ID: 973174771

View in Genome Browser
Species Human (GRCh38)
Location 4:47191603-47191625
Sequence GTGAAAACACTGTTATCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 220}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973174771 Original CRISPR GTGAAAACACTGTTATCTAA GGG (reversed) Intronic
901113899 1:6824324-6824346 GTGAAATAAATGTTATATAAAGG + Intronic
902259738 1:15215513-15215535 GTGAAAAGACTGTCATCTACAGG + Intronic
906766215 1:48436828-48436850 GGGAAAATACTGATATCCAATGG - Intronic
908987333 1:70039668-70039690 TTTAAATCACTGTTATCTGATGG - Exonic
910188108 1:84567381-84567403 GTGAAAACACTCTTACAAAATGG - Intronic
910938674 1:92508631-92508653 ATCAAAACACTGTTAACAAATGG - Intergenic
913649267 1:120895227-120895249 GGGAAAACACTTTTGTGTAAAGG - Intergenic
914077428 1:144368279-144368301 GGGAAAACACTTTTGTGTAAAGG + Intergenic
914101751 1:144598226-144598248 GGGAAAACACTTTTGTGTAAAGG - Intergenic
914172334 1:145236819-145236841 GGGAAAACACTTTTGTGTAAAGG + Intergenic
914297210 1:146339285-146339307 GGGAAAACACTTTTGTGTAAAGG + Intergenic
914639419 1:149589312-149589334 GGGAAAACACTTTTGTGTAAAGG - Intergenic
915688613 1:157663196-157663218 TTGAAAACACTCTTATCCAGGGG + Intergenic
917433658 1:174997899-174997921 GCTAAAAGACTGTGATCTAAGGG + Intergenic
918531987 1:185533182-185533204 GAGAAAATACTGTTCTCTAGAGG + Intergenic
918773559 1:188597534-188597556 GTGAAACCACTGGTTTCTTATGG + Intergenic
919090039 1:192967401-192967423 CTGACAACACTGTTATCTTTCGG + Intergenic
922457090 1:225783655-225783677 GTTCAAACACTGTCATTTAAAGG - Intronic
923838038 1:237636303-237636325 GTGCTGACACTGTTCTCTAAAGG - Intronic
1063070374 10:2656941-2656963 GTCAAAACACTTGTATGTAACGG + Intergenic
1063941543 10:11134996-11135018 GTGCAAACACTGGTATTTGAGGG - Intronic
1064726629 10:18286726-18286748 GTGAAAATATTGTAATCTGATGG + Intronic
1064950825 10:20848254-20848276 GTTTACAAACTGTTATCTAAAGG + Intronic
1067665213 10:48271742-48271764 CTAAAAACACTGATATCTCAGGG + Intronic
1067692178 10:48508961-48508983 AGGATACCACTGTTATCTAATGG + Intronic
1068341274 10:55706681-55706703 GTCAAACCACTGTTATCTCAAGG + Intergenic
1068529975 10:58174746-58174768 GTTAAAACACTGGAATCCAATGG + Intergenic
1072431227 10:95372674-95372696 GTTTAAACTCTGTTCTCTAAGGG - Intronic
1074946958 10:118289385-118289407 GTAAAAACATTGTTTTTTAAAGG + Intergenic
1075311583 10:121418785-121418807 GGAAAAACACTGTCATCCAAGGG + Intergenic
1076098724 10:127756420-127756442 GTGAAAACACATATATCTATTGG + Intergenic
1078996583 11:16706993-16707015 GTGATAACACTATTATGGAAAGG - Intronic
1080191791 11:29559325-29559347 GTGAAGACACTTTTCTCAAAGGG - Intergenic
1082693855 11:56336068-56336090 GTGAAAACTTTGTAATTTAATGG + Intergenic
1086006219 11:82040667-82040689 CTGAAACCAGTTTTATCTAATGG - Intergenic
1087288599 11:96295219-96295241 CTGGAAACACTGGTATCTTAAGG + Intronic
1087600747 11:100311869-100311891 GTGAAAACATTGTGCTCTGATGG - Intronic
1088073247 11:105815401-105815423 GTTAAGACTCTATTATCTAATGG + Intronic
1088212143 11:107468619-107468641 GTGTGAACACTGTTGGCTAATGG + Intergenic
1088956136 11:114616319-114616341 GTGTAACCACTGTTACCTGATGG + Intergenic
1088956152 11:114616442-114616464 GTGTAACCACTGTTACCCAATGG + Intergenic
1088956531 11:114618960-114618982 GGGTAAACACTGTTATCTGGTGG + Intergenic
1090198127 11:124834611-124834633 GTGAAAACAGTTTTATTTATTGG + Intergenic
1090674439 11:128976858-128976880 GTGAAAAATCTCTTTTCTAAAGG + Intronic
1091118871 11:133040204-133040226 GTGAAAATATTTTTATTTAAGGG - Intronic
1091529937 12:1344496-1344518 GTTAAAACACAGTGATCAAAAGG - Intronic
1093035496 12:14328667-14328689 GTGAGACCCCTGTTCTCTAATGG + Intergenic
1094429913 12:30356916-30356938 GACAAAACCCTGTTCTCTAAAGG + Intergenic
1096919603 12:55069631-55069653 TTGAAGACAGTGTAATCTAATGG - Intergenic
