ID: 973169568

View in Genome Browser
Species Human (GRCh38)
Location 4:47122616-47122638
Sequence CACCCAGTGTCCTTTGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973169568_973169570 6 Left 973169568 4:47122616-47122638 CCAGTCTCAAAGGACACTGGGTG 0: 1
1: 0
2: 1
3: 13
4: 159
Right 973169570 4:47122645-47122667 AGCAGGAGCTAATGTCTCTGAGG 0: 1
1: 0
2: 1
3: 29
4: 212
973169568_973169571 7 Left 973169568 4:47122616-47122638 CCAGTCTCAAAGGACACTGGGTG 0: 1
1: 0
2: 1
3: 13
4: 159
Right 973169571 4:47122646-47122668 GCAGGAGCTAATGTCTCTGAGGG No data
973169568_973169572 8 Left 973169568 4:47122616-47122638 CCAGTCTCAAAGGACACTGGGTG 0: 1
1: 0
2: 1
3: 13
4: 159
Right 973169572 4:47122647-47122669 CAGGAGCTAATGTCTCTGAGGGG 0: 1
1: 0
2: 0
3: 14
4: 131
973169568_973169573 25 Left 973169568 4:47122616-47122638 CCAGTCTCAAAGGACACTGGGTG 0: 1
1: 0
2: 1
3: 13
4: 159
Right 973169573 4:47122664-47122686 GAGGGGAAGTATGATAGACTTGG 0: 1
1: 0
2: 0
3: 16
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973169568 Original CRISPR CACCCAGTGTCCTTTGAGAC TGG (reversed) Intronic
900318126 1:2069562-2069584 CACCTACTGTCCTTTGAGACAGG - Intronic
902835716 1:19045436-19045458 CCCCCAGTGTCCCCTGAGGCTGG + Intergenic
904371022 1:30047488-30047510 GACCCAGAGTCTATTGAGACTGG + Intergenic
904542881 1:31245360-31245382 CACCCACTGACCTCTGAGAATGG - Intergenic
905734177 1:40314897-40314919 CACCAAGGGTCCTTTGGCACTGG - Intronic
907283417 1:53365559-53365581 CACGCAGTGGCCTCTGCGACCGG + Intergenic
908648153 1:66302161-66302183 GACCCACTGGCCTTGGAGACAGG + Intronic
912420921 1:109541849-109541871 CTCCCAGTTTCCTTCCAGACGGG + Intronic
912681843 1:111733871-111733893 CAGCCAGAATCCTTTGATACAGG + Intronic
912947841 1:114099428-114099450 CACAGAGTGTCCTCAGAGACAGG - Intronic
913192387 1:116424654-116424676 CACCCATTACCCTTTGTGACTGG - Intergenic
919971272 1:202580950-202580972 AACCCAGTGTCCTCTGATATAGG + Exonic
921476522 1:215616958-215616980 CACCCAGCAACCTTTGAGAAGGG + Intronic
921727460 1:218539567-218539589 CAACCAGTGTGCTCTGTGACTGG - Intergenic
923631427 1:235651044-235651066 CGCCCTGTGTCCTTTGTGGCAGG - Intergenic
924043880 1:240009216-240009238 CACCCAGAGTCCACTGAGGCAGG + Intergenic
1063566461 10:7175428-7175450 CACCCTGTGTCCTGGGAGAGAGG + Intronic
1067664928 10:48269646-48269668 CACCCAGTGGGGTTTGTGACAGG - Intronic
1069949144 10:72007539-72007561 CGCACAGTGTCCTTCGAGCCGGG + Exonic
1070325508 10:75386191-75386213 CGCACAGTGTCCTTTCAAACAGG - Intergenic
1070646616 10:78206149-78206171 CACTACATGTCCTTTGAGACTGG + Intergenic
1071805422 10:89115051-89115073 AAACCAGTTTCCTTAGAGACAGG - Intergenic
1072131609 10:92499436-92499458 CACCCAGCCTTCTTTAAGACAGG + Intronic
