ID: 973162955

View in Genome Browser
Species Human (GRCh38)
Location 4:47041306-47041328
Sequence CAAGTTGGTCTCCTGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973162955 Original CRISPR CAAGTTGGTCTCCTGGAAAG AGG Intronic
901858815 1:12061603-12061625 GAAGTGGGTCTCTTGGGAAGGGG + Intergenic
904327627 1:29737809-29737831 CAAGTGGGTGGACTGGAAAGAGG - Intergenic
913672350 1:121109337-121109359 CAAGTTATTCCCCTGTAAAGTGG - Intergenic
914662604 1:149804730-149804752 CAAGTTATTCCCCTGTAAAGTGG - Intronic
916197980 1:162242861-162242883 CAAATTGGTCTTCGGGAAGGAGG + Intronic
916992412 1:170258304-170258326 CTAGTTTGTTTCCTGGAAATTGG - Intergenic
917830038 1:178872983-178873005 TAAGCTGGTTTCCTGGAAATTGG - Intronic
1062891150 10:1061328-1061350 CAGGTTGGTATCATGGGAAGAGG - Intronic
1063164493 10:3447837-3447859 TAAGTTGGTTTCCTAGGAAGTGG + Intergenic
1063666322 10:8062756-8062778 CAAGTTGGTCCCCCAGAGAGGGG - Intronic
1063925796 10:10976011-10976033 CAGGTTGTTGCCCTGGAAAGGGG + Intergenic
1065115465 10:22478804-22478826 GAAGTTGGTCGCCTGGGAGGAGG + Intergenic
1065154011 10:22851243-22851265 CAAGTTTGTCTCCTGGAGCTAGG - Intergenic
1068357132 10:55923499-55923521 CTATTCGTTCTCCTGGAAAGGGG - Intergenic
1070345272 10:75535849-75535871 CAGTGTGGTCTACTGGAAAGTGG + Intronic
1071954895 10:90747128-90747150 TAAGTTGTTCTTCTGAAAAGTGG + Intronic
1073580376 10:104660242-104660264 CAAGGTGGCTTCCTGAAAAGTGG + Intronic
1076220242 10:128728018-128728040 CAAGCAGATCACCTGGAAAGAGG + Intergenic
1081080227 11:38732079-38732101 CCATTTGCTCCCCTGGAAAGGGG - Intergenic
1083915731 11:65742460-65742482 CAAGTTGTTGGCATGGAAAGGGG + Intergenic
1088105525 11:106202891-106202913 CAATTTGTTCTTCTGCAAAGTGG - Intergenic
1089333763 11:117708470-117708492 CAATTTTCTCTCCTGTAAAGTGG + Intronic
1089784606 11:120898975-120898997 CAAGGTGGGCTGCTGGGAAGGGG - Intronic
1091936847 12:4441572-4441594 CATGTCTGTCTCCTGGAAAGAGG - Intronic
1094636106 12:32228149-32228171 CACGATAGTCTCTTGGAAAGGGG + Intronic
1102401975 12:112637825-112637847 CAGGTGGGGCTGCTGGAAAGGGG - Intronic
1106501251 13:30330998-30331020 CAAGTTAGTTTCATGGATAGTGG - Intergenic
1113246333 13:108400576-108400598 CTAGCTGGTCTCCTGAGAAGAGG - Intergenic
1113697015 13:112354135-112354157 CCAGGTGGGGTCCTGGAAAGTGG + Intergenic
1117439605 14:55747250-55747272 CAAGTTCCTCACCTGGAAAATGG - Intergenic
1118163002 14:63309682-63309704 CAGCTTGGTCTCCAGGCAAGGGG + Intergenic
1119871945 14:78025563-78025585 CAAAATGGTCTCTAGGAAAGAGG + Intergenic
1121797682 14:96748731-96748753 TAAGATGTTCTTCTGGAAAGAGG + Intergenic