1098119377 12:67220000-67220022 GTAGAAACACTATGATCTAATGG + Intergenic
1098849921 12:75583818-75583840 GTGAAAACTCTGTTATTCAAAGG + Intergenic
1100550348 12:95641219-95641241 GAGAAAACACTCTTATTAAAGGG - Intergenic
1104411939 12:128565656-128565678 GTGAAGAAACTGATATTTAAGGG + Intronic
1106055311 13:26231542-26231564 GGGAAAACATTGTCATATAAGGG + Intergenic
1106601776 13:31194446-31194468 ATGGAAACCCTGTTATTTAACGG - Intergenic
1107998131 13:45881521-45881543 GGCAAAACACAGTTGTCTAATGG + Intergenic
1108539585 13:51427317-51427339 GTGAAAAGACAGTGATATAAAGG + Intronic
1110030424 13:70604594-70604616 CTGAAACCAGTTTTATCTAATGG + Intergenic
1110095694 13:71517220-71517242 ATCAAAACACTGTTATCAAATGG + Intronic
1111298741 13:86318469-86318491 GGGAAAACATTGTAGTCTAAAGG + Intergenic
1112459321 13:99589395-99589417 GTGACAACAATTTAATCTAATGG - Intergenic
1113553270 13:111209938-111209960 GTGCAAAGACTGTGATCCAAGGG - Exonic
1116133190 14:40886927-40886949 GTGAATACAATGAAATCTAATGG + Intergenic
1119915776 14:78400344-78400366 GTAAAAACACTGTCAGATAAAGG - Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1125104343 15:35953290-35953312 AAGAAAACAGTGTAATCTAATGG - Intergenic
1125476312 15:40050311-40050333 GGGAACACACTGTTCTCTACTGG + Intergenic
1125813331 15:42561773-42561795 ATGAAAACACTATCAACTAAGGG + Intronic
1126280184 15:46938391-46938413 GTGAAAGGAGTGTTTTCTAAGGG - Intergenic
1126409568 15:48358271-48358293 TTGAAAATACTGCTATCTAGAGG + Intergenic
1127736784 15:61848248-61848270 TTGAAAACACTGTTTAGTAAAGG - Intergenic
1128527137 15:68420267-68420289 GTGAAAACCTAGTTATATAATGG - Intronic
1130153249 15:81327694-81327716 GTGAAACCACAGTTATGCAAAGG + Intergenic
1131330432 15:91493860-91493882 GTGGCAACACTGTTATTTGAAGG + Intergenic
1134296436 16:12950443-12950465 GTTAAAAGGCTGTTATCAAAAGG + Intronic
1134677193 16:16098990-16099012 GTGAAAACACAGACATCTGACGG - Intronic
1139137343 16:64220824-64220846 GTGATATTACTGTTATCTAGTGG - Intergenic
1139958469 16:70704532-70704554 GTGCAAACACTGCTGTCTGAGGG + Intronic
1140801481 16:78492180-78492202 GTGCACACACTGTCACCTAATGG - Intronic
1144237235 17:13273431-13273453 GTGTAAATAATGTTATTTAATGG + Intergenic
1144307496 17:13982618-13982640 TTGAAAACAGTGTTATCTCAGGG - Intergenic
1147501563 17:40969240-40969262 GTTCAAACACTGTTATTTTATGG - Intergenic
1150115707 17:62547524-62547546 ATGAAAACAATGTTTTCAAAAGG - Intronic
1150868760 17:68881084-68881106 GTGGAAAATATGTTATCTAATGG - Intronic
1154507723 18:15059307-15059329 GTTAACACACTGTTTTCTCATGG - Intergenic
1156802252 18:41130466-41130488 GTGAGAATAATTTTATCTAAGGG + Intergenic
1156809370 18:41227948-41227970 GTGAAAAAGATGTTAGCTAAGGG + Intergenic
1156897033 18:42257487-42257509 GTGAAAACACTTTTATGACAGGG - Intergenic
1158288090 18:55907196-55907218 CAGAAAGAACTGTTATCTAATGG + Intergenic
1159257657 18:65968438-65968460 GTGAAACCTCTGTCAGCTAAAGG - Intergenic
1159443244 18:68508486-68508508 GTGAGCACCCTGTTATCTAAAGG + Intergenic
1159486922 18:69073312-69073334 GTGGAGACAATGTTATCCAAAGG - Intergenic
1163740374 19:19008127-19008149 GTGAACACACTCAAATCTAAAGG + Intronic
1165208140 19:34209030-34209052 CTAAAAACACAGTTATCTCAAGG + Exonic
1166942095 19:46373387-46373409 GTGAAAACACTGCCATGTAGAGG + Intronic
925838892 2:7972314-7972336 GAGAAAACACTCTCATCTGAAGG - Intergenic
927655700 2:24943593-24943615 GTGGAAACACTGGTCTTTAATGG - Intergenic
928888096 2:36173113-36173135 TTGAAATCACTGTTATTTATTGG + Intergenic
929000352 2:37342280-37342302 GTGATAACACTGTTCTCAAGTGG - Intergenic
930005033 2:46889995-46890017 TTGAAAACATTGTTCTGTAAGGG + Intergenic
930884190 2:56305566-56305588 TTGAAAACATTATTATCTATGGG - Intronic
933315109 2:80706036-80706058 GTTAAAACATTGTTCTCCAAAGG + Intergenic
934954293 2:98604410-98604432 TTGAAAACACTGGTTTCTATTGG + Intronic
935507712 2:103927087-103927109 CTGAAAACAATGTTGTCTTATGG - Intergenