ID: 973154931

View in Genome Browser
Species Human (GRCh38)
Location 4:46939046-46939068
Sequence GCAACAAGTAAGTTTTAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973154930_973154931 13 Left 973154930 4:46939010-46939032 CCTCTTTGTGGAAGTAATACTTA 0: 1
1: 0
2: 2
3: 21
4: 200
Right 973154931 4:46939046-46939068 GCAACAAGTAAGTTTTAAATAGG 0: 1
1: 0
2: 2
3: 16
4: 240
973154928_973154931 30 Left 973154928 4:46938993-46939015 CCTGGGAGATGGGAAAACCTCTT 0: 1
1: 0
2: 1
3: 23
4: 213
Right 973154931 4:46939046-46939068 GCAACAAGTAAGTTTTAAATAGG 0: 1
1: 0
2: 2
3: 16
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973154931 Original CRISPR GCAACAAGTAAGTTTTAAAT AGG Intronic
905710083 1:40094692-40094714 GGAATAAGTAAGTTCAAAATGGG - Intronic
906475690 1:46167854-46167876 GCCACAGGTAGTTTTTAAATTGG - Intronic
907605507 1:55813544-55813566 TTAAAAAGGAAGTTTTAAATTGG + Intergenic
908823759 1:68114459-68114481 GCATATAGTAAGTTTTAAAAAGG - Intronic
909117312 1:71554534-71554556 GCAACCAGAAAGTCTTATATTGG + Intronic
909947070 1:81675909-81675931 GCAAAATGAAGGTTTTAAATTGG + Intronic
909962519 1:81864252-81864274 GCAAGAAGTTTTTTTTAAATGGG + Intronic
910819390 1:91329490-91329512 GCAGCAAGGAAGTTTAAAAGGGG + Intronic
911222975 1:95270328-95270350 GTTACAAGTAAGAATTAAATAGG - Intergenic
912653605 1:111464621-111464643 GGAGCAAGTAATATTTAAATTGG + Intergenic
915658070 1:157377852-157377874 GGAAGAATTAAGTTTTAAAGTGG + Intergenic
915940519 1:160115727-160115749 GCAACAGGGTAGCTTTAAATAGG - Intergenic
919138272 1:193538054-193538076 ACAATTTGTAAGTTTTAAATTGG + Intergenic
919346000 1:196379269-196379291 GCCACATATAATTTTTAAATAGG - Intronic
921083425 1:211763764-211763786 CCAACAAATAAATTTTAAATAGG - Intronic
923947930 1:238911033-238911055 ACAAGAAATAATTTTTAAATGGG + Intergenic
924705359 1:246496924-246496946 GCAACAAGTAAACTTTAAAAAGG + Intronic
924874752 1:248090034-248090056 GCTACAGGTAAGTTTTTAAAGGG - Intronic
1063440752 10:6070973-6070995 GCTACAAGGCAGTTTTCAATTGG - Intergenic
1064093327 10:12403955-12403977 GCAACAGGAAAGTTTTCAATTGG - Intronic
1066307098 10:34156065-34156087 GCTACAGATAAGTATTAAATTGG + Intronic
1066449523 10:35515959-35515981 GGACAAAGTAAGTTTTAAAGGGG - Intronic
1068262689 10:54603365-54603387 GCAAAAAATAAATTTTAAAAAGG - Intronic
1071047956 10:81406682-81406704 TCAACAAGCAAGTTGTAAATAGG - Intergenic
1071353599 10:84770810-84770832 GCAAGGAGTCAGTTTTCAATAGG + Intergenic
1071696303 10:87876642-87876664 GCAACAGCAAAATTTTAAATGGG - Intronic
1074326203 10:112454096-112454118 GGAACAGATAATTTTTAAATGGG - Intronic
1074478314 10:113793625-113793647 GAAACAAGCAGGTCTTAAATTGG + Intergenic
1074757211 10:116632928-116632950 GAAACAATTAAGTTTGAAACAGG + Intronic