1127823906 15:62686394-62686416 CAAGCTGCTCTCCTGAACAGGGG + Intronic
1129179065 15:73860190-73860212 CAAGTTTATCTGCTGGAAAGAGG - Intergenic
1132414397 15:101610280-101610302 CTAGTTGGTCCCTGGGAAAGTGG - Intergenic
1133270935 16:4610520-4610542 GATGTTGGTCTCCTGGAAAAAGG + Exonic
1133475248 16:6115033-6115055 CAGGTTGTTGTCATGGAAAGGGG + Intronic
1135378759 16:21975132-21975154 CAGGTTGGAATCCTGCAAAGTGG + Intronic
1141126940 16:81407659-81407681 CAGGTTGCTCTCCTGGAAACAGG - Intergenic
1141400814 16:83745298-83745320 CAAGTTTTTGTCCTGCAAAGTGG - Intronic
1143123778 17:4627526-4627548 CAAGAAGCTCTCCTGGAAAGGGG - Intergenic
1143426363 17:6842350-6842372 CAAGAAGCTCTCCTGGAAAGGGG + Intergenic
1144406303 17:14955751-14955773 TATTTTGGTCTACTGGAAAGGGG + Intergenic
1147228405 17:38999134-38999156 CAAGTGGATCACCTGGCAAGTGG - Intergenic
1150461466 17:65357019-65357041 GAAGTTGGTCTCCTGGACTCTGG + Intergenic
1154058736 18:11037671-11037693 CAAAGTGGTCTTCTGGAAAGAGG - Intronic
1155313765 18:24550689-24550711 CAAATTGCTCTTCTGGAAATAGG + Intergenic
1155705718 18:28809178-28809200 CATGTTAGTCTGCTAGAAAGTGG - Intergenic
1156444466 18:37224972-37224994 CAAGTTTGCCTCCTGGAAAGCGG - Exonic
1159583645 18:70262329-70262351 CAAGTGAGTTACCTGGAAAGAGG + Intergenic
1160244938 18:77150135-77150157 CAGGTAGGCATCCTGGAAAGTGG + Intergenic
930391317 2:50765116-50765138 TAAGTTAGTTTCATGGAAAGAGG - Intronic
930478610 2:51917574-51917596 CAAGATATTCTCCTGAAAAGTGG + Intergenic
933901504 2:86853616-86853638 CAGCTTGGTGTCCTGGAGAGAGG + Intronic
935398229 2:102632956-102632978 CCAGTGGGTCTCCAGGAAACAGG - Intronic
936795418 2:116197026-116197048 TAACTTGGTGTCCTTGAAAGGGG + Intergenic
937039495 2:118809833-118809855 AATGTTTCTCTCCTGGAAAGAGG + Intergenic
945109370 2:206347918-206347940 CAAATTAATCTCCTTGAAAGAGG + Intergenic
947087985 2:226477027-226477049 TGAGTTGGTCTCCTTGAAACAGG - Intergenic
947720546 2:232367136-232367158 CAGATTTGTCTCCTGGAGAGAGG + Intergenic
1173143673 20:40506610-40506632 GAAGTTGGTCTCCGGGGCAGAGG - Intergenic
1174190304 20:48735652-48735674 CACGCTGCTCTCCTGGAATGGGG + Intronic
1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG + Intronic
1175806490 20:61831996-61832018 CAAGGTGGTCTCCTGGTCAAAGG - Intronic
1177432212 21:21004881-21004903 CAAGGTGATGTCCTGGTAAGAGG - Intronic
1177889546 21:26789110-26789132 CATGTTGGACTACAGGAAAGAGG + Intergenic
1178614484 21:34119296-34119318 CAAATGGGTGTCATGGAAAGTGG - Intronic
1179428066 21:41297267-41297289 AGAGTGGGTCTCTTGGAAAGGGG - Intergenic
