ID: 973159128

View in Genome Browser
Species Human (GRCh38)
Location 4:46993824-46993846
Sequence CTGTGGGCGGGGAGCCCACT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973159128_973159139 20 Left 973159128 4:46993824-46993846 CCAAGTGGGCTCCCCGCCCACAG 0: 1
1: 0
2: 1
3: 11
4: 239
Right 973159139 4:46993867-46993889 CCTGGCCCCCTCCCTTCCGCTGG 0: 1
1: 0
2: 4
3: 66
4: 423
973159128_973159140 21 Left 973159128 4:46993824-46993846 CCAAGTGGGCTCCCCGCCCACAG 0: 1
1: 0
2: 1
3: 11
4: 239
Right 973159140 4:46993868-46993890 CTGGCCCCCTCCCTTCCGCTGGG 0: 1
1: 0
2: 1
3: 18
4: 282
973159128_973159134 2 Left 973159128 4:46993824-46993846 CCAAGTGGGCTCCCCGCCCACAG 0: 1
1: 0
2: 1
3: 11
4: 239
Right 973159134 4:46993849-46993871 GTGTTCGTCCTCCTACCTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 141
973159128_973159144 27 Left 973159128 4:46993824-46993846 CCAAGTGGGCTCCCCGCCCACAG 0: 1
1: 0
2: 1
3: 11
4: 239
Right 973159144 4:46993874-46993896 CCCTCCCTTCCGCTGGGATTTGG 0: 1
1: 0
2: 1
3: 20
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973159128 Original CRISPR CTGTGGGCGGGGAGCCCACT TGG (reversed) Exonic
900131000 1:1087232-1087254 CTGTGTGCACGGAGCCCACGGGG + Intronic
900680979 1:3915978-3916000 CTGTGGGGCAGGAGCCCACCTGG + Intergenic
903298885 1:22363880-22363902 CTGTGGACAAGGAGCCAACTGGG + Intergenic
903540572 1:24094006-24094028 CCGTGGGCTGGGAGGCCTCTGGG - Intronic
905884134 1:41482589-41482611 CTGTGGGCGGGCAGCCAGCAAGG + Intronic
906033957 1:42739647-42739669 CTGTGGGAGGGGAGGGCTCTAGG - Intronic
907474819 1:54698648-54698670 CCGTGGGTGGGGAGGCCAGTGGG + Intronic
907647199 1:56255940-56255962 CTGTGGACACGGAGCTCACTTGG - Intergenic
909369755 1:74870241-74870263 CTGTAGGAGTGGAGCCCACATGG + Intergenic
913063141 1:115226081-115226103 CTGTGGGCCTGGAGCTTACTGGG + Intergenic
914341214 1:146762131-146762153 CTGTGGGAGGAGAGCTCAGTGGG - Intergenic
919820457 1:201468974-201468996 CGGTGGGCGCGGAGCGCGCTGGG - Exonic
920612471 1:207454760-207454782 CTGGGGGCGGGGAGCCCGGCAGG - Intronic
923154408 1:231264930-231264952 CTGTGGGCCAGGTGCTCACTGGG - Intronic
924759619 1:246971838-246971860 CTGTGGGCGGGAAGCCACCCAGG - Intronic
1063314033 10:4984291-4984313 CTGGAGTCTGGGAGCCCACTGGG - Intronic
1067043591 10:42971267-42971289 CTGTGGGCTGGGACCCCATGAGG - Intergenic
1067768692 10:49108449-49108471 CTGTGGGTGGGGAGCCGCCCTGG + Intronic
1070646949 10:78208415-78208437 CTGGGAGCGGTGAACCCACTGGG + Intergenic
1071352768 10:84763225-84763247 CTGTCGGCTGGGAGCTCAGTGGG + Intergenic
1071513609 10:86282722-86282744 ATGTGGGAGGGGAGCCCCCAGGG - Intronic
1072654335 10:97319758-97319780 CTGTGGGCCCGGCGCCCCCTGGG + Exonic
1072970016 10:100009649-100009671 CTGTGGGCCAGGAGCCCGCGAGG - Intronic
1073050198 10:100662137-100662159 CTGGGTGTGGGGAGGCCACTCGG + Intergenic
1075916877 10:126175259-126175281 CAGTGTGCGTGGAGGCCACTGGG + Intronic
1076731765 10:132442779-132442801 CTGCTGGCTGGGAGCCCACGGGG - Intergenic
1076800443 10:132825350-132825372 CTGTGGGCTCAGAACCCACTGGG + Intronic
1077133067 11:984244-984266 CTGTGGTCGGGGGGCCCTGTGGG + Intronic
1077141922 11:1028523-1028545 CTGTGTCCGGGGAGCCCCCAGGG - Intronic
1077472898 11:2772550-2772572 CTGTGGGCTGGGATGCCACCGGG + Intronic
1078104825 11:8351871-8351893 CCCTGGGCGGGGAGCCCTCATGG - Intergenic
1079476882 11:20840520-20840542 CTGTTGGCTGGGATCCCAGTTGG + Intronic
1083727802 11:64637424-64637446 CTGGAGGTGGGGAGCCCAGTAGG + Intronic
1083765117 11:64838004-64838026 CACTGGGCGCGTAGCCCACTGGG - Intronic
1083787570 11:64961080-64961102 CAGTAGGCGGTGAGCCCACCTGG + Intronic
1083792847 11:64997004-64997026 CTGGGGGCGGAGTGGCCACTGGG - Exonic
1083904358 11:65660420-65660442 CTGTAAGCAGGGAGCCCACAGGG - Intronic
1083968386 11:66057282-66057304 CTGTAGGAGTGGGGCCCACTGGG - Exonic
1084267711 11:68013343-68013365 CTGTGGGCCGGGAGCTCTGTGGG - Intronic
1084296440 11:68215602-68215624 CTATGGGAGGCGAGCTCACTAGG + Intergenic
1084378962 11:68798540-68798562 CTGTGTGCGGGGAGCTGGCTGGG - Intronic
1084604537 11:70164895-70164917 ATGGGAGCGGGGAGCGCACTGGG - Intronic
1086184955 11:84002417-84002439 CTGTGGGAGAGGAGCCCTCATGG - Intronic
1088710007 11:112499399-112499421 ATGTGGGAGAGCAGCCCACTTGG + Intergenic
1094472702 12:30818173-30818195 CAGTCAGCGGGAAGCCCACTGGG + Intergenic
1098922511 12:76315487-76315509 CTGTGGGAGGTGAGCTCCCTGGG - Intergenic
1101489360 12:105197176-105197198 CTCTGAGAGGGGATCCCACTGGG + Intronic
1101963759 12:109268171-109268193 CGGTGGGCAGAGAGCCTACTAGG + Exonic
1103561932 12:121797385-121797407 CGGTGGGCGGGGCGCCCTCGAGG + Intronic
1112303032 13:98247498-98247520 CTGGGGGAGTGGAGCTCACTGGG + Intronic
1114076036 14:19161679-19161701 CTGGGGGCTGGGTGTCCACTTGG + Intergenic
1114086121 14:19237892-19237914 CTGGGGGCTGGGTGTCCACTTGG - Intergenic
1119085195 14:71732841-71732863 CTGTTGAGGGGCAGCCCACTGGG - Intronic
1119709199 14:76809194-76809216 CTGTGGCCAGGGCACCCACTGGG + Exonic
1123035414 14:105469900-105469922 CTGGGGGCAGGGAGCCCCCCCGG - Exonic
1202895094 14_GL000194v1_random:2204-2226 CTGTGGGCTGGGAGGCCAGCTGG + Intergenic
1202897659 14_GL000194v1_random:19511-19533 CTGGGGGCTGGGTGTCCACTTGG - Intergenic
1124629409 15:31328080-31328102 CTGGGGGCGGGGACCCCTCCCGG + Intronic
1125605676 15:40938500-40938522 CTGTGGGCTGGAAAACCACTGGG + Exonic
1128699631 15:69794806-69794828 CAGTGGGACGGGAGCTCACTGGG + Intergenic
1128736725 15:70057791-70057813 CTGAAGGCAGGGATCCCACTTGG - Intronic
1129523486 15:76200068-76200090 CTGTCTGCGGGGAGCACAGTCGG - Intronic
1130134880 15:81174197-81174219 CTGTAGGCTTGGAGCTCACTTGG - Intronic
1131119777 15:89814924-89814946 CTGCGGGCGGGCGGCCCGCTAGG - Intronic
1132320232 15:100919711-100919733 CTGTGGGAGGGGAGCGCGCGGGG + Intronic
1132743454 16:1427291-1427313 CTGTGGGCCGGGAGCTCGGTTGG + Intergenic
1135417887 16:22282877-22282899 TTGTGGATGGGGAGCCCAGTGGG + Intronic
1136774364 16:32863797-32863819 CAGGTGGCAGGGAGCCCACTTGG - Intergenic
1136896247 16:33997717-33997739 CAGGTGGCAGGGAGCCCACTTGG + Intergenic
1138247573 16:55479110-55479132 CTGGGGGCGGGGGGCGCACTCGG - Exonic
1139993070 16:70955277-70955299 CTGTGGGAGGAGAGCTCAGTGGG + Intronic
1140068196 16:71627129-71627151 TTGTGGCCGGGCCGCCCACTTGG + Intronic
1141284481 16:82659037-82659059 CTGTGAGCAGGGAGGCCACCAGG + Intronic
1142147789 16:88499773-88499795 CTGTGGGCTCTGTGCCCACTCGG - Intronic
1142232492 16:88906342-88906364 CCGTGGGCTGGTAGCCCACGGGG - Intronic
1203076791 16_KI270728v1_random:1125933-1125955 CAGGTGGCAGGGAGCCCACTTGG - Intergenic
1143763835 17:9124425-9124447 CTGTGGGTGGGAAGCCGGCTGGG + Intronic
1144969304 17:19097568-19097590 CTGTGGGCCGGGATCTCTCTGGG - Intergenic
1144978612 17:19154497-19154519 CTGTGGGCCGGGATCTCTCTGGG + Intronic
1144989610 17:19223735-19223757 CTGTGGGCCGGGATCTCTCTGGG - Intronic
1145973023 17:28968019-28968041 CTGTGGGAGGGGAGTTGACTTGG + Intronic
1146814992 17:35935587-35935609 CTGTGGGCCGGGATCTCTCTGGG - Intronic
1147161329 17:38571082-38571104 CTGTGGTGGGGGAGGCCTCTGGG + Intronic
1147235658 17:39055613-39055635 CTGTGGGCCGGGAGCTCTCTGGG + Intergenic
1147371304 17:39994908-39994930 CAGTGGGCAGGGAGCCCCATGGG - Intronic
1147840652 17:43369094-43369116 CCGGGGGCAGGGAGCCCACGAGG - Intergenic
1147986893 17:44312010-44312032 CTGTGTACTGGGAGCCCACCTGG + Intronic
1148588666 17:48799218-48799240 CTGTGGGGAGGGAGCCCTCTAGG - Intronic
1151250275 17:72828841-72828863 CTGTGGGTGCAGAGCCCACCAGG - Intronic
1151445188 17:74159119-74159141 CTGTGGGCAGGGGGAGCACTGGG - Intergenic
1152386688 17:79979099-79979121 CTGAGAGCGTGGAGCCCACGAGG - Intronic
1152727926 17:81956791-81956813 CTGTGGGTGGGGAGCCCCGGGGG - Intronic
1153825633 18:8871597-8871619 CTGTTGGCTGGGAGCCCAGCTGG - Intergenic
1155226738 18:23735871-23735893 CTGTGGCCGGGCAGCCCATGTGG - Intronic
1156458331 18:37307153-37307175 AGGTGGGCGGGGAGCACCCTGGG - Intronic
1158306131 18:56107687-56107709 CAGTGGGCAGGCAGCCCATTTGG + Intergenic
1158509794 18:58080233-58080255 CTGTAGATGGGGAGCCCACCTGG + Intronic
1160014767 18:75132298-75132320 CTGTGCGCGGGGTGCCCACGTGG - Intergenic
1160130181 18:76218444-76218466 CTGCTGGTGGGGAGCCCAGTAGG + Intergenic
1161048959 19:2151876-2151898 ATGTGGGCGGGGCGCCCACGTGG + Intronic
1161396412 19:4047142-4047164 TTGGAGGCGGGGAGGCCACTGGG + Exonic
1161515018 19:4691605-4691627 GTGTGGGGGAGGAGCCAACTGGG + Intronic
1161571098 19:5031233-5031255 CTGTGGGCGAGGGGCCCGCTGGG + Intronic
1162922749 19:13913124-13913146 GTGTGGGTGGTGACCCCACTTGG - Intronic
1162925880 19:13930352-13930374 CTGGGGGAGAGGAGGCCACTGGG - Intronic
1164555499 19:29248020-29248042 ATGTGGGCGGGGACCCGCCTGGG + Intergenic
1166042563 19:40212738-40212760 CTGGAGGCTGGGAGCCCAGTGGG + Intronic
1166141356 19:40807058-40807080 CGGTGCCCCGGGAGCCCACTAGG - Intronic
1166821224 19:45581476-45581498 CTGAGATGGGGGAGCCCACTGGG - Intronic
1168132731 19:54331673-54331695 CTGTGGGAGAGGAGACCACAGGG + Intergenic
926185410 2:10686811-10686833 CTGAGGGAGGGAAGACCACTAGG + Intronic
930404866 2:50942255-50942277 CTGTGGGAATGGAGCCCACATGG + Intronic
931992989 2:67809614-67809636 CTGTTTGCGGGGAGCACAGTGGG + Intergenic
935064841 2:99638550-99638572 CTGTGGGCGGGGGGACAGCTGGG - Intronic
941363403 2:164580923-164580945 CTGTGTGCCAGGAGCCCAATGGG - Intronic
942506302 2:176645030-176645052 CTGTGGTTGGGGAGGCCAGTTGG + Intergenic
946182130 2:217955202-217955224 CTGCGGGCGTGGAACCCACGGGG - Intronic
946372854 2:219290973-219290995 CTGGGGGAGGGGAGGACACTGGG + Intronic
946414422 2:219532474-219532496 CTGGGGGTGGGGTGCCCACCTGG - Exonic
947536518 2:230943271-230943293 CTGGGGGCGGGGAGCCAGCCAGG - Intronic
948806541 2:240455644-240455666 CTGGGGGTGGGGAGGCCCCTGGG + Intronic