1078418847 11:11190064-11190086 GCCACAAGTCAGTTTAATATTGG + Intergenic
1079995580 11:27292057-27292079 GAAACAGGTAAGTTTTGAAGAGG + Intergenic
1080656375 11:34261873-34261895 GCAACAAGTCTGATTTAATTTGG - Intronic
1081506301 11:43720732-43720754 GCACCTAGTAAGTTTAAACTTGG + Intronic
1082142574 11:48627217-48627239 CCAAAAAATATGTTTTAAATAGG + Intergenic
1082569776 11:54724585-54724607 CCAAGAAATATGTTTTAAATAGG + Intergenic
1082738082 11:56879051-56879073 GAACCAGGTAAATTTTAAATTGG - Intergenic
1086061847 11:82708079-82708101 GAAAAAAGAAATTTTTAAATGGG + Intergenic
1086430835 11:86735280-86735302 GCAAGAAGTAACTTTCAAAATGG + Intergenic
1086437340 11:86795261-86795283 GCACAAAGTAAATTCTAAATTGG - Intronic
1086809783 11:91294534-91294556 GCAAAAAGTATATTTTAAAAAGG + Intergenic
1087107094 11:94421594-94421616 GCAACATGTTAGTATTTAATAGG + Intronic
1087286739 11:96272101-96272123 GAAAGGAGTCAGTTTTAAATAGG - Intronic
1088289337 11:108219620-108219642 AAACCAAGTAAGTTTCAAATTGG + Intronic
1090341888 11:126030416-126030438 ACTACAAGAAAGTTTGAAATAGG - Intronic
1090548320 11:127790650-127790672 GCTTTAAGTAAGTTTTAAAATGG - Intergenic
1091741939 12:2965458-2965480 GCTACTAGAAAATTTTAAATTGG - Intronic
1092705486 12:11279495-11279517 GCAAAAACTAAGTGTTACATGGG + Intergenic
1092988508 12:13871075-13871097 GCAACAACTAAAATTTACATGGG + Intronic
1093451363 12:19319047-19319069 ATATGAAGTAAGTTTTAAATAGG - Intronic
1093984278 12:25511678-25511700 GCAACAATTGGATTTTAAATAGG - Intronic
1094871300 12:34600593-34600615 GCAACAGGAAGGTTTGAAATGGG + Intergenic
1097114283 12:56686181-56686203 GCGAAAAGTATGTTTAAAATTGG - Intronic
1097745278 12:63294955-63294977 GCAAGCAGTAAGTTTAAATTTGG + Intergenic
1098704616 12:73671780-73671802 GCAGCCAGGAAGTTTGAAATGGG + Intergenic
1100436490 12:94576084-94576106 GCAACAATTAACGTTTAAATGGG + Intronic
1101574208 12:105982558-105982580 GAAACAAGAAAGCTTTGAATTGG - Intergenic
1102636525 12:114329357-114329379 GGAACAAGTAGATATTAAATAGG - Intergenic
1102688615 12:114743253-114743275 GCAAGATGAAAATTTTAAATTGG - Intergenic
1103754948 12:123197470-123197492 CCAAAAGGTAAGTTTTAAAAGGG + Intronic
1104138084 12:125959490-125959512 ACAACAAGTAAAATTTAAAAAGG - Intergenic
1106385289 13:29278959-29278981 ACAACAAGTCAGTTTTTCATGGG - Intronic
1107150759 13:37107933-37107955 GCAACAAATAGTTTTTAAAATGG + Intergenic
1107191164 13:37588355-37588377 GCAACACTTAAGTTTTAACAAGG + Intronic
1107551984 13:41485443-41485465 GCAACAACGAAGTTTAAAAGTGG - Intergenic
1108633023 13:52304584-52304606 ACAACAAAAAAGTTTAAAATAGG + Intergenic
1108653668 13:52507971-52507993 ACAACAAAAAAGTTTAAAATAGG - Intergenic
