ID: 973170278

View in Genome Browser
Species Human (GRCh38)
Location 4:47134048-47134070
Sequence CAAAATGATTAGAGGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973170278 Original CRISPR CAAAATGATTAGAGGGAGAC TGG Intronic
905778233 1:40684792-40684814 CAAACTGATCAATGGGAGACAGG - Intergenic
906066987 1:42988040-42988062 CAAAATGAATACAGTGAAACGGG - Intergenic
908991224 1:70092624-70092646 CAAAACGATTACAGCCAGACAGG + Intronic
910621088 1:89255548-89255570 CATAATGATCAGATGGAGAAGGG - Intergenic
911339508 1:96619570-96619592 GAAAATGATTAGAAGAAGATAGG - Intergenic
911559973 1:99393201-99393223 AAAAATGTGTAAAGGGAGACTGG + Intergenic
912588233 1:110786910-110786932 CAAACTGATTAGAGAGGGAGTGG + Intergenic
912763626 1:112389689-112389711 CAGAATTACTGGAGGGAGACAGG + Intergenic
913347776 1:117825483-117825505 CAAAATGATGAGAGATAGAATGG + Intergenic
914903602 1:151726436-151726458 CAAAATGAATTGAAGGAGAAGGG + Intronic
916063149 1:161115925-161115947 AAAAATTATTAGGGGGAGCCAGG + Intronic
917194528 1:172451260-172451282 CAAAGTGAGTAGAGAGAGAGTGG - Intronic
918132499 1:181642033-181642055 CAAAATAATAAGAGGGAGCAGGG + Intronic
918685387 1:187408551-187408573 CAAGATGGTTAGGGTGAGACAGG - Intergenic
923583570 1:235242905-235242927 CAAAATGAAAAGAGGTAGATGGG - Intronic
1063933093 10:11049411-11049433 TAAAATGATTAGACGCAAACAGG - Intronic
1066545889 10:36499859-36499881 CAAAAAGATTAGTGAGTGACTGG + Intergenic
1067826756 10:49579745-49579767 CAAAATAATCAGACTGAGACTGG + Intergenic
1070947003 10:80400669-80400691 CAAGATGCTTAGAGGGAGACTGG + Intergenic
1071200235 10:83213742-83213764 CAAAATTATTAGAGGTATATAGG + Intergenic
1073369666 10:102976201-102976223 CAAAATCTTTGGAGGGAGAGTGG + Intronic
1073404637 10:103286527-103286549 CAAAATGAATGGAGGCAGAGAGG + Intronic
1074335110 10:112565531-112565553 AAAAATGATCAGAGGTATACAGG - Intronic
1074425362 10:113346523-113346545 AAAACAGATTAGAGGGAGAAAGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079094131 11:17500184-17500206 CAAAATGAGAAGAGAGACACAGG + Intronic
1080394281 11:31875589-31875611 CTACATAATTAGAGGGAGAGTGG - Intronic
1080459524 11:32440972-32440994 AAAGATGACTAGAGGGAGAAAGG + Intergenic
1082098801 11:48154297-48154319 GAAAGTGAGCAGAGGGAGACGGG + Intronic
1084721902 11:70911760-70911782 CAAAATGACAAGAGTGAGAATGG + Intronic
1085711102 11:78829902-78829924 CAACAGGATAAGAGGGAGCCTGG + Intronic
1086566159 11:88229804-88229826 CAAAATCAATGGAGGGACACAGG - Intergenic
1088880811 11:113971987-113972009 TAACAGGATTAGAGGGAGCCGGG - Intergenic
1090146263 11:124326227-124326249 CCACATGATTAAAGGGAGAAGGG + Intergenic
1092702991 12:11253868-11253890 CAAAATATTTTGAGGGAGAGAGG - Intergenic