948873764 2:240816989-240817011 CTGAGGGTGGGGATCCCAGTGGG + Intronic
1170806690 20:19638992-19639014 CTGTGGAAGGGGACCCCAGTGGG + Intronic
1170843796 20:19945397-19945419 CTGTGTGTGGGGTTCCCACTGGG + Intronic
1171325217 20:24285138-24285160 CTGAGGGCTGGGAAGCCACTTGG - Intergenic
1173350077 20:42236851-42236873 CTGTGGGAGGGCAGTCCACAAGG - Intronic
1173691337 20:44963448-44963470 CTGTTGGCTGGAAGCTCACTTGG - Intergenic
1174146546 20:48456195-48456217 CTGGGGGCGGGGCTCCCCCTTGG + Intergenic
1174268737 20:49351377-49351399 GGGTGGCCGGGGAGCCCCCTGGG - Intergenic
1175843042 20:62042552-62042574 CTGTGGGGCGGGAGCCCAAAAGG + Intronic
1176169169 20:63689359-63689381 CTGTGGGTCAGGACCCCACTTGG - Intronic
1176614796 21:9018191-9018213 CTGTGGGCTGGGAGGCCAGCTGG + Intergenic
1176617343 21:9035500-9035522 CTGGGGGCTGGGTGTCCACTTGG - Intergenic
1176707797 21:10128169-10128191 CTGGGGGCTGGGTGTCCACTTGG + Intergenic
1178910022 21:36666829-36666851 CTGGAGGCGGGGAGGCCATTTGG + Intergenic
1179139715 21:38714017-38714039 CAGTGGGAGGGGAGCACAATTGG - Intergenic
1179456947 21:41506953-41506975 CTGTGGGCAGGGAGCACCCAGGG - Intronic
1180016975 21:45093457-45093479 CTGTGGGTGCCGAGCCCTCTGGG + Intronic
1180291846 22:10855301-10855323 CTGGGGGCTGGGTGTCCACTTGG + Intergenic
1180494650 22:15884723-15884745 CTGGGGGCTGGGTGTCCACTTGG + Intergenic
1180942831 22:19670835-19670857 CTGTGGGCTGGGAGAACACCTGG - Intergenic
1181381483 22:22508331-22508353 ATGGGGGAGGGGAGCGCACTGGG + Intronic
1181514356 22:23402646-23402668 CGGTGGGCGGGGCGCTCACCTGG + Intergenic
1183458611 22:37936243-37936265 CTGGGGGCAGGGAGCCCAGCAGG - Intronic
1183735447 22:39642417-39642439 CTGTATGTGGGGAGCCCACCTGG - Intronic
1183792762 22:40086984-40087006 CTGTGAGAGGGGAGCCTACAGGG - Intronic
1183932152 22:41241208-41241230 CTCTGGGAGGGCAGCCCACATGG - Intergenic
1184923623 22:47622866-47622888 GTGTAGGCTGGGATCCCACTGGG - Intergenic
950901517 3:16502484-16502506 CTGTGGGAGGGGACCACACAAGG - Intronic
954717759 3:52534742-52534764 CTGTCGGAGGGGAGCCAGCTGGG + Intronic
956157349 3:66312420-66312442 CTGTGGGGGTGGAGCCTACTGGG + Intronic
961217156 3:125168557-125168579 ATGTGGGCAGGGAGGCCACGGGG - Intronic
961415261 3:126752385-126752407 GTGTGTGAGCGGAGCCCACTAGG + Intronic
961512163 3:127409681-127409703 CTGTGGGCTGGGAGGCCAGCAGG - Intergenic
961623591 3:128243794-128243816 TTGTGGGCTGGGTCCCCACTGGG + Intronic
962887099 3:139637901-139637923 CTGAGGGCAGGGATCCCACTGGG + Intronic
964118444 3:153159981-153160003 CTGTGGGCGGAGGTCCCTCTTGG + Intergenic
968761026 4:2442866-2442888 TTGGGGGCAGGGAGCTCACTGGG + Intronic
968761041 4:2442902-2442924 TTGGGGGCAGGGAGCTCACTGGG + Intronic
968761070 4:2442968-2442990 TTGGGGGCAGGGAGCTCACTGGG + Intronic
968761099 4:2443034-2443056 TTGGGGGCAGGGAGCTCACTGGG + Intronic
969694470 4:8726751-8726773 CTGTTGGTGGGGGGACCACTGGG - Intergenic
972448367 4:39169731-39169753 CTATTGGCTGGGAGCCCACCTGG - Intergenic
973159128 4:46993824-46993846 CTGTGGGCGGGGAGCCCACTTGG - Exonic
982216024 4:153083117-153083139 CTGTGGTCAGGGAGCCCAAGGGG + Intergenic
984526866 4:180867427-180867449 GTGTGGGCTGGGATCCCAGTGGG - Intergenic
985871898 5:2563833-2563855 CTGGGGGCTGTGAGCACACTGGG + Intergenic
991510014 5:67365834-67365856 CTGGTGGAGGGGACCCCACTGGG - Intergenic
998148642 5:139744803-139744825 CTGTGGTCTGGGAGCCAAGTGGG - Intergenic
1000561014 5:162789466-162789488 CTGTGAGAGGGGAGCCTACAGGG - Intergenic
1002323332 5:178388691-178388713 CTGGAGGCAGGGAGGCCACTCGG - Intronic
1002493554 5:179596845-179596867 CTGTGGGGAGGGAGCTCCCTAGG - Intronic
1002978313 6:2109164-2109186 CTGTGAGCAGGCAGCACACTGGG + Intronic
1005320219 6:24646122-24646144 CGGTGGGCGGGGATCCCCCGGGG - Exonic
1005724912 6:28639148-28639170 CTGTGGGAGGAGACCCCAGTAGG + Intergenic
1015519293 6:134114891-134114913 TTATGGCCGGGGAGCCCTCTGGG + Intergenic
1017041440 6:150311355-150311377 CTGTGGAAGGGGACCCCAGTGGG + Intergenic
1018715571 6:166530242-166530264 CTCTGGGAGGGGGGCACACTTGG - Intronic
1018811479 6:167301229-167301251 CTGTGGCCAGAGAGCACACTGGG - Intronic
1019394238 7:808429-808451 CTCTGGGAGGGGAGCCCAGAAGG - Intergenic
1019431372 7:1001339-1001361 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431379 7:1001355-1001377 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431389 7:1001389-1001411 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431409 7:1001457-1001479 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431427 7:1001527-1001549 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431438 7:1001561-1001583 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431492 7:1001729-1001751 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431506 7:1001781-1001803 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431515 7:1001813-1001835 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431522 7:1001829-1001851 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431532 7:1001863-1001885 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431568 7:1001981-1002003 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431578 7:1002015-1002037 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431594 7:1002065-1002087 CTGTGGGTGGGGAGTCCTCTGGG + Intronic
1019431627 7:1002185-1002207 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431654 7:1002291-1002313 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431663 7:1002323-1002345 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431670 7:1002339-1002361 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431680 7:1002373-1002395 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431696 7:1002423-1002445 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431710 7:1002475-1002497 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431720 7:1002509-1002531 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431783 7:1002737-1002759 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431803 7:1002804-1002826 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431854 7:1002991-1003013 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431888 7:1003111-1003133 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431898 7:1003145-1003167 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431922 7:1003231-1003253 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431948 