ID: 973159226

View in Genome Browser
Species Human (GRCh38)
Location 4:46994287-46994309
Sequence CCCTCCTCTCCAGAAAAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 298}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973159226_973159232 3 Left 973159226 4:46994287-46994309 CCATCCTTTTCTGGAGAGGAGGG 0: 1
1: 0
2: 4
3: 31
4: 298
Right 973159232 4:46994313-46994335 AGGTGGAGACAAGCGACCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973159226 Original CRISPR CCCTCCTCTCCAGAAAAGGA TGG (reversed) Exonic
901197900 1:7450450-7450472 CCCTCCCCTCCAGCAGAGGTGGG - Intronic
903127032 1:21255216-21255238 CCCTCCTCAGCAGAGAAGCAAGG + Intronic
903140773 1:21337957-21337979 CCCTCCTCTCCAGTGCTGGAAGG + Intronic
903813995 1:26051261-26051283 CCCTCATCTCCAGGAAAAAAAGG + Intergenic
904482684 1:30804054-30804076 CTCTCCTCTCCAGAAGCAGAGGG + Intergenic
904652099 1:32013594-32013616 CCCTCCACGCCAGAAAGGGGAGG + Intergenic
904910093 1:33928142-33928164 CCCTCCACTGCAGGCAAGGATGG - Intronic
905015683 1:34777019-34777041 CCCACCTCTCCACTCAAGGAAGG + Intronic
905632054 1:39524452-39524474 CCAGCCTCTCCACACAAGGAGGG + Intronic
906932501 1:50183502-50183524 CTCTCCTTCCCAGAGAAGGAAGG - Intronic
908439803 1:64142316-64142338 CCCTCCCCTCCAGAAACTGCTGG + Intronic
908451839 1:64263675-64263697 CCCTCTTTTGCAGAGAAGGATGG + Intronic
908474215 1:64471767-64471789 CCTTCCTCTCCCGAGGAGGACGG - Intronic
908599329 1:65722387-65722409 TCCTCCTCTACAGAAAAAAAAGG + Intergenic
909424140 1:75502291-75502313 CCCTCCTCTGCAGGAAAACAAGG - Intronic
911778283 1:101842742-101842764 CCCTCCACTGAAGAAAAGCAGGG + Intronic
912689577 1:111794388-111794410 CCCTGGTCTCCAGTAAAGAATGG - Intronic
914390401 1:147216509-147216531 CACTGCTCTCCAGAAAACGCTGG - Intronic
914828767 1:151155555-151155577 CCCTCCTCTCTACAAAAAAAAGG + Intergenic
914885666 1:151582298-151582320 CCCTCCTCCCCAGAAAGACAAGG - Exonic
914936763 1:151988548-151988570 CCTTAATCTCCAGAAAAGTATGG + Intronic
915898085 1:159826880-159826902 CCTGCCTCTCCAGAGAAAGATGG + Exonic
915937864 1:160099219-160099241 CCCAACTCTCCAGGAAAGGCTGG - Intergenic
915980364 1:160416399-160416421 CACTCCTCTGGAGATAAGGAAGG - Intronic
920184041 1:204149693-204149715 CCCTCCTCACCTGAAAAGCCGGG + Exonic
1063519893 10:6731661-6731683 ACCTTCTCTTCAGACAAGGATGG + Intergenic
1064298913 10:14104487-14104509 CTCTACTCCCCAGAAAGGGAAGG + Intronic
1064611695 10:17110187-17110209 GACTTCTTTCCAGAAAAGGAGGG + Intronic
1066461817 10:35619128-35619150 CCCTCCTCCCCAGGCGAGGATGG - Intergenic
1069589661 10:69634047-69634069 GCCTCCTCTCCAGAGAAGCAGGG - Intergenic
1069933648 10:71900458-71900480 CTCTCCTCTCCTCAAGAGGAGGG + Intergenic
1070145332 10:73769716-73769738 CCCTCCTCTGCAGGACAGGTGGG + Exonic
1070442256 10:76458216-76458238 CCCTCTCCTCCAGACAAGGGTGG + Intronic
1070745289 10:78930058-78930080 CCTACATCTCCAGGAAAGGATGG + Intergenic
1071486458 10:86105704-86105726 CCCCCCTCTCCAGCAAAGGTTGG + Intronic
1072238783 10:93475985-93476007 CCTTGTTCTCCAGAAAGGGATGG + Intronic