1093205567 12:16244610-16244632 AAAAATGAAGAGAGGGAGAAGGG + Exonic
1096347056 12:50858311-50858333 CAAAATAATTGGAGGGAGAATGG - Intronic
1097382713 12:58914513-58914535 CAAAATTAGTTTAGGGAGACTGG + Intronic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1103191223 12:119003657-119003679 CAGAAAGATCAGAGGGACACTGG + Intronic
1103386447 12:120536123-120536145 AAAACTGTTTAGAGTGAGACCGG + Intronic
1104040924 12:125130033-125130055 AAATAAGATTAGAGGGAGGCAGG - Intronic
1106064833 13:26336054-26336076 AAAAAGCATTTGAGGGAGACTGG - Intronic
1106621252 13:31373153-31373175 CAAAATGACTAGAGGTGGTCAGG + Intergenic
1107645564 13:42491279-42491301 CAAAAGCACTAGAGGGTGACTGG + Intergenic
1108692542 13:52872173-52872195 CAAAATGGTTAAAGGAAGAGAGG - Intergenic
1111092755 13:83468336-83468358 CAAAATAAATATATGGAGACAGG + Intergenic
1112782503 13:102916518-102916540 AAAAAAGATTAGAGGAAGAGTGG - Intergenic
1113789393 13:113019540-113019562 CAAAGTCATGAGACGGAGACAGG + Intronic
1114859610 14:26498828-26498850 TAAAATGTTTATAAGGAGACTGG - Intronic
1115269621 14:31537403-31537425 CAAAATTAGTAGAGGGAGATGGG + Intronic
1115433469 14:33347562-33347584 TAAAATGAGTTGAGGGTGACAGG + Intronic
1117896589 14:60493998-60494020 CACAATGAAAAGAGGGACACTGG + Intronic
1118860194 14:69656991-69657013 CACAATTATTAGAGGGAAATGGG + Intronic
1119772236 14:77227435-77227457 CAAAATGATGAGATGTAGTCAGG + Intronic
1119847500 14:77841271-77841293 CAAAATGAGACGAGAGAGACTGG + Intronic
1120375179 14:83695668-83695690 TTAAATGATTAGAGAGAGCCTGG - Intergenic
1120746362 14:88155881-88155903 CAAATTGCTTAGAAGGAGAAAGG - Intergenic
1121522543 14:94596151-94596173 CACAATGATAAGAGTGAGCCTGG + Intronic
1121987842 14:98525720-98525742 GAAAATGTTTATAGGGAGATTGG - Intergenic
1124550742 15:30679045-30679067 CAAAATGATTTGTTGAAGACAGG + Intronic
1125056538 15:35364864-35364886 CAGAAAGACTAGAGGGAGAATGG - Intronic
1125662795 15:41407480-41407502 CAGACAGATGAGAGGGAGACGGG + Intergenic
1125850796 15:42901062-42901084 TAAAATTATTAGAGGAAGGCCGG + Intronic
1127308546 15:57730950-57730972 CAAAATGAATACAGGAAGCCAGG + Intronic
1129908388 15:79206100-79206122 CAAAAGGAGGAGAGGGACACTGG + Intergenic
1132524996 16:410073-410095 CAAAATGACCAGAGCAAGACGGG - Intronic
1134802815 16:17101088-17101110 CAAAATCCTTAAAGGAAGACAGG - Intergenic
1134821801 16:17252985-17253007 CTAAATGAGGAGATGGAGACAGG - Intronic
1135083435 16:19455593-19455615 CAAAATGTCTGGAGGAAGACTGG + Intronic
1135427124 16:22347867-22347889 GAAAATGACGAGAGGAAGACTGG + Intronic
1138224205 16:55278652-55278674 CAGAATGGTTAGAGGAAGTCTGG + Intergenic