1109410908 13:61968031-61968053 CTAACAATTATGTTTTAAATAGG - Intergenic
1109759188 13:66804692-66804714 GAAATAAGTAATTTTTATATAGG - Intronic
1110547313 13:76769837-76769859 GCAAAAAATAAATTCTAAATGGG - Intergenic
1111517947 13:89359649-89359671 GCAATAAATATGTTTTATATAGG - Intergenic
1111873897 13:93868997-93869019 CCAAAAATTAAGTTTTAAAATGG - Intronic
1115666787 14:35559110-35559132 GCAAAAGTTAAGATTTAAATAGG + Intronic
1116844357 14:49851497-49851519 CTAACAATTAAGTTTTTAATTGG - Intronic
1116886740 14:50229748-50229770 GCTACCAGAAAGTTATAAATGGG + Intronic
1117595325 14:57321221-57321243 CCACCAAGTATGTTTTAAAGTGG + Intergenic
1118120933 14:62841621-62841643 GCAAAAACTAAGATTTAAAATGG + Intronic
1118211319 14:63768407-63768429 GCATCAAACAAGTTTTAACTGGG - Intergenic
1118337928 14:64870219-64870241 GCAACATGTAAGTTTTACAGAGG + Intronic
1118801977 14:69198635-69198657 GCTACTAGAAAATTTTAAATTGG - Intronic
1120592617 14:86393604-86393626 GGAGCATGTAAGTCTTAAATTGG - Intergenic
1120602730 14:86532018-86532040 GCAATAAGGAAGTTTTCACTGGG + Intergenic
1121370352 14:93352269-93352291 GGAAAAAGTAAGTTCAAAATTGG - Intronic
1121899011 14:97675006-97675028 GCCACAGGGAAGTTTGAAATGGG + Intergenic
1125471348 15:40007396-40007418 CCACCAATTAAGTTTTAAAAGGG - Intronic
1130037374 15:80373651-80373673 GCATCAAGTAATTTTTATGTTGG - Exonic
1130236816 15:82142876-82142898 GGAACAAGTAATTTTTGAATGGG - Intronic
1131783305 15:95883354-95883376 CCAACATGCAGGTTTTAAATTGG - Intergenic
1131982436 15:98007343-98007365 GTTAGAAGTAAGTTTAAAATAGG - Intergenic
1132421538 15:101674040-101674062 ACAACTCATAAGTTTTAAATTGG + Intronic
1133428110 16:5710945-5710967 GCAATAAATATGTTTTTAATAGG - Intergenic
1133516119 16:6510884-6510906 GCCACTAGTAAGTATTAAAGAGG - Intronic
1137878886 16:52025698-52025720 GCAAAAATTGAGTTTTAAAGAGG - Intronic
1139814631 16:69658535-69658557 GCCACAAGTTAGTTTTTAAAGGG - Intronic
1140265272 16:73415397-73415419 GCAACCATTAAGCCTTAAATGGG + Intergenic
1144180432 17:12746475-12746497 GCAAAAAATAATTTTTAAGTAGG + Intronic
1156165800 18:34419222-34419244 GGGACAAATAAGTTTTAGATTGG + Intergenic
1158966736 18:62628844-62628866 GCAAGAAAAAAGTTTTAAGTAGG - Intergenic
1159428852 18:68325002-68325024 GCCAGATGTAAGTTTTAAAAAGG + Intergenic
1161641011 19:5423361-5423383 GCAAGAAGAAAGTCTTAACTGGG - Intergenic
926878555 2:17514234-17514256 GAAACAAGTTAATTTTAAAAAGG - Intronic
927855896 2:26527816-26527838 GCAACAAGTAAGTGTGGGATGGG - Exonic
931964036 2:67513893-67513915 TCAACAAATAAGTTATCAATGGG + Intergenic
932183860 2:69674390-69674412 TGAACAAGGAAGTTTTATATGGG - Intronic
935400571 2:102656031-102656053 GCAACACCTAAGTTTTAGAGGGG + Intronic
936762014 2:115798110-115798132 TATACATGTAAGTTTTAAATAGG - Intronic