1074903382 10:117839147-117839169 CTCTCCCCTCCAGAAAATGAGGG - Intergenic
1075041850 10:119114364-119114386 TGCTCCTCACCAGAAATGGAGGG - Intronic
1075289622 10:121217186-121217208 CCCTCCACTCCAGGAAATGTAGG - Intergenic
1075728719 10:124623724-124623746 TCCTCCTATCCAGGCAAGGACGG + Intronic
1075830589 10:125407657-125407679 CTCTCCTTTCCTGAAATGGAAGG + Intergenic
1077393490 11:2310317-2310339 GCCTGCTCTCCAGGAAGGGAAGG + Intronic
1078669533 11:13352800-13352822 CCCTCATCTGCAAAACAGGAGGG - Intronic
1079124451 11:17708852-17708874 CCCTCCTGCCCAGAGAAGGGAGG + Intergenic
1080489842 11:32750857-32750879 CCTTCCACTTGAGAAAAGGAGGG - Intronic
1080766120 11:35298740-35298762 CCCTTCTCCCCAGAGATGGAGGG - Intronic
1083252531 11:61477688-61477710 CCCATCCCTCCAGAACAGGAGGG - Intronic
1084599337 11:70135646-70135668 CCCTCCTCTGCAGAGAAAGAAGG + Intronic
1086998244 11:93384390-93384412 CCCTCCTCTCTGTAACAGGAAGG - Intronic
1087876893 11:103369558-103369580 CCCTCCTCTCCTCAAACAGAAGG - Intronic
1088960788 11:114662638-114662660 TCCTCCCCTCAAGCAAAGGAAGG - Intergenic
1089152518 11:116374811-116374833 CTCTGCCCTTCAGAAAAGGAAGG + Intergenic
1089213565 11:116822145-116822167 CCACCCTCTGCAGACAAGGAGGG - Intronic
1089612308 11:119676394-119676416 CTCTGCTCCCCAGAAAAAGAAGG + Intronic
1089635121 11:119807063-119807085 CCCTCCTCTCTAGCAAAAGGAGG + Intergenic
1090253429 11:125266470-125266492 CCCACCCCTTCAGAAAAGCAGGG - Intronic
1091215192 11:133896996-133897018 CCCTCTTCCCCAGGAAAGCAAGG + Intergenic
1091963552 12:4719591-4719613 CCCAGCTCTCCAAAAAAGCAAGG + Intronic
1092163553 12:6329234-6329256 CCCTCCTTTCCAGAAAAAAGTGG + Exonic
1092511939 12:9166012-9166034 CCCTCCCCTCCAGCAAATGGAGG + Intronic
1092868423 12:12784666-12784688 CCCTCTCCTCCAGATAAGGAGGG - Intronic
1097295140 12:57954787-57954809 CTCTCTTCTCCAGAAAACCAAGG - Intronic
1097581024 12:61456616-61456638 CACTTGTCTTCAGAAAAGGAGGG + Intergenic
1099164610 12:79288152-79288174 CCTTCCTCTTCATAAAATGATGG - Intronic
1099557466 12:84128359-84128381 CCCTCCAATTCAGAAAAGGGCGG - Intergenic
1101945655 12:109134407-109134429 ACATCCTCCCCAGGAAAGGAGGG - Intronic
1102190997 12:110988223-110988245 CCCTCCTCTCCAGGAATCCAAGG - Intergenic
1102232119 12:111269867-111269889 CTCTCCTCCCCAGAAATGCAGGG + Intronic
1102490298 12:113286484-113286506 CTCTCCTCTCCAGACACGCAGGG - Intronic
1102514996 12:113440413-113440435 TCTTGCTCTTCAGAAAAGGAGGG - Intergenic
1103341890 12:120225179-120225201 CCCCAGTCTCCAGAAAAGAAGGG + Intronic
1103358960 12:120342499-120342521 CCCTCCTCTCCAGGGCTGGAGGG + Exonic
1103518723 12:121523894-121523916 CCCTCCTCTGCACAGAAGCATGG + Intronic
1105322979 13:19345583-19345605 TCCTCCTCTGCAGAAGGGGACGG - Intergenic
1105722089 13:23127266-23127288 CCCCTCTATCTAGAAAAGGAAGG - Intergenic
1106293230 13:28385305-28385327 AGCTCCTCTCAAAAAAAGGAAGG - Intronic
1108247015 13:48527101-48527123 CCCTCCTATGCAGAAAAGGGGGG - Intronic
1108989801 13:56640617-56640639 CCCTCCTCTCCTCAAGTGGAAGG - Intergenic
