:108623-108645 TTAAAAATTTGTTAAGAGGATGG - Intergenic
1203504006 Un_KI270741v1:50493-50515 TTAAAAATTTGTTAAGAGGATGG - Intergenic
1185803226 X:3032276-3032298 TTATTTATTTATTTTGAGGCAGG - Intronic
1186553648 X:10533905-10533927 TTATATATTTATTTGCAGAGTGG - Intronic
1186893078 X:13979214-13979236 TTATTTATTTATTTTGAGAAGGG - Intergenic
1187156246 X:16722737-16722759 TTGTAAATTTATCAGGAGGGAGG - Intronic
1187818959 X:23264836-23264858 TTATATTTTTAGTAGGGGGGTGG + Intergenic
1188568577 X:31554732-31554754 TTAAATATTTATTATGTGGTAGG + Intronic
1188615031 X:32147508-32147530 TTATCTATTTAATAGGAATATGG - Intronic
1192589092 X:72345075-72345097 TCAACTATTTATCAGGAGGAGGG + Intronic
1193093837 X:77525891-77525913 TTATATATTTAATGGTTGGAGGG + Intronic
1193842367 X:86422560-86422582 GTATATATTTATTGGGAACATGG + Intronic
1194162915 X:90477285-90477307 TTATTTATTTATTGTGAAGAAGG - Intergenic
1194182385 X:90728972-90728994 TTAAATATTTGTTAAGAGGATGG + Intergenic
1195077488 X:101341015-101341037 TTTAATTTTTATTAGGGGGAGGG - Intergenic
1195340703 X:103903756-103903778 GTTTATATTTATCAGGAAGATGG - Intergenic
1195516814 X:105786334-105786356 TAATATATATATCAAGAGGAAGG + Intergenic
1195611878 X:106876747-106876769 TTACATAATTATCAGGAGGATGG + Intronic
1195832937 X:109079961-109079983 TTATTTATTTATTTCGAGGCTGG + Intergenic
1195851220 X:109283866-109283888 TAATAAAAGTATTAGGAGGAAGG - Intergenic
1195926553 X:110031491-110031513 TTATATATTTTTTAAGAGATGGG + Intronic
1196020881 X:110989859-110989881 TGTTATATTCTTTAGGAGGAGGG - Intronic
1196365721 X:114921545-114921567 TTATGTATTTATTTTGAGGCAGG + Intergenic
1196700081 X:118658712-118658734 TTTTATATTTTTTGGGAGGAAGG - Intronic
1197191724 X:123654925-123654947 TTATAGGTTTATTAGGAGGAGGG + Intronic
1197250655 X:124213207-124213229 TTATATATATATGAGAAAGAGGG - Intronic
1197816185 X:130501045-130501067 TTATATATTTATTTTGAGACAGG + Intergenic
1198630556 X:138633165-138633187 GTATATATTTATTATGAACAAGG - Intronic
1198697901 X:139363333-139363355 TTCGATATTTATGAGTAGGAAGG - Intergenic
1199229491 X:145419641-145419663 TTTTATATGGTTTAGGAGGAGGG + Intergenic
1200204047 X:154303215-154303237 TTATTTATTTATTTTGAGGCAGG + Intronic
1200345645 X:155444695-155444717 TTATTTATTTATTTTGAGGCTGG + Intergenic
1200509189 Y:4055016-4055038 TTATTTATTTATTGTGAAGAAGG - Intergenic
1200529005 Y:4310926-4310948 TTAAATATTTGTTAAGAGGATGG + Intergenic
1201647146 Y:16247449-16247471 TTATTTATTTATTTTGAGGCAGG + Intergenic
1201655665 Y:16337853-16337875 TTATTTATTTATTTTGAGGCAGG - Intergenic