1138310159 16:56016736-56016758 GTAGGTGATTAGAGGGAGACAGG - Intergenic
1138385696 16:56634524-56634546 CAAAGTGATTAGAAAGGGACAGG + Intergenic
1138389013 16:56657000-56657022 GAAAATGATTAAAAGGAGACTGG + Intronic
1138904253 16:61311108-61311130 AAAAAGAATTAGAGGGAGATGGG + Intergenic
1143807457 17:9441163-9441185 CAAAAAGATTAAAATGAGACAGG + Intronic
1144440952 17:15281104-15281126 CAACATGATCAGAGAGACACTGG - Intergenic
1146234957 17:31150620-31150642 CAAAATGAGGAGAGGGAGGGTGG - Intronic
1146516260 17:33492005-33492027 GGAGAAGATTAGAGGGAGACAGG - Intronic
1148955115 17:51347308-51347330 AAAAATGATGAGAAGGAGAGAGG - Intergenic
1149183566 17:53970483-53970505 AAAAATGTGTAGATGGAGACTGG + Intergenic
1150465803 17:65391725-65391747 CAAGATGATGTGAGGCAGACAGG + Intergenic
1154473407 18:14726261-14726283 CAAAAGGATTGGTGGGGGACAGG + Intergenic
1155293935 18:24368590-24368612 CTAAAGGGATAGAGGGAGACAGG + Intronic
1156228333 18:35130557-35130579 CAGAATTATTAGAAGGAGAGAGG + Intronic
1157983373 18:52408875-52408897 CAAAATGATTTGTGGGAGTTTGG + Intronic
1158739192 18:60120328-60120350 CAATAGCATTAGAGGGAGATGGG - Intergenic
1160116813 18:76086138-76086160 AGAATGGATTAGAGGGAGACAGG - Intergenic
1162688956 19:12413078-12413100 CAATATGATTTGAGGGACTCAGG - Intronic
1166591982 19:44007731-44007753 CAGAATGATAAGCGGGACACAGG - Intronic
1167056263 19:47112996-47113018 AAAAAGGATTTGAGGGAGAGAGG + Intronic
1167399039 19:49252665-49252687 CAAAAGGATAAAAGGGAGGCTGG + Intergenic
1168724708 19:58574731-58574753 CAAGATGATTCTAGGAAGACAGG - Intergenic
927909402 2:26885842-26885864 CAAAATGTTTTGAGGGATTCTGG - Intronic
929697223 2:44128407-44128429 CAAGATGTCTAGAGGCAGACAGG + Intergenic
933787984 2:85859017-85859039 CAAAATGATCACAGGCAGCCGGG + Intronic
934163874 2:89276518-89276540 CAAAATTATTAAAGTGAGAAAGG - Intergenic
934203398 2:89906006-89906028 CAAAATTATTAAAGTGAGAAAGG + Intergenic
935416053 2:102820621-102820643 CAAAAGGATTTCAGGGAGAAGGG + Intronic
938417485 2:131115993-131116015 CAGAATGAGGAGAGGTAGACAGG + Intronic
940354144 2:152719573-152719595 CAAAATTATTAGAGGACGAGTGG - Intronic
940543543 2:155053501-155053523 CAAGATGTATAAAGGGAGACTGG - Intergenic
940848483 2:158665983-158666005 AAAAATGACTTGATGGAGACAGG + Intronic
942994615 2:182246151-182246173 CAAAATGAATAAAGGGGAACTGG - Intronic
944406925 2:199395182-199395204 AAAAATGAGTAGAGGTAAACTGG - Intronic
944629719 2:201612277-201612299 CAAAAGGATTAAAGGGGGCCGGG + Intronic
944986001 2:205177905-205177927 CAAACTGAGGACAGGGAGACAGG - Intronic
945341078 2:208655436-208655458 CAAAATGATAAGAAAAAGACAGG + Intronic
945806005 2:214490577-214490599 CAAAGTGATTAGAGTGAGTATGG + Intronic