939075780 2:137600967-137600989 GCAACAAAAAAAGTTTAAATAGG + Intronic
939107318 2:137964116-137964138 GCCACAAGTAAGTTCCAAGTGGG - Intronic
940231195 2:151454227-151454249 GAAACAAGTAATTTTGGAATGGG + Intronic
940274056 2:151920837-151920859 GCCTCAAGTAAGTTTTAAGATGG - Intronic
940588943 2:155695157-155695179 GCAATATGTAGCTTTTAAATTGG - Intergenic
940597181 2:155810117-155810139 GCACAAAGTAAGTTTCATATAGG + Intergenic
940805649 2:158183757-158183779 GCAACAAGAAATCTTTAAACAGG + Intronic
941104338 2:161335103-161335125 GAAACAAGGTATTTTTAAATAGG + Intronic
942620453 2:177839429-177839451 GGAACCATTGAGTTTTAAATGGG - Intronic
942650304 2:178159726-178159748 GCAATAAATAATTTTTAATTGGG - Intergenic
943369302 2:186997673-186997695 GCAATAAGTAAATTTAAAAAAGG + Intergenic
943612617 2:190051555-190051577 GCACCAAGTAAGTTTCTTATGGG - Intronic
944148145 2:196528440-196528462 GCAACAAATCAGTTTTAAATAGG - Intronic
944915129 2:204352029-204352051 TTAACAAGTACGTTTTTAATTGG - Intergenic
946169467 2:217886028-217886050 GCATCTAGTAAGTATTACATGGG - Exonic
947294203 2:228612872-228612894 GAAGAAAGTAGGTTTTAAATAGG + Intergenic
1170743362 20:19077331-19077353 TACACAAGTAAGCTTTAAATTGG - Intergenic
1172543297 20:35738952-35738974 GCAAAAAGTGAGTTTTAAGAAGG - Exonic
1173278083 20:41602067-41602089 GAAACAACTAAGTTTTCATTAGG - Intronic
1174971904 20:55285632-55285654 GCAACATGTGAGTTTTAGAAGGG + Intergenic
1175626533 20:60492797-60492819 GCAAGAACTAGATTTTAAATGGG + Intergenic
1177419702 21:20840388-20840410 GAAAGGAGTAAGATTTAAATGGG + Intergenic
1178257942 21:31072540-31072562 GCATGAAGTCAGTTCTAAATAGG + Intergenic
1179203801 21:39253557-39253579 GCTGTAATTAAGTTTTAAATTGG - Intronic
1181382277 22:22515626-22515648 GCAAAAAGTAAATTGAAAATGGG - Exonic
1182166748 22:28182513-28182535 GAAACAAGAAATCTTTAAATTGG + Intronic
1183076206 22:35428767-35428789 ACAACTAGTAAGTATGAAATAGG - Intergenic
1184897128 22:47416474-47416496 GCAACATCTAAGTTTTGGATGGG - Intergenic
949662753 3:6299670-6299692 TCAACATGTAAGTATAAAATAGG - Intergenic
950134664 3:10572115-10572137 GCAACCAACAAGTTTAAAATAGG - Intronic
951166114 3:19486700-19486722 GCGACCGGTAACTTTTAAATGGG - Intronic
951378077 3:21947647-21947669 GCTATAAGTTATTTTTAAATTGG + Intronic
952100167 3:30001831-30001853 GCAACAAGAACATTTTAAGTTGG - Intronic
952263517 3:31763625-31763647 ACAGCAATTAAGTTTTAAAAGGG - Intronic
952735542 3:36688436-36688458 GAAACAACTATTTTTTAAATTGG - Intergenic
953655733 3:44852402-44852424 TCAATAATTAAGTTTTAATTTGG - Intronic
953997396 3:47530557-47530579 GCTACAAGTAATTTAAAAATTGG - Intergenic
954966148 3:54612794-54612816 TGAAAAACTAAGTTTTAAATGGG - Intronic
956593146 3:70937347-70937369 GCAAGAAGTAAGTTACAAAGGGG - Intergenic
957809675 3:85203883-85203905 GGAAGAAATATGTTTTAAATGGG - Intronic
959272385 3:104229708-104229730 GCAACAACTACATTTTAGATAGG - Intergenic
960034518 3:113088941-113088963 GCAACAAGTGCTTTTTAAATTGG + Intergenic
962187747 3:133277916-133277938 GCAATAAGAATGTTTCAAATGGG - Intronic
962920943 3:139949954-139949976 GCAAGAAGGAAGTTTTTAATTGG + Intronic
964593995 3:158400655-158400677 GAAAAAAGAAATTTTTAAATAGG + Intronic
966695370 3:182784874-182784896 TGAACAAGAAAGTCTTAAATGGG + Intergenic
967248265 3:187510774-187510796 GTAACAAGTGGGTTTTAAAAGGG + Intergenic
968032595 3:195513556-195513578 GGTAAAACTAAGTTTTAAATAGG + Intergenic
970698269 4:18703897-18703919 GCAACAAGTAAGATACACATAGG - Intergenic
970928066 4:21476382-21476404 GAGACAAGTAAGTTTAAATTAGG + Intronic
972641603 4:40930633-40930655 TCAGCATGTAAGTTTTAAGTAGG + Intronic
973154931 4:46939046-46939068 GCAACAAGTAAGTTTTAAATAGG + Intronic
974709743 4:65575023-65575045 AAATGAAGTAAGTTTTAAATTGG + Intronic
975399174 4:73914578-73914600 GAAAAAAGTAAGGTTTGAATGGG - Intergenic
976016823 4:80565653-80565675 GCAAAAGGTCATTTTTAAATAGG - Intronic
976988364 4:91330641-91330663 GCAACAGGGATATTTTAAATTGG - Intronic
977179163 4:93853112-93853134 GCAACAAATAAATTTAGAATGGG - Intergenic
977363033 4:96030513-96030535 TCAACTAGTAAGCTTTCAATTGG + Intergenic
977436438 4:97001674-97001696 GAAATAAATAAGTTTTAAAGAGG + Intergenic
977791334 4:101107150-101107172 AGAACAAGTAAGTTTTAGCTAGG - Intronic
978202383 4:106037254-106037276 GTAAAAAGTGTGTTTTAAATTGG + Intergenic
978225807 4:106333671-106333693 GAAAGAATTAAATTTTAAATAGG - Intronic
978699752 4:111628216-111628238 GCAACCAGAAAGTTTGAACTGGG - Intergenic
979120392 4:116892354-116892376 GCAACAAGTAAGTTGTAATCAGG + Intergenic
983923009 4:173367574-173367596 GCAACAAGTGACTGTTTAATAGG + Intergenic
986611823 5:9576162-9576184 GCAATAAGTAATATTTATATGGG + Intergenic
987186177 5:15421799-15421821 ACAACAAGAAATTTATAAATGGG + Intergenic
987204635 5:15612430-15612452 TAAACAAGCAATTTTTAAATTGG + Intronic
987221869 5:15799036-15799058 CCAAGAAATAAGTTGTAAATGGG + Intronic
988192207 5:27953064-27953086 TCAACAATTAATTTTTAAATGGG - Intergenic
991087670 5:62663199-62663221 GCCACAAGAAAATTTAAAATTGG + Intergenic
992488839 5:77221344-77221366 GCAATAAGTAAACTTTAGATTGG - Intronic
993786471 5:92144620-92144642 GCAACTTGTAAGCATTAAATTGG - Intergenic
994924341 5:106095005-106095027 GGAAAAAGTAAGTTTAGAATAGG - Intergenic
996547696 5:124697751-124697773 GAAACAATTAAGTATTGAATGGG + Intronic
996634348 5:125672028-125672050 GCAACACCTGAGTTTTGAATGGG + Intergenic
998273836 5:140732766-140732788 ACAACAAGGAAGTTTTATTTAGG - Intergenic
999575480 5:152972084-152972106 GGAACAAGTCAGTTCTAAAAGGG - Intergenic
999785720 5:154888715-154888737 GTAAGAAGTAAAATTTAAATTGG - Intronic
1003642861 6:7890032-7890054 GCAAGAAGTGAATTTTAAACAGG + Intronic
1003701868 6:8475161-8475183 TCTACAAATAAGTTTTATATTGG - Intergenic
1003707240 6:8546493-8546515 GCAACAAATGGGTTTTAAAAAGG - Intergenic
1003811511 6:9788238-9788260 GAAGGAAGGAAGTTTTAAATTGG - Intronic
1004786171 6:18970010-18970032 CCAAAAATTAATTTTTAAATAGG - Intergenic
1004944936 6:20602146-20602168 GCAAAAACCAAGTCTTAAATAGG + Intronic
1005270211 6:24155663-24155685 TAAACAGGTATGTTTTAAATGGG - Intergenic
1008294917 6:49763754-49763776 GCAACCACTAAGTCTCAAATTGG + Intergenic
1009465792 6:63967265-63967287 ACAATTAATAAGTTTTAAATTGG - Intronic
1009552623 6:65118707-65118729 GCCACAAGAGAGTTTTAAGTTGG + Intronic
1009848406 6:69163836-69163858 GCAACATGCAAATTTTAAAAAGG - Intronic
1010431145 6:75780041-75780063 GCAACAAGTAGATTTCAAAGAGG - Intronic
1010431436 6:75782824-75782846 GCAACAAGTAAATTTCAGAGAGG - Intronic
1010826244 6:80479532-80479554 GCTTCAAGTAATTTTTAAAGAGG - Intergenic
1011369388 6:86617110-86617132 GCAACAAATAACTATTAAGTTGG - Intergenic
1011782371 6:90804105-90804127 GCAAAAAGTTATTTGTAAATGGG + Intergenic
1013560527 6:111299853-111299875 TCAACAAGTACATTTTAATTCGG + Exonic
1013734434 6:113209035-113209057 GCTACAAATCACTTTTAAATAGG + Intergenic
1014067917 6:117148749-117148771 GCAACAAAAAAGGATTAAATGGG + Intergenic
1016039715 6:139420327-139420349 GCTACAAGTAATTTTTAAAATGG - Intergenic
1016082455 6:139872604-139872626 GCAACATTTAAATTTCAAATAGG - Intergenic
1016596733 6:145811657-145811679 GAGAAAAGTAAGTTTAAAATAGG + Intronic
1016644484 6:146389881-146389903 GCATCAAGCAAGTGGTAAATGGG - Intronic
1017924980 6:158903008-158903030 TCAATAACAAAGTTTTAAATAGG - Intronic
1018506738 6:164478999-164479021 TTAACAAGTGAGTTTTAAATAGG - Intergenic
1020971452 7:14946661-14946683 GAAACAAGGAAGTTTTCAAACGG + Intronic
1021010657 7:15460821-15460843 GCAATCAATAACTTTTAAATTGG + Intronic
1021616299 7:22506322-22506344 GCAATCAGTGAGATTTAAATTGG - Intronic
1021845712 7:24760483-24760505 GTTATAAGTAATTTTTAAATGGG - Intergenic
1022752823 7:33249704-33249726 GGAAAAAATAATTTTTAAATCGG - Intronic
1024312990 7:47986910-47986932 GAAACCAGTAATTTTTAAATTGG - Intergenic
1027915314 7:84310487-84310509 GTAACAAGTAAAACTTAAATGGG + Intronic
1028056965 7:86257455-86257477 GCAATAAATAATTTTTTAATAGG - Intergenic
1028304385 7:89245512-89245534 GAAACCAATAAGTTTTAAGTAGG + Intronic
1028523650 7:91759461-91759483 GCAACCAGGAAGTTTGAACTGGG + Intronic
1028539582 7:91927280-91927302 GCAAGAAGTAAGGATTTAATTGG + Intergenic
1028960110 7:96739082-96739104 CCAACAAATAAATTTAAAATGGG - Intergenic