1179815620 21:43904403-43904425 CCAGTCGGTCTCCAGGAGAGGGG - Intronic
960368304 3:116802278-116802300 CAAGCTGGTTTCCAGGAAAATGG - Intronic
960933114 3:122874759-122874781 CAAGGTGGTTTCCAGGAAAAAGG + Intronic
961199445 3:125032625-125032647 CAAGCTGGTCTCCTGGGAGGAGG + Intronic
962011869 3:131399709-131399731 GAAGCTGCTCTCCTGGAAACTGG - Intergenic
963149092 3:142025170-142025192 CAAGTTTGTTACCTGGAAATTGG - Intronic
966781843 3:183590842-183590864 TGAGTTGGTTTTCTGGAAAGAGG + Intergenic
968712423 4:2128554-2128576 CAAGATGGTCTCTGGGGAAGAGG + Intronic
969329074 4:6462516-6462538 CAAGTTGGTAGCCTGAAAAGGGG + Intronic
969830918 4:9795990-9796012 CAATTTTGTCACCTGTAAAGTGG - Intronic
971943220 4:33241561-33241583 CAAGTCACTCTCCTGAAAAGGGG - Intergenic
972418655 4:38867340-38867362 CAAACTGGCCTTCTGGAAAGTGG + Intergenic
972436415 4:39039889-39039911 CAAGTAGGTCTCCTGTAACCAGG - Intergenic
973162955 4:47041306-47041328 CAAGTTGGTCTCCTGGAAAGAGG + Intronic
973996840 4:56467336-56467358 CATGGCGGTCTCCTGGAAACAGG + Exonic
976840185 4:89423387-89423409 CTACATTGTCTCCTGGAAAGAGG + Intergenic
978108245 4:104930711-104930733 AAAGTTAGACCCCTGGAAAGGGG + Intergenic
978656424 4:111070535-111070557 CAAGCTGTTCTCCTGGAAATGGG - Intergenic
980198059 4:129617496-129617518 CAAGGTGTTCTCCTGGCTAGAGG + Intergenic
981158227 4:141465325-141465347 ACAGTTGGTCTCCTGGGAGGAGG + Intergenic
981908586 4:149952530-149952552 CAAGTTGTTGTCCTGGAGTGGGG - Intergenic
984786391 4:183571333-183571355 CAAAGTGCTCTCCTGGAGAGAGG + Intergenic
985490716 5:176921-176943 CAGCTGGGTCACCTGGAAAGTGG + Intronic
989424083 5:41275653-41275675 GAAGTTGGACTTCTGGAAAACGG - Intergenic
991573530 5:68079729-68079751 CAAGGTGGCCTGCTGAAAAGGGG - Intergenic
992002215 5:72446858-72446880 AAAGTTGCTCTGCTGAAAAGTGG - Intronic
996283974 5:121767083-121767105 CAAGTTGGTCATATGGAAAAGGG - Intergenic
999178682 5:149652906-149652928 GAAGTAGGTCTTGTGGAAAGAGG - Intergenic
999673323 5:153976117-153976139 TAAGTAGGTGTCCTGGGAAGAGG - Intergenic
1001453783 5:171845757-171845779 CAACTTGGAGTCCGGGAAAGGGG + Intergenic
1001556063 5:172637991-172638013 CAAGCTGATCTCCTGGGATGTGG - Intergenic
1002660335 5:180787243-180787265 CAGGCTGGTCTCCAGGAAATAGG + Intergenic
1005334094 6:24775598-24775620 CAAATTTGGCTCATGGAAAGAGG + Intronic
1006519120 6:34561393-34561415 CAACATGGTGTCCTGGAGAGAGG - Intergenic
1009682614 6:66918095-66918117 AAAGTTGTGCTCCTGGAAATGGG - Intergenic
1011509075 6:88080315-88080337 CAAGTTTGTCTCCTTGTGAGAGG + Intergenic
1011534550 6:88362061-88362083 CCAGTTTGTCTCCTGAAAGGTGG - Intergenic