945809289 2:214528821-214528843 AGAAATGATTAGAGAGAGAATGG - Intronic
946358602 2:219205466-219205488 CCAAATGATTATAATGAGACTGG + Intronic
947083517 2:226425200-226425222 TTAAAAGATTAGAGGGTGACTGG - Intergenic
947104173 2:226650819-226650841 AAAATTGATTAGAATGAGACAGG + Intergenic
947697853 2:232207596-232207618 CGAAATATTTAGAGGGAGAGTGG + Intronic
1168782149 20:501863-501885 CAAAATCTTGAGAGGGAAACGGG + Intronic
1170051301 20:12148568-12148590 CAATATGGTCTGAGGGAGACAGG + Intergenic
1170737599 20:19025189-19025211 CCAGATGATTAGAGGGGGAGAGG + Intergenic
1176801078 21:13431605-13431627 CAAAAGGATTGGTGGGGGACAGG - Intergenic
1180991069 22:19936572-19936594 CAAAATGATAGGAGGGTGAGGGG - Intronic
1181406574 22:22689212-22689234 AAAAATAAGTAGAGGGAGGCTGG + Intergenic
1181882218 22:25990072-25990094 CAAGCTGATGAGAGGGAGAAGGG - Intronic
1184057970 22:42065358-42065380 CAAAAGGATCAGAGGCACACGGG + Intronic
949725643 3:7041268-7041290 CAGGAGAATTAGAGGGAGACAGG - Intronic
950211921 3:11129962-11129984 AAAAATGATTAGGGGAAAACAGG + Intergenic
950339866 3:12233734-12233756 CAAAATGATGAGAGGAAAAAAGG + Intergenic
950874965 3:16263537-16263559 CAAAATGAATATAGGGAAAGTGG - Intronic
951404018 3:22271695-22271717 TTAAATGATGAGAAGGAGACAGG - Intronic
952667830 3:35928687-35928709 TTCAATGAATAGAGGGAGACTGG + Intergenic
953118718 3:40018380-40018402 GAACATGTTTAGCGGGAGACAGG - Intronic
955153816 3:56395798-56395820 CAAAATGTTAAAAGGGAAACTGG + Intronic
955559848 3:60177026-60177048 AAAAATGCTCATAGGGAGACTGG + Intronic
955889533 3:63635213-63635235 AAAACTTATTAGAGGGAGAGAGG + Intergenic
955955248 3:64282147-64282169 CAAAATGCTCCCAGGGAGACCGG + Intronic
960287167 3:115842658-115842680 CAATCTGATTAGAGAGAGGCAGG + Intronic
962485806 3:135841090-135841112 CAAAAGGAACAGAGGTAGACTGG + Intergenic
964621399 3:158723198-158723220 CAAGATGCGTGGAGGGAGACTGG - Intronic
965182503 3:165422484-165422506 CAGAAAGATTAGAGGGACAGGGG + Intergenic
966093445 3:176168897-176168919 AAAAATCATGAGAGGTAGACCGG + Intergenic
967130831 3:186469320-186469342 CAAAAAGGTCAGAGTGAGACCGG - Intergenic
967724076 3:192845169-192845191 CAGAAGGATTATAGGGTGACTGG + Intronic
967837692 3:193978412-193978434 TGAAATGCTTAGAGGGAAACAGG - Intergenic
968120001 3:196119528-196119550 AAGAATGATTAGAAGGAGGCTGG + Intergenic
969829667 4:9784643-9784665 CAAAATGATTGGAGTCAGCCGGG - Intronic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
971816515 4:31497305-31497327 CAAAATGATTAAAGCCACACTGG - Intergenic
973170278 4:47134048-47134070 CAAAATGATTAGAGGGAGACTGG + Intronic
974670284 4:65021574-65021596 CAAAAGGAAGAGAGAGAGACGGG + Intergenic