1028969644 7:96843664-96843686 TGAACAAGTAGGTTTTAAACTGG + Intergenic
1030844435 7:114391664-114391686 GAAAAAAGTATATTTTAAATAGG - Intronic
1031718703 7:125141101-125141123 GCAACTATTAATTTTTAAAAGGG + Intergenic
1032150780 7:129427684-129427706 GCAACCAGGAAGTGTTAAAATGG - Exonic
1033714722 7:143988258-143988280 TCAACAAGTAAGTTTTAATTAGG + Intergenic
1033861834 7:145637915-145637937 GCAGCAAGTAAGATTTAAGGAGG - Intergenic
1034056463 7:148040100-148040122 GCAACAAGTGAATTTTAAGTAGG - Intronic
1038567111 8:28628913-28628935 GCAACCAGGAAGATTAAAATGGG + Intronic
1040757511 8:50797120-50797142 ACAACAATTTAGTGTTAAATTGG - Intergenic
1041710812 8:60892642-60892664 GCAACACTAAATTTTTAAATAGG + Intergenic
1041979076 8:63834714-63834736 ACAAAAAATAAGTTTAAAATAGG - Intergenic
1046532577 8:115467203-115467225 GAATCAAGTAACTTGTAAATTGG - Intronic
1047681834 8:127261722-127261744 GCAAGAAAAAAATTTTAAATGGG - Intergenic
1048453847 8:134559318-134559340 GCAAAAAGTAAGATTAAAAAAGG - Intronic
1050852075 9:10300641-10300663 GCCACCAGGAAGTTTGAAATGGG + Intronic
1051576266 9:18619473-18619495 GAACCAAGTCAGTTTTAAATGGG - Intronic
1051845477 9:21447178-21447200 GCAATATGTAAGCTTTTAATGGG - Intergenic
1052546092 9:29881600-29881622 GCAACATGAGAGTTTTACATGGG + Intergenic
1055860906 9:80747847-80747869 GCAACACCTAAGTTTTAGAGGGG - Intergenic
1057070078 9:92090140-92090162 GCAATAAGAAAGTGGTAAATAGG + Intronic
1057794312 9:98144740-98144762 GCCACAGGTAGGTTTTAAGTGGG + Intronic
1058301182 9:103374993-103375015 GCAAAATTTCAGTTTTAAATGGG + Intergenic
1058343378 9:103926131-103926153 GAAACATGTAAGTTTTAATGTGG - Intergenic
1060168698 9:121442576-121442598 GCAAAATGTAAGTCTAAAATTGG - Intergenic
1186132769 X:6486671-6486693 ACAACAAGATAGTATTAAATAGG - Intergenic
1186168084 X:6848354-6848376 GCAACTAGTAATTTGAAAATAGG + Intergenic
1188534114 X:31176815-31176837 GCAATAACGAAGTTTTAAAAAGG + Intronic
1191991957 X:67047747-67047769 CCAAAAAGTAATTTTTAAAAAGG - Intergenic
1192555707 X:72087522-72087544 GCAACAAAGTAGTTTTAAAAAGG + Intergenic
1193377665 X:80781027-80781049 GCAACACGTAAATATTAATTTGG + Intronic
1194957184 X:100194680-100194702 ACAACAAATTAGTTTGAAATAGG - Intergenic
1196532684 X:116807297-116807319 GTAACAATCATGTTTTAAATGGG - Intergenic
1197764721 X:130052590-130052612 CCATCAAATAAGTATTAAATTGG - Intronic
1200024944 X:153250577-153250599 AAAACATCTAAGTTTTAAATGGG - Intergenic
1200035702 X:153328129-153328151 ATAACAATGAAGTTTTAAATAGG - Intergenic
1200715769 Y:6542442-6542464 TCAATAAGTATTTTTTAAATAGG + Intergenic
1200952424 Y:8912478-8912500 TCAACAAGCAAATTTTCAATTGG - Intergenic
1201016991 Y:9614694-9614716 GTAACAAGCAATTTTTAGATTGG + Intergenic