1013467382 6:110429796-110429818 CTGGCTGGCCTCCTGGAAAGCGG + Intronic
1018273868 6:162109092-162109114 CAAGTTGTTGTCGTGAAAAGGGG + Intronic
1018345088 6:162891792-162891814 CCAGTTGGTCTCATCGAAACAGG - Intronic
1019266241 7:118959-118981 CAGGTTAGTCGCCTGGAAAAGGG + Intergenic
1020136730 7:5592133-5592155 CAAATAGGTCTCCGGGAGAGTGG - Intergenic
1020265742 7:6558958-6558980 CAGGGTGGTGGCCTGGAAAGTGG - Intergenic
1021858196 7:24878924-24878946 CAGCCTGGTCTCCTGGAATGTGG - Intronic
1024551218 7:50564020-50564042 CACCCTGGTCTCCAGGAAAGGGG - Intronic
1024627844 7:51223591-51223613 CTGGTTGGTTTCCTGGAAACTGG - Intronic
1024718395 7:52106834-52106856 CAAGTTGTTGTCATGGAAAGGGG + Intergenic
1027507850 7:79040422-79040444 AAAGTTGGTCTCATGGAGGGTGG + Intronic
1032554488 7:132817494-132817516 CAGGTGGCTCTTCTGGAAAGTGG - Intronic
1032722309 7:134560295-134560317 CAAGTTAGCCTCATGGAAAACGG + Intronic
1033617639 7:143032166-143032188 CCATTCGCTCTCCTGGAAAGGGG + Intergenic
1035480398 7:159177864-159177886 CAAGTTGCTCTCCTCTAAAAAGG + Intergenic
1037388060 8:18364488-18364510 CTAGTTTCTCTCCAGGAAAGAGG - Intergenic
1037728908 8:21507069-21507091 GAAGTAGGTTTTCTGGAAAGAGG + Intergenic
1038673884 8:29606015-29606037 CAATTTGCTCACATGGAAAGTGG - Intergenic
1043962463 8:86432928-86432950 CAAGTAGCTTTCCTGTAAAGGGG - Intronic
1045151811 8:99416406-99416428 CCATTTGCTCCCCTGGAAAGGGG - Intronic
1046849666 8:118957900-118957922 CTAGTTCCTCTCCTGGGAAGTGG + Intergenic
1047835626 8:128687722-128687744 CAAGTTGCTCCCATGGAAACTGG - Intergenic
1048916229 8:139186206-139186228 CAAGTAGATCACCTAGAAAGTGG + Intergenic
1051213450 9:14770730-14770752 CAAGTGGGGCTCCTGAAAAATGG - Exonic
1052278499 9:26705787-26705809 CAGGTTGGTATCCTGGAGATTGG + Intergenic
1059000847 9:110347342-110347364 CTACTTGGTCTCATGGAAAAAGG + Intergenic
1060943989 9:127559271-127559293 CAAGATGGCCTCCTGCAATGTGG + Intronic
1188201668 X:27299673-27299695 CAGTTTACTCTCCTGGAAAGGGG + Intergenic
1188536402 X:31201592-31201614 TAGGTTGGTCTCCTGATAAGGGG + Intronic
1189245040 X:39556931-39556953 CAACTGGGTTTGCTGGAAAGAGG - Intergenic
1189856953 X:45233183-45233205 CAAGCTGGTCTCCTGGCATCAGG - Intergenic
1190566800 X:51738720-51738742 TTAGTTGATCTCCTGGAAACAGG + Intergenic
1190576435 X:51844158-51844180 CAATTTGGGAACCTGGAAAGGGG - Intronic
1193995263 X:88358990-88359012 AAAGTTGGACTCATGGAAGGGGG + Intergenic
1196829252 X:119763413-119763435 CACTTTGCTCCCCTGGAAAGAGG - Intergenic
1201511527 Y:14769701-14769723 CCATTTACTCTCCTGGAAAGAGG + Intronic
1201695749 Y:16823797-16823819 CACTTTGGTCTCATGTAAAGGGG + Intergenic