1074506299 10:114073765-114073787 CACCCTGTGACTTTTGAGTCTGG + Intergenic
1075646923 10:124102748-124102770 CAGCCCCTGTCCTTGGAGACTGG - Intergenic
1076196552 10:128522654-128522676 GACCCAGTTTCCTTGGAGAGGGG - Intergenic
1076324995 10:129614172-129614194 CAGCCATTGTCTTTTGTGACTGG + Intronic
1076823912 10:132957802-132957824 GACCCAGTGTCTTCAGAGACGGG - Intergenic
1078012890 11:7587183-7587205 CACTCAGTGTCCTTTGTGTGTGG - Intronic
1080578594 11:33622922-33622944 CACCCAGCTTCCTTTGTTACAGG + Intronic
1081569780 11:44282572-44282594 CCCCAAGTGTCCTTTGACAGGGG + Intronic
1083971309 11:66077553-66077575 CACCCATTTTTGTTTGAGACAGG - Intronic
1084222907 11:67695546-67695568 CACCCAGTCTCCTTCGGGTCGGG - Intergenic
1087928843 11:103952057-103952079 CAGCCAGTGTCCATTCTGACTGG + Intronic
1089609093 11:119659600-119659622 CTCCCAGTATCCTTTGGGCCGGG + Intronic
1089623087 11:119733929-119733951 CCACCAGTGACCTTTGAGAGAGG + Intergenic
1092585396 12:9895727-9895749 CACCCAGTTTCCTGTGATAACGG - Exonic
1095353252 12:41240346-41240368 CACCCATTATGTTTTGAGACAGG - Intronic
1095711805 12:45297131-45297153 TACCCAGTGCCCTTTGTGCCAGG + Intronic
1095721604 12:45407411-45407433 CACCCAGTGACCTTAGAGTTCGG + Intronic
1099632796 12:85172259-85172281 TACAGAGTGTCCTATGAGACAGG - Intronic
1106124195 13:26886738-26886760 CACATACTCTCCTTTGAGACTGG - Intergenic
1106182062 13:27378133-27378155 GACCCAGTGTCATTGAAGACTGG + Intergenic
1106874989 13:34061963-34061985 CACCTAGTGTCCTGTGCGTCTGG + Intergenic
1113637658 13:111931073-111931095 CAGCACGTGCCCTTTGAGACTGG + Intergenic
1118443405 14:65831454-65831476 CAGCCAGGGTCTTTGGAGACAGG - Intergenic
1119426827 14:74541035-74541057 CAGCCAGTGAGCTTTGTGACAGG + Intronic
1120352406 14:83379530-83379552 CACCCAGTGTTCTTGGCCACAGG - Intergenic
1120887854 14:89465910-89465932 AAAACAGTGTCCTTTAAGACAGG + Intronic
1123145524 14:106126363-106126385 CACCCATTGTCCCATGACACAGG - Intergenic
1125193099 15:37016036-37016058 CACCCAGTATTCTTTGATCCAGG + Intronic
1125285831 15:38091556-38091578 CACCCACTTTCCTTTTAGAGCGG - Intergenic
1125733388 15:41906998-41907020 CACCCAGGGTCCTCTGAGCTGGG - Intronic
1127083518 15:55404279-55404301 CACCAAGTGTCCATTAACACTGG - Intronic
1128551944 15:68603553-68603575 CCCCCAGTGTGTTTGGAGACAGG + Intronic
1129393783 15:75233609-75233631 CAGCCAGTGTCCTCTGTGGCCGG - Intergenic
1130782159 15:87051927-87051949 TATCCAGTTTCCTTTGAAACTGG - Intergenic
1131752023 15:95519987-95520009 CAACCAGAGTCCTTCGGGACTGG + Intergenic
1133016836 16:2947213-2947235 CACTCTGTGTGCTTTGTGACTGG - Intronic
1133639944 16:7707165-7707187 CATCAAGTGCCCTTTGACACAGG + Intronic
1138891003 16:61144092-61144114 CAACCAGTGTCCTTCTAAACAGG - Intergenic
1139402197 16:66691875-66691897 CACACAGTTTCTTTAGAGACAGG + Intronic
1139676202 16:68525560-68525582 CACCCAGTTTCCCTCGATACTGG - Intergenic
1141151713 16:81568806-81568828 CACCCACTCGCCTTTCAGACTGG - Intronic
1141577223 16:84971741-84971763 ACCCCAGTATCCTTAGAGACAGG + Intergenic
1142179672 16:88662336-88662358 CACCCAGTATCTTTTGAGTTTGG - Intronic
1142494562 17:299453-299475 CCCCCAGGGTCCTTTTAGCCTGG - Intronic
1143185615 17:5008285-5008307 TATCCAGTGTCCTTTCTGACTGG - Intronic
1143905732 17:10207751-10207773 CCCCCCTTGTCCTTTGAGATAGG - Intergenic
1149368073 17:55965486-55965508 CACACAGAGTACTTTGAGGCAGG + Intergenic
1150856854 17:68761325-68761347 CACCCTTTGTCCTTTGACATTGG + Intergenic
1152001949 17:77652095-77652117 CACCCAGTGACCTTCGAGGAGGG - Intergenic
1153973922 18:10250030-10250052 ATCACTGTGTCCTTTGAGACAGG + Intergenic
1156293566 18:35770817-35770839 GTCCCAGTGTCCTCTGGGACTGG - Intergenic
1156384278 18:36591915-36591937 CACCTTGTTTCATTTGAGACAGG - Intronic
1157408649 18:47445339-47445361 CTTCCAGAGTCCTGTGAGACAGG - Intergenic
1158917150 18:62144988-62145010 CCGCCAGTTTCCTTAGAGACAGG - Intronic
1160571358 18:79819498-79819520 CACTCAGTGTCCCTTCAGATCGG + Intergenic
1160915453 19:1494327-1494349 CACCCAGTGTCCCCTGGGGCGGG - Intronic
1162513140 19:11131831-11131853 CACCCAGTGTCTTTCGAGGTGGG + Exonic
1163000995 19:14367105-14367127 GCCCCAGTCTCCTCTGAGACTGG + Intergenic
1163197345 19:15732437-15732459 ATCCCTGTCTCCTTTGAGACTGG + Intergenic
1165333964 19:35156198-35156220 CACCCATTCTCCTCTGACACAGG - Intronic
1165757432 19:38302361-38302383 CAGCCTGTGTGTTTTGAGACAGG + Intronic
1165930864 19:39357603-39357625 CACTCTGTGTCCTGTGAGATTGG + Intronic
1167692811 19:50997332-50997354 CAGCCACTTTTCTTTGAGACCGG - Intronic
931613110 2:64125206-64125228 CACCCAGTGACCTCTGGGAAAGG - Intronic
932264444 2:70355083-70355105 CACCCTCTGTCCTGTAAGACTGG + Intergenic
932318576 2:70802977-70802999 CCCCCACTGTTTTTTGAGACTGG - Intergenic
934586289 2:95499990-95500012 CACCCTGTATTCTTTGATACAGG - Intergenic
937647776 2:124284921-124284943 CACCCAGGGTATTCTGAGACAGG + Intronic
940340387 2:152574556-152574578 CTCCCATTTTCCTTAGAGACTGG + Intronic
944478142 2:200127573-200127595 TCCCCAGTGTCCTGTGAGACAGG + Intergenic
945138095 2:206651787-206651809 CACCAAGAGGCCTTTGAGCCTGG + Exonic
947832198 2:233149487-233149509 GTCCCTGTGTCCTTGGAGACAGG + Intronic
1170011265 20:11726803-11726825 CCCACAGTCTCCTTTGAGAATGG - Intergenic
1172914848 20:38435883-38435905 CATCCCGTGTACTTTGAGGCTGG - Intergenic
1174687566 20:52470176-52470198 GGCCCAGTGTCCTTTGAGGTGGG + Intergenic