1109522802 13:63534538-63534560 CTCTCCTCTCCTCAAACGGAAGG + Intergenic
1110010050 13:70321067-70321089 CCCCCCTCCCCACAACAGGAAGG + Intergenic
1110219409 13:73058252-73058274 CCCTCCTCCCCACACACGGATGG + Intronic
1110628475 13:77678443-77678465 CCCACCGCTGCAGAAAAGAATGG + Intergenic
1111647716 13:91051645-91051667 CCCTGGTCTCCATAAAAGCAAGG - Intergenic
1115300878 14:31883584-31883606 CCCTCCCCTCCAGATCATGAGGG + Intergenic
1117216300 14:53556194-53556216 TCCTGCTTTCCTGAAAAGGAAGG - Intergenic
1118751095 14:68808340-68808362 CCCACCACTCCAGACAGGGAGGG + Intergenic
1118829375 14:69415746-69415768 TCTTCCTCTCCAAACAAGGAGGG + Intronic
1118857650 14:69636625-69636647 GCCTCCTTTCCAGAAGAGGCAGG + Intronic
1119082814 14:71712003-71712025 CCCTTTCCTCCAGAAAAGGCAGG - Intronic
1119474692 14:74920284-74920306 CCCTCCTCTGAAAAAATGGATGG - Intronic
1120302960 14:82731638-82731660 TTTTCCTCTCAAGAAAAGGAAGG + Intergenic
1121098103 14:91232088-91232110 CCCTCCTCACTAGAGAAGAAGGG - Intergenic
1122637597 14:103137742-103137764 CCCTCTTCCTCAGTAAAGGACGG - Intergenic
1124349818 15:28947081-28947103 TCCTGCTCTCCAGGAAAAGAGGG - Intronic
1124361166 15:29037506-29037528 CCCTCCTCTCCTGAAAGGCCTGG - Intronic
1124370498 15:29102272-29102294 CACTCTTCTCCAGCCAAGGAGGG - Intronic
1125819089 15:42612543-42612565 CCCTCCTCCCTACAAAAAGATGG - Intronic
1126737266 15:51743146-51743168 CCCCCATCTCAAAAAAAGGAGGG - Intronic
1127536181 15:59892072-59892094 ATCTCCTCTCCAGACAAGCATGG + Intergenic
1128683060 15:69665516-69665538 CTCTCCTCTCTTGAAAAGGCAGG + Intergenic
1130979889 15:88804974-88804996 CCCTCCTCTTCAGACGAGGTGGG - Intronic
1131311834 15:91297304-91297326 GCCTCCTCTGCAGCAAAGGGAGG - Exonic
1132592890 16:734052-734074 CCCTCTGCTGCAGAAGAGGAAGG + Intronic
1132983007 16:2748877-2748899 CCTCCCCCTCCAGAAAAGAAAGG + Intergenic
1135940016 16:26814506-26814528 CCCTCATCAACAGAGAAGGAAGG + Intergenic
1137589063 16:49682369-49682391 CCCTCCTGCTCAGGAAAGGAGGG + Intronic
1137589062 16:49682369-49682391 CCCTCCTTTCCTGAGCAGGAGGG - Intronic
1137716678 16:50602368-50602390 CCCTCGTCTCTAGAATAGGGAGG - Intronic
1138116393 16:54364085-54364107 ACCTCTGCTCCAGATAAGGAGGG - Intergenic
1138206710 16:55130820-55130842 CCCTCCCCTCGAGAGAAGTATGG + Intergenic
1139150301 16:64373846-64373868 CTCCCCTCCCCAAAAAAGGAGGG + Intergenic
1140085172 16:71789194-71789216 ACCTCCCCACCAGAAAAAGATGG + Intronic
1140599030 16:76452586-76452608 TCCTCCTCTCCAGAGAAGTCTGG - Exonic
1141763085 16:86041809-86041831 CCCTGCTTTCCAGAAATGGAAGG - Intergenic
1142207461 16:88790960-88790982 CCCTCCTCGCCTGTAAAGCAAGG + Intergenic
1142822857 17:2485761-2485783 CCGTCCGCTTCAGAAAGGGAGGG - Intronic
1143147595 17:4786653-4786675 CCCTCATCTACAAAATAGGAAGG - Intergenic
1143682396 17:8487150-8487172 CCCTCCTCTCGAGGTGAGGAAGG + Intronic
1143771412 17:9171349-9171371 CTCTCCCCACCAGGAAAGGACGG + Intronic
1143916503 17:10297332-10297354 GCATCATCTCCAGAAAATGAGGG + Intergenic
1144090383 17:11850927-11850949 CCCTGCTCTCATGAAGAGGAGGG + Intronic
1144290694 17:13823376-13823398 CCCCCATCTCTAGAAAAAGAGGG + Intergenic
1144854396 17:18260085-18260107 CCCTCCTCCCCTGCGAAGGATGG - Intergenic
1145091317 17:19988309-19988331 CCCTGCTCCCCAGAGAAGGCTGG - Intergenic
1145363039 17:22227943-22227965 CCCACCTTTCCAGAAAAGAAGGG - Intergenic
1146827701 17:36037706-36037728 CCCAGCTTTCCAAAAAAGGAGGG - Intergenic
1147364716 17:39952510-39952532 CTCTCCTCACCAGGAAAAGATGG - Intergenic
1147972599 17:44227644-44227666 CCCTCCTCTCCCAGAAAGGGAGG + Intergenic
1149558275 17:57589722-57589744 CAGTCTTCTCCAGAAAAGTAGGG + Intronic
1152213941 17:79021318-79021340 CCCTCCTCTTCCCAAGAGGATGG + Intergenic
1152723476 17:81934125-81934147 CCCTCCTCGCAGGAAACGGAAGG + Intronic
1152761356 17:82108810-82108832 CCGGCGTCTCCAGGAAAGGAAGG + Intronic
1155047006 18:22111565-22111587 CCCTCCTCTGTGGATAAGGATGG - Intergenic
1156908249 18:42380772-42380794 AGCTCCTCACCAGCAAAGGATGG - Intergenic
1157325470 18:46665645-46665667 CGCTCCTGCCCGGAAAAGGAGGG - Intergenic
1157332725 18:46715185-46715207 TTCTCTTCTGCAGAAAAGGAGGG - Intronic
1157484085 18:48074592-48074614 CCTTCCTCTCCATACAAGAAAGG - Intronic
1158419226 18:57278216-57278238 TCCTACACTCCAGGAAAGGAGGG + Intergenic
1160557480 18:79735579-79735601 CCCTCCTCTCCTGAACTGCACGG - Intronic
1160787575 19:908270-908292 CACTCCTCTCCAGAAATGGAAGG + Intronic
1161484564 19:4528213-4528235 CCCACCTCAGCAGAAAAGCAGGG - Intronic
1162673200 19:12276092-12276114 CCCATATGTCCAGAAAAGGAAGG + Intronic
1163526225 19:17823175-17823197 CCCTGCCCCCCAGAAAAGGCAGG - Intergenic
1163803842 19:19384684-19384706 CGCCTCTCTCCAGAGAAGGATGG - Intergenic
1164491000 19:28714396-28714418 CCCTCCACTTGAGAAGAGGAGGG + Intergenic
925433268 2:3815257-3815279 CCCTCCCCACCAGCAAAGGGAGG - Intronic
925626155 2:5843599-5843621 CCTTCCCCTCAAGAAAATGATGG + Intergenic
925921192 2:8639097-8639119 TCCTCCTCTCCAGACAAAGTGGG + Intergenic
926735372 2:16069784-16069806 GCCGGCTCTCCAGAAAAGAAAGG - Intergenic
926914546 2:17879252-17879274 GCCTCCTCTCGAGGAAGGGAAGG - Intronic
927193344 2:20531897-20531919 CTCCCGTCTCCAGAACAGGAGGG + Intergenic
927199539 2:20569864-20569886 CTCTACTTTCCAGAAAAGGCAGG + Intronic
928115444 2:28542633-28542655 CCCTCCCTTCCAGAGATGGATGG - Intronic
928270256 2:29849155-29849177 CCCTCCTCCTCAGAAAAGCTGGG + Intronic
928691742 2:33806672-33806694 CCCACCTTCCCAAAAAAGGAAGG - Intergenic
929008192 2:37415678-37415700 CTCTCCCCTCCAGGAAGGGATGG - Intergenic
929087817 2:38185846-38185868 CCCTCCTCTCCAAAAAGGAAAGG - Intergenic
930059680 2:47277689-47277711 CCCTTATCTCCATAAAAGAAAGG + Intergenic
931166292 2:59752584-59752606 CCCTTCTCCCCAGAAAACCAAGG - Intergenic
933500441 2:83104139-83104161 CCCTCCTCCTCAGGAAAGGCAGG + Intergenic
935812891 2:106817314-106817336 CTCTCCTCTCCTGATAAGGAAGG - Intronic
936233828 2:110726290-110726312 CCATCCTCTCCAGAATTGGAGGG - Intergenic
936493618 2:112997802-112997824 CCTTCCAGTGCAGAAAAGGAGGG - Intergenic