7:1003337-1003359 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431954 7:1003353-1003375 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431968 7:1003405-1003427 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431992 7:1003491-1003513 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432012 7:1003558-1003580 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432018 7:1003574-1003596 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432047 7:1003676-1003698 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432085 7:1003811-1003833 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432103 7:1003879-1003901 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432117 7:1003931-1003953 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432131 7:1003983-1004005 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019499959 7:1359916-1359938 CTGTGGGTGTGGGGCCCACCAGG + Intergenic
1019645168 7:2125034-2125056 GTGTGGGCCGGGAGCCCAGCAGG - Intronic
1019742621 7:2682348-2682370 CTGTGTGCTGGGGGCCCACCCGG - Intronic
1019750416 7:2725646-2725668 CTCTGGGAGTGGAGCCCACAGGG - Intronic
1023875904 7:44286257-44286279 CTGTGGCCGCTGAGCCCTCTAGG - Intronic
1024323282 7:48089729-48089751 CTCTGGGCGGGGAGCCCACCGGG + Intronic
1024867597 7:53921454-53921476 CTGTGGAAGGGGACCCCAGTGGG - Intergenic
1035725612 8:1823616-1823638 TTGGGGGCGGGGAGGGCACTCGG + Intergenic
1038422200 8:27440460-27440482 CTGTGGGCTGGGGGCCCACCCGG + Intronic
1040073333 8:43205464-43205486 GTTTGGGCGGGGCGCCTACTGGG - Intergenic
1041552907 8:59119987-59120009 CTGAGGGCGGAGAACCCACAGGG + Intergenic
1044929452 8:97237952-97237974 CTGTGGGAGGGAAGCTCAGTTGG + Intergenic
1045561833 8:103271534-103271556 CTGTGGGGGTGGAGCCCTCATGG + Intergenic
1045849295 8:106673954-106673976 CTGTAGGGGTGGAGCCCTCTTGG + Intronic
1047627217 8:126668433-126668455 CAGTGGGAGAGGAGCCCAGTGGG + Intergenic
1048789338 8:138085144-138085166 CTGTGGAAGGGGACCCCACCGGG - Intergenic
1049528069 8:143139239-143139261 CTGTGGGCGAGGCTTCCACTTGG - Intergenic
1052105558 9:24510397-24510419 CTGTGGGGGTGGAGCCCTCATGG + Intergenic
1053271386 9:36751979-36752001 CTTTGGGCTGGAAACCCACTGGG + Intergenic
1053301143 9:36950494-36950516 GTGTGGGCAGTGAGGCCACTTGG - Intronic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1053760990 9:41349945-41349967 CTGGGGGCTGGGTGTCCACTTGG - Intergenic
1055476183 9:76665837-76665859 CTGTGGGCGGCAAGCCACCTAGG + Intronic
1055880943 9:81002461-81002483 CTGTTGGCTGGGAGCTCAGTTGG - Intergenic
1057881638 9:98796646-98796668 CTGTGTGCCGGGAGCGCGCTAGG + Intronic
1058120341 9:101131562-101131584 TCGTGAGCGGGGAGCCCACTTGG + Intronic
1060784462 9:126439241-126439263 CTCTGGGCAGGGAGCTCACAGGG + Intronic
1061189075 9:129071246-129071268 CTGTGGGCCCGGGGACCACTTGG + Exonic
1062280800 9:135750824-135750846 GTGTGGGAGGGGAGCCCAGCTGG + Intronic
1062315073 9:135963091-135963113 CTGTGGGAGGGGAGGCCAGCAGG + Intergenic
1202792542 9_KI270719v1_random:97049-97071 CTGGGGGCTGGGTGTCCACTTGG + Intergenic
1189269253 X:39739316-39739338 CTGTGGGCGTTGAGCGCAGTGGG + Intergenic
1192179569 X:68908061-68908083 CAGGGGGTGGGGAGACCACTGGG - Intergenic