1174935465 20:54863227-54863249 CACCCAGTGTTTATTTAGACAGG - Intergenic
1175847643 20:62066649-62066671 CACCCAGCTGCCTTGGAGACAGG + Intergenic
1176143555 20:63555420-63555442 CAACCAGTGGCCTGTGGGACAGG - Exonic
1176241629 20:64078273-64078295 GGCCCAGTTTCCTCTGAGACTGG + Intronic
1177821837 21:26039088-26039110 CACCCAATGTCTTTTTAGGCAGG + Intronic
1179510264 21:41868079-41868101 CAGCCTGTGACCTTTGAGATTGG + Intronic
1180241450 21:46509490-46509512 CACCCAGTGACCACTGAGTCTGG - Intronic
1183528620 22:38339335-38339357 CACCCAGGGGGCTTTGAGGCTGG + Intronic
950014705 3:9747460-9747482 CACCCAGCTTCCCCTGAGACTGG - Exonic
950479715 3:13236852-13236874 CACCCAGGGTACTTTGGGAAGGG + Intergenic
950669180 3:14515089-14515111 CACCATGTGGCCTTTGTGACAGG + Intronic
952159779 3:30682007-30682029 CACCCAGCTTCCTTTGAGTCAGG - Intronic
952636332 3:35537268-35537290 CACCCAGTTCCCTTTGAGCCAGG + Intergenic
954184729 3:48908060-48908082 CACCTAGGGTCTTTTGAGACAGG + Intergenic
954663123 3:52236716-52236738 CACCCAGTGGCCTTGGAGGGTGG - Intronic
956506751 3:69948836-69948858 CAACCAGTTCCCTTTGAGGCAGG - Intronic
956512912 3:70014190-70014212 CACCTAGTGACCTGTGACACAGG + Intergenic
959528211 3:107401581-107401603 CAACCAGTCTCCTTTGAAGCTGG - Intergenic
962070850 3:132032974-132032996 CACCCACCGTCCTATGACACAGG - Intronic
963372794 3:144423006-144423028 CACTCTCTGTCCTTTGAGAAAGG + Intergenic
973169568 4:47122616-47122638 CACCCAGTGTCCTTTGAGACTGG - Intronic
979055713 4:115991308-115991330 CAGCCAGTGTTATTTTAGACTGG + Intergenic
984924414 4:184794223-184794245 CATCCAGTGACCTTTCAGAGAGG + Intronic
991202702 5:64012823-64012845 GATGCAGTGTCCTTTAAGACTGG + Intergenic
992885028 5:81150050-81150072 CATCCATTGTCCTTTGGAACAGG - Intronic
996330744 5:122325640-122325662 CTTACAGTGTCCTCTGAGACAGG - Intronic
996552134 5:124742159-124742181 CACCCAGTTTCCTCTGTGACTGG + Intronic
998373220 5:141674254-141674276 CGCCCAGCCTCTTTTGAGACAGG + Intronic
999492447 5:152064516-152064538 CACCCACTGACCTTTGAGAGTGG - Intergenic
1000290244 5:159863373-159863395 CACCCAGTGTACTTAAAGAAAGG - Intergenic
1000848051 5:166305636-166305658 CACCCATTGACCTCTGAGAAAGG - Intergenic
1002594039 5:180310718-180310740 CACCCAGTTTCCCTTAAGAATGG - Intronic
1003548005 6:7077155-7077177 GACCCAGTGTCCTTGGAGAATGG + Intergenic
1003701995 6:8476792-8476814 GCCCCACTGTCCTTAGAGACTGG + Intergenic
1004396987 6:15254196-15254218 CATCCCGTGTCCCTTGGGACTGG + Intronic
1006741803 6:36314250-36314272 CAGCCACTGTGCTTTGAAACTGG + Intergenic
1007207511 6:40164550-40164572 CACCCAGAGTGCTTTGAGGCAGG - Intergenic
1007716121 6:43857293-43857315 CACCCAGAGCCCTTTGAGTCAGG - Intergenic