936985994 2:118311600-118311622 TCCTCCAGTCCAGAAAGGGAGGG - Intergenic
937147466 2:119659857-119659879 CCTTCCTCTCCACAGAAGCAGGG - Intronic
937267557 2:120626082-120626104 CCCTTCTCTCTAGGAAGGGAGGG - Intergenic
939405118 2:141746046-141746068 CCCTCCTCTCCCCAAGAGGAAGG + Intronic
939855940 2:147358746-147358768 CCCTGCTCTTCAGGGAAGGAAGG - Intergenic
941155409 2:161971786-161971808 CCCTTCTCTTCAGATAAGCATGG + Intronic
942540675 2:177012280-177012302 CCTTCCTCTCCAGAAAATGAGGG - Intergenic
942809033 2:179974744-179974766 CCAACCTCTCCAAAAAAGGTGGG - Intronic
945010492 2:205457030-205457052 CAATCCTTTCCAGAAAAAGAAGG - Intronic
945252807 2:207778654-207778676 CCCTCTTCTCCACAAAAAGGGGG - Intergenic
946163208 2:217848382-217848404 CCCTCCTGTGCAGAGTAGGAGGG + Exonic
946668934 2:222081638-222081660 CACTCCTCTCCAGAAAATGAAGG - Intergenic
947960450 2:234232101-234232123 CCCTGACCTCCAGACAAGGAAGG - Intergenic
948199703 2:236120719-236120741 GCCTTCTCTCCAGAAGATGATGG - Intronic
1168935467 20:1661626-1661648 CTCTACTCTGCAGGAAAGGAGGG + Intergenic
1169485949 20:6032829-6032851 CCCTTCTCTCCCAAAAATGATGG - Intronic
1172554236 20:35827016-35827038 ATCTCCTCTCCAGCAAAGGCTGG + Intronic
1174362464 20:50037548-50037570 ACGTTCTCTCCAGAGAAGGAAGG + Intergenic
1176416030 21:6475235-6475257 CACTCCTCTCCAGGGAAGGATGG - Intergenic
1177491387 21:21830607-21830629 CTCTCCTCTGCAGAAAAGGTGGG + Intergenic
1179691530 21:43083569-43083591 CACTCCTCTCCAGGGAAGGATGG - Intergenic
1180591796 22:16944854-16944876 CCCTCCTCAGCAGAACCGGATGG + Intergenic
1181429560 22:22870667-22870689 GCCTCCTCTCCAGACAAGTTAGG - Intronic
1184164560 22:42720118-42720140 CCCTCCTCTCCAGCTGGGGAAGG - Intronic
1184753384 22:46502253-46502275 ACCTCATCTCAAGAAAAGAAAGG + Intronic
949949491 3:9217485-9217507 CCCTCCTCCCCGCAAAAGGAAGG + Intronic
950202451 3:11054914-11054936 CCGTCCCCACCAGAAAAGCATGG + Intergenic
950430056 3:12945341-12945363 CCTCCCTCTCCAGGAAGGGAAGG + Intronic
950710527 3:14810453-14810475 TCCTCCGCTCCCGAAGAGGAAGG - Intergenic
951279606 3:20731953-20731975 CTCTCCTCTCCTCAAGAGGAAGG + Intergenic
952479766 3:33749116-33749138 TTTTCCTCTCCAGAAAGGGATGG + Intergenic
953556864 3:43952891-43952913 CACTCCTCTCCAGCAATGTAAGG + Intergenic
953687772 3:45091532-45091554 CCTTCCTCTGCAGGAAAGGGAGG + Exonic
953690938 3:45118736-45118758 CCCTTCTTCTCAGAAAAGGAGGG - Intronic
954671087 3:52291729-52291751 CCCACCTCTCAAGACAATGAGGG - Exonic
957038092 3:75313386-75313408 CCATCATCTCCAGACATGGAAGG - Intergenic
957164345 3:76651941-76651963 CCATCTCCTCCAGAAAAGGCTGG - Intronic
962425599 3:135266621-135266643 CCCACCTCTCCAGGAAATGAAGG + Intergenic
964459302 3:156905054-156905076 CCCACCTCTCCCAAAAAGGCAGG - Intronic
965257037 3:166426153-166426175 CTCTCCTCTCCTCAAATGGAAGG - Intergenic
965977289 3:174640993-174641015 CCCTCCCCTCCAGGCGAGGATGG + Intronic
967153620 3:186672773-186672795 CCCTCCTCTCTAGAACAGATGGG - Exonic
967157089 3:186703248-186703270 CTCTCCTCTCTAGAACAGGTGGG - Intergenic