974891562 4:67890350-67890372 GAAAAGGATTAGAGGCAGAAGGG - Intergenic
977378840 4:96243669-96243691 CAACATGAGTAGAGAGAAACTGG + Intergenic
977540416 4:98312224-98312246 CAGAATTATTAGCTGGAGACTGG - Intronic
978381641 4:108135102-108135124 CAAACTTGTTAGAGGAAGACAGG + Intronic
979051679 4:115942995-115943017 CATAATTATTATAGGGAGATAGG + Intergenic
980064252 4:128166403-128166425 CAGAATGAAAGGAGGGAGACAGG - Intronic
980964824 4:139511345-139511367 CCAAATGATTAGACTGAAACAGG - Exonic
983338902 4:166432239-166432261 CAAAATGAGTAGGGGAAAACTGG - Intergenic
986352169 5:6890741-6890763 AAAAGTGAAGAGAGGGAGACAGG - Intergenic
988479976 5:31621356-31621378 CAATATGGTTAGAAGGAGAGTGG + Intergenic
989559104 5:42830553-42830575 CGATATGATATGAGGGAGACAGG - Intronic
991571263 5:68055637-68055659 CAAAAGCATTAGAGTGACACTGG - Intergenic
991651692 5:68862216-68862238 CAGAATGAGTAGAGGCAGAGAGG + Intergenic
991989576 5:72324299-72324321 CAAAATGATGAAAGGTTGACAGG - Intronic
994472352 5:100224064-100224086 CAGAGTGATTAAAGGGAGAGAGG - Intergenic
996746694 5:126852257-126852279 CAAAATGAATAGTGGAAGGCTGG + Intergenic
1000362768 5:160463254-160463276 CAAAAAGATAAGAGGAAGATGGG - Intergenic
1002374713 5:178780471-178780493 AAATAAGATTAGAGGGAGGCAGG + Intergenic
1003380407 6:5619805-5619827 AAGAATGAAGAGAGGGAGACAGG - Intronic
1005269778 6:24151193-24151215 CAAAATGATAAAAGTCAGACTGG + Intronic
1005979711 6:30827692-30827714 GAAAGTGATTAGAGTGTGACCGG - Intergenic
1007485919 6:42180543-42180565 CAAAAAGATAAAAGGGAGCCGGG + Intergenic
1007963449 6:45982228-45982250 CAAACTGATAAGATGGAGTCAGG - Intronic
1011818388 6:91220799-91220821 CAATATGATTAAAGGGAACCTGG - Intergenic
1013554150 6:111239371-111239393 AAAAATGATTAAAGTGAGGCTGG - Intergenic
1014322050 6:119942415-119942437 CAGAATGGTTAGAGACAGACTGG + Intergenic
1015653490 6:135490933-135490955 CAAAAAGGTCAGAGGGATACAGG - Intronic
1016155502 6:140802127-140802149 CAAAATAATTTGAGGGAGTGTGG + Intergenic
1016747922 6:147600615-147600637 CTAAATGAGGAGAGGGAGAGTGG - Intronic
1017739308 6:157392799-157392821 CAAAGTCTCTAGAGGGAGACAGG - Intronic
1018734088 6:166674504-166674526 CGATATCTTTAGAGGGAGACCGG + Intronic
1020415852 7:7945015-7945037 AAAAATGGTAAGAGGGTGACAGG - Intronic
1020914477 7:14175330-14175352 GAAACTGATTAGAGGGCAACAGG - Intronic
1021130335 7:16904691-16904713 CAAAATGATAGAAGAGAGACAGG - Intergenic
1022483982 7:30763699-30763721 CAAATTGATTATAGGGATGCTGG - Intronic
1024445448 7:49473119-49473141 CAAAATGATCAGTGGGAAATAGG - Intergenic
1025966943 7:66282247-66282269 CACAGTGATTAGAGGGAAATGGG - Intronic
1026064016 7:67053345-67053367 CCAAATGAAAAGAGGGAGAGAGG - Intronic
1026714332 7:72774099-72774121 CCAAATGAAAAGAGGGAGAGAGG + Intronic
1028977463 7:96930016-96930038 TAGAATAAATAGAGGGAGACAGG - Intergenic
1030827699 7:114181033-114181055 AAAAATGATGATAGAGAGACAGG - Intronic
1035299955 7:157890757-157890779 CAAAATGATTTGTGTGAGACCGG - Intronic
1035831200 8:2696475-2696497 GAAACTGATTAGAGGAAGTCTGG + Intergenic
1037070509 8:14641099-14641121 CAAAAAGATTAGAGGGGGTAGGG + Intronic
1041214621 8:55587490-55587512 TAAAATGATCACAGGTAGACTGG - Intergenic
1042602741 8:70514010-70514032 CAAAATGATGAAAGGGAAAGAGG - Intergenic
1044213361 8:89577866-89577888 GAAAATGATTAGAGACAGAGAGG - Intergenic
1044446311 8:92280882-92280904 CAAAATAATTAGAGAAAGAAAGG + Intergenic
1044816137 8:96115314-96115336 CAAAGTGAGTAGAGAGAGAAGGG - Intergenic
1044889191 8:96814319-96814341 CAAAATAATTAGAAGAAGAAAGG - Intronic
1045567379 8:103334666-103334688 CAAAATTATTAGAGGGATTGAGG - Intergenic
1045710598 8:104978860-104978882 CAAAATGATTTGGTGGAGAAAGG - Intronic
1048235408 8:132684765-132684787 CAAAAGGATTAGAAGAATACTGG - Intergenic
1051340168 9:16103442-16103464 GAAAATGCTTTGAGGGATACTGG + Intergenic
1055160206 9:73117462-73117484 CAAAATAACTACATGGAGACTGG + Intergenic
1056256886 9:84808634-84808656 CAAAACTTTTAGAAGGAGACTGG + Intronic
1056628945 9:88276795-88276817 CAAAATGACTCGAGAGAGCCAGG - Intergenic
1058552588 9:106131043-106131065 CAAAATTATCAAAGGGACACAGG + Intergenic
1061060353 9:128247126-128247148 TAAAATGCTTAGAAGGGGACTGG - Intronic
1203654845 Un_KI270752v1:13832-13854 CAAAATGATTGTAGGGATAGGGG - Intergenic
1185775540 X:2800179-2800201 CCAGGTGATGAGAGGGAGACAGG + Intronic
1188402424 X:29762531-29762553 CAAAAGGAAGAGAGGGAGAGAGG + Intronic
1188528439 X:31111594-31111616 CTAAAGGATTAGAGGAAGGCCGG + Intronic
1189055385 X:37694243-37694265 CATAATAATTAGAGACAGACAGG - Intronic
1189110846 X:38286969-38286991 CAAGATGAGGAGAGGGAGAAGGG - Exonic
1190532909 X:51397587-51397609 AAAAATGTGTAGAGGGAGAGAGG - Intergenic
1191731846 X:64344543-64344565 CAAAATGATTAGGGTCAGAAAGG - Intronic
1193369211 X:80673310-80673332 TAAAAAGAATAGAGGGACACAGG + Exonic
1193934284 X:87596684-87596706 AAACATGATTACAGGGAGGCAGG + Intronic
1194539810 X:95156485-95156507 TAAAATGTTCAGATGGAGACAGG - Intergenic
1196047150 X:111268285-111268307 CAAAATGATAAAAGGAACACAGG + Intronic
1197069236 X:122274024-122274046 CAACATGATCAGAGAAAGACTGG + Intergenic
1197623697 X:128780369-128780391 CAAAATGGTGAAAGGGAGACAGG + Intergenic
1197770795 X:130087946-130087968 CAGTTTGATTAGAGGGAGAGAGG + Intronic
1198998973 X:142609826-142609848 CAGATTTATTAGAGTGAGACTGG + Intergenic
1201294378 Y:12451178-12451200 CCAGGTGATGAGAGGGAGACAGG - Intergenic