1013671973 6:112414039-112414061 CTCCCCTTGTCCTTTGAGCCAGG - Intergenic
1017280979 6:152625432-152625454 CACCCAGTTTCCTTTGATGCAGG + Intronic
1017962856 6:159236734-159236756 TACCCTGTGTCCTTTGAGAAAGG - Intronic
1018490878 6:164291852-164291874 CACTCAGTGAGCTTTTAGACTGG - Intergenic
1021704332 7:23351775-23351797 CACACATTTTCCTTTGAGACAGG + Intronic
1025851568 7:65248912-65248934 CACCCATTTTTTTTTGAGACAGG + Intergenic
1029745728 7:102514802-102514824 CACCAAGTGGCCTTGGGGACTGG - Intronic
1029763666 7:102613781-102613803 CACCAAGTGGCCTTGGGGACTGG - Intronic
1031196743 7:118624688-118624710 AACCCAGGGTCCTTAGAGGCTGG + Intergenic
1032112730 7:129090718-129090740 CACCCAGTGGCGTCTGAGTCAGG + Intergenic
1032305867 7:130732688-130732710 ACACCAGAGTCCTTTGAGACTGG + Exonic
1041022247 8:53649607-53649629 CACCCAATGTCCTTTTAAAGTGG + Intergenic
1042186286 8:66139411-66139433 CACTCAGTGTCCTCTGATGCTGG - Intronic
1044568933 8:93696775-93696797 CACCCTGTTTGCTTTCAGACAGG + Intergenic
1048977054 8:139678960-139678982 CAGCCAGTGTTCTTTCAGCCAGG - Intronic
1049113745 8:140667599-140667621 CCCCTAGTGTCCTTTTACACAGG + Intronic
1050950356 9:11583805-11583827 CACCCACTCTCCACTGAGACTGG + Intergenic
1051609957 9:18951366-18951388 CAGCCAGTGTCTTTTGTAACTGG + Intronic
1053224528 9:36341695-36341717 CACCCAGTCTCGCTTGAGCCTGG + Intronic
1054798850 9:69326549-69326571 CACCCGGTGTCCATAGATACTGG - Intronic
1055298557 9:74859389-74859411 CATCCAGTGTCCTCTGCCACTGG - Intronic
1056105657 9:83343879-83343901 CACACAGTGGCCTGTGACACGGG + Intronic
1056385925 9:86097550-86097572 CACCCCAGGTCCTTTGAGAAAGG + Intronic
1056840532 9:89995203-89995225 TACGCAGTGTTCTTTGAGCCTGG - Intergenic
1058336574 9:103836696-103836718 GACCCAGTGGCCTCTGAGAAAGG + Intergenic
1059520264 9:114934215-114934237 CACCCAGCCTCCTTTCAGCCTGG + Intergenic
1059644551 9:116251649-116251671 CTCCCAGAGTCCTTGGTGACTGG + Intronic
1060511949 9:124240774-124240796 CAGCCAGTGTCCTTTCTGATTGG - Intergenic
1187801089 X:23063811-23063833 CACCCTGTGCCCTTGGATACAGG + Intergenic
1189497723 X:41524597-41524619 CACACAGTGTCTTTAGCGACAGG - Intronic
1191048633 X:56167022-56167044 CACTCATTGTCCTTTTAGAGTGG - Intergenic
1192331619 X:70179955-70179977 GACACAGTGTCCTTTGAGAGGGG - Intronic
1194961998 X:100246756-100246778 CTTCCAGTGTCATTTGTGACTGG - Intergenic
1196286096 X:113882148-113882170 CACCCCATGACCTTTGAGAAGGG - Intergenic
1198176522 X:134161223-134161245 CACCAAGTGACCTTAGGGACTGG - Intergenic
1198765457 X:140075329-140075351 CCACCAGTGTCCTTTGAAATTGG + Intergenic
1199602578 X:149551083-149551105 GACCCAGGGTCCTTTCAGTCTGG - Intergenic
1199647810 X:149928392-149928414 GACCCAGGGTCCTTTCAGTCTGG + Intergenic