967190671 3:186982185-186982207 TCTTCCTCACCAAAAAAGGAAGG - Intronic
970373550 4:15433316-15433338 CCCCCCTCCCCAGAAAAAAAAGG - Intronic
970860849 4:20700726-20700748 CCCTCTACCCCAGGAAAGGAGGG - Exonic
971757424 4:30721306-30721328 CTCCCCTCTCCCGGAAAGGAAGG - Exonic
973159226 4:46994287-46994309 CCCTCCTCTCCAGAAAAGGATGG - Exonic
973262114 4:48175564-48175586 ATCTCCTCTCCAGAAGAGGAGGG - Intronic
979817412 4:125127359-125127381 CCCTACTCTGCACCAAAGGAGGG - Intergenic
980869249 4:138592554-138592576 CTCTCCTCTCCAAACAAGGCTGG - Intergenic
980889048 4:138794709-138794731 GCCTCCTCTCTAGAAGAGGGAGG - Intergenic
980960621 4:139470945-139470967 CTCTCCTCTCCTCAAATGGAGGG + Intronic
981729380 4:147881756-147881778 CCCTGCTCTCCAGTATAGAATGG + Intronic
981867842 4:149447011-149447033 CCATCATCTCCAGGAAAGGAAGG - Intergenic
982117063 4:152106650-152106672 CCCTCATCTCTAGTAGAGGAGGG + Intergenic
982398873 4:154943744-154943766 CCAGGCTCCCCAGAAAAGGAAGG - Intergenic
983456235 4:167968472-167968494 CTCTCCTCTCCTCAAATGGAAGG - Intergenic
984956927 4:185053989-185054011 ACCTACCCCCCAGAAAAGGATGG - Intergenic
985764104 5:1767961-1767983 CCCTCCTCACCCCAAAAGGGAGG + Intergenic
986343287 5:6811164-6811186 CCCTCCTCTCCAGCAAAGGCAGG + Intergenic
987369838 5:17182783-17182805 CCCTCCTCTCCCCACAATGAGGG - Intronic
989633986 5:43515165-43515187 CCCGCCCCTCCACAACAGGAAGG + Intergenic
990273631 5:54172664-54172686 CTCTCCTCACCAGATAAAGATGG - Intronic
990995934 5:61732233-61732255 CCCTCCTCCCCAGATAACCAAGG + Intronic
992627725 5:78649357-78649379 GCCTCCTCTCCGGAAGAGGGCGG - Intronic
993881574 5:93368536-93368558 CCATTTTCTCCAGAAAAGAAGGG + Intergenic
994888138 5:105593233-105593255 CCCTCTTCCCCAAAAGAGGACGG + Intergenic
995324040 5:110871972-110871994 GCTTCCTCTCAAGACAAGGAAGG + Intergenic
995444115 5:112223556-112223578 CCCACCTGTCAAGAACAGGAGGG + Intronic
996300083 5:121971439-121971461 CCCCCCTCCCCACAAAAGAAGGG + Intronic
997145119 5:131424485-131424507 CTTTCCTCTACAAAAAAGGAAGG - Intronic
997572133 5:134938500-134938522 GACTCTTCTCCAGAATAGGAAGG - Intronic
997955562 5:138275934-138275956 CCCTCCTCTCCAGAAAGGTGAGG + Intergenic
998380206 5:141719019-141719041 TTCTCCTCCCCAGAAAAGGCTGG + Intergenic
998456980 5:142281035-142281057 CCTTCCTCTCCACAAACCGAGGG - Intergenic
1001780385 5:174363779-174363801 ACCTCCTCTCCTGCAAAGGATGG - Intergenic
1004015650 6:11729489-11729511 CCCTCCTCTCAGGGACAGGAGGG - Intronic
1004427779 6:15517738-15517760 CCCCCCTCTCCAGAAGAGCGTGG - Intronic
1004653598 6:17635817-17635839 CACTCCTCTGCTGAAAATGATGG + Intronic
1004876673 6:19962604-19962626 TCCTCCTCTTTAGAAAAGGGAGG + Intergenic
1005449932 6:25962684-25962706 TCCGCCTCTCCGGTAAAGGAGGG - Intergenic
1005825143 6:29627893-29627915 CCCTCCTCCCCACAAAATCAGGG - Intronic
1007805869 6:44445642-44445664 CCCTGCTCTCCAGATAAACAGGG + Exonic
1009881391 6:69570826-69570848 CCCTCAACTCCAGCAAATGAAGG - Intergenic
1009996413 6:70900333-70900355 TCATCTTCTCCAGGAAAGGAGGG + Intronic
1010552759 6:77243160-77243182 CCCACCCCTCCAAAAAAGCATGG - Intergenic
1011344574 6:86354624-86354646 AGCTTCTCTCCAGAAAAGGAAGG + Intergenic
1011459718 6:87590279-87590301 CCCTCCTCTCCAGCCAGGGAAGG - Intronic
1011719382 6:90139587-90139609 CCCTCCTCCCCAGAAAAAAAAGG - Intronic
1013161557 6:107550006-107550028 CCCTCCTCTCCACACCTGGAAGG + Intronic
1013374481 6:109501283-109501305 CCCTCCTCCCCAGTACAGGCAGG - Intronic
1014931319 6:127339973-127339995 TGCTCCTCTTCAGAAAGGGAAGG + Intronic
1015745679 6:136507162-136507184 CCCTGCTCCCCAGAAAAGTGGGG + Intronic
1017806746 6:157952980-157953002 CCCTGGGCTCCAGAACAGGAAGG - Intergenic
1018710175 6:166493311-166493333 CCCTTCTCCACAGAAAAGGGTGG - Intronic
1018962374 6:168457918-168457940 CCCCCCTCCCCAGAAGATGATGG - Intronic
1019522461 7:1467022-1467044 CCCTCCACTCCTGAAAGGAAGGG + Intergenic
1019928344 7:4207685-4207707 CCCTTCTCTCCAGAAGATGGGGG + Intronic
1021653190 7:22851300-22851322 CATTCCTTTCCAGAGAAGGAAGG - Intergenic
1021653201 7:22851364-22851386 AGCTCCTCTACAGAAAAGCATGG + Intergenic
1022136383 7:27453297-27453319 CCCTCATCTCAAGGAAAGCACGG + Intergenic
1023771094 7:43557307-43557329 CCTTCCTCTGCAGAAAGGAAAGG + Intronic
1024638660 7:51311328-51311350 CCAGCCCCTCCAGAGAAGGATGG - Intronic
1024706058 7:51961025-51961047 TCCTTCTCTGCAGAAAAAGAAGG - Intergenic
1027405452 7:77855378-77855400 CTCTCCTCTCCCCAAATGGAAGG + Intronic
1028404551 7:90461423-90461445 CCATCCTGCCCAGAGAAGGAAGG - Intronic
1029053818 7:97718559-97718581 CCTTCCTCTTCAGAAATGCATGG + Intergenic
1030804082 7:113892195-113892217 TCCTTCTCTCCACAAAAGAAAGG + Intronic
1032075937 7:128836238-128836260 CCCTCATCTCCTGAAAAGATAGG + Intronic
1032197672 7:129798795-129798817 GCCTCCTGCCCAGAGAAGGAAGG - Intergenic
1032704871 7:134413145-134413167 TTCTCCTCTTTAGAAAAGGATGG - Intergenic
1032719356 7:134538127-134538149 TCTTCCTTTCCATAAAAGGAGGG + Intronic
1032724325 7:134576896-134576918 TCTTCCTTTCCATAAAAGGAGGG + Intronic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1035307506 7:157942739-157942761 CCCTCCTTCCTAGAAAAGGTGGG - Intronic
1035486968 7:159233602-159233624 CCCTCCACTCCAGAATTGGGTGG + Intergenic
1035925400 8:3722481-3722503 CCATTCTCTCCTGAAAAGCAGGG + Intronic
1036699327 8:11001626-11001648 CCCTCATCTCCAGGAATGGGGGG - Intronic
1037261772 8:17017791-17017813 CCCTCCTCTTCATTAAAGGAGGG + Intergenic
1037478603 8:19282380-19282402 CCTTCCTCTTAAGAAATGGAAGG - Intergenic
1037908466 8:22729169-22729191 CCCTCCTCTCCTGGAAGAGATGG - Intronic
1038412985 8:27372747-27372769 CCCTTCCCTCCAGAACAGGGTGG - Intronic
1039171843 8:34756408-34756430 TCCTCATCCCAAGAAAAGGATGG + Intergenic
1039442927 8:37607939-37607961 CCATCCCCTGCAGAACAGGAGGG + Intergenic
1039457235 8:37715668-37715690 CTCCCCTGTCCAGAACAGGAAGG + Intergenic
1042257286 8:66817932-66817954 ACCCCCTCTCCAGAAAAAAAAGG + Intronic
1043593431 8:81856182-81856204 CCTTCCTGACCAGAACAGGAAGG + Intergenic
1044079467 8:87865879-87865901 CCATTCTCTCCACAACAGGAAGG + Intergenic
1044704712 8:94997137-94997159 CGTTCCTCTCCACAAAATGAAGG - Intronic
1045071058 8:98505448-98505470 ACCTCTTCTCCCCAAAAGGATGG - Intronic
1045335908 8:101204910-101204932 CTCTCCTCTCCCCAAAACGATGG - Exonic
1046890682 8:119417560-119417582 CCCTCCTGTCCAGAAAGGAAGGG - Intronic
1047481163 8:125284364-125284386 CCATCCACTTCAGAGAAGGAGGG + Intronic
1048416211 8:134230315-134230337 CCCTGCTTTGCAGAAAAGGCTGG - Intergenic
1048447614 8:134503679-134503701 CCCTCCCCTTTTGAAAAGGAGGG + Intronic
1049107928 8:140625174-140625196 CACTGCACTCCAGCAAAGGAGGG - Intronic
1049653634 8:143788315-143788337 CCCTGCTCCACAGACAAGGAGGG + Intergenic
1052115558 9:24645154-24645176 CCCTACAGTCCAGAAAAGAATGG - Intergenic
1054861025 9:69953524-69953546 CCCACCACTCCAAAAAAAGAAGG + Intergenic
1055092369 9:72376004-72376026 ACCTCTTAGCCAGAAAAGGATGG - Intergenic
1055483559 9:76734179-76734201 CCCTCCTTTCCACAGAAGGAGGG - Intronic
1055610920 9:78023147-78023169 CCCTGCCCTCTGGAAAAGGAAGG + Intronic
1057003034 9:91530494-91530516 AGCTCATCTCCAGAAAAGCATGG + Intergenic
1057993811 9:99800683-99800705 CCCTGTTCTCCAGAAAAAGGGGG + Intergenic
1060877829 9:127095991-127096013 CCTTCCTCCCCAGAAGATGAAGG - Intronic
1060887773 9:127167751-127167773 CGCACCTCTCCAGAAAGCGAGGG + Intronic
1061169033 9:128941379-128941401 CCCCCCTCCCCAGAGCAGGAAGG - Intronic
1061417114 9:130453140-130453162 CCCACCTTTCCCAAAAAGGAGGG + Intronic
1061913164 9:133735441-133735463 GCCTTCTCTCCTGAGAAGGAGGG - Intronic
1186092873 X:6068473-6068495 CCCTCCACTCCAGGAAGGCATGG + Intronic
1186448039 X:9648622-9648644 CCCTCCTCTTCTGTGAAGGAAGG + Intronic
1189063992 X:37786603-37786625 CCCACCACTCCAGGAAAGGTAGG + Intronic
1189490899 X:41471109-41471131 CCCCCCCCTCCAAAAAAAGAAGG - Intronic
1190475531 X:50823457-50823479 CCCTCTTTTGCAGAGAAGGAAGG + Intergenic
1190640694 X:52481196-52481218 CCCTGCTCTACAGAAAATGATGG + Intergenic
1190646978 X:52531669-52531691 CCCTGCTCTACAGAAAATGATGG - Intergenic
1192841128 X:74857257-74857279 CTCTCCTCTCCTGAAGAGGAAGG - Intronic
1193912087 X:87317866-87317888 CTCTCCTCTCCTCAAATGGAAGG + Intergenic
1194247524 X:91534483-91534505 CTCTCCTCTCCTCAAAAGAAAGG + Intergenic
1195000147 X:100636091-100636113 CCGTCCTCTCCAGGTAGGGATGG + Intronic
1195090177 X:101450966-101450988 CTCTCCTCTACAGAAATGGAAGG + Intronic
1195718595 X:107843384-107843406 CCCTCATCTCCAGGGATGGATGG + Intronic
1196281580 X:113828978-113829000 CTCTCCCCTCCAAAAAAGAAGGG + Intergenic
1196750822 X:119115900-119115922 CCCTAGTCTCCTGAAATGGAGGG + Intronic
1197316510 X:124972752-124972774 ACTTCTTCTCCAGAAAATGATGG + Intergenic
1197953203 X:131919455-131919477 CCTTCTTCTCCAGAACAGGGAGG + Intergenic
1198178016 X:134174130-134174152 CCCTCCCCTCGAAAAAAGGGGGG + Intergenic
1198611929 X:138411375-138411397 CTCTCCTCTCCTCAAATGGAAGG - Intergenic
1200101937 X:153692642-153692664 CACCTCTCTCCAGAAGAGGAGGG + Intronic
1200566547 Y:4776016-4776038 CTCTCCTCTCCTCAAAAGAAAGG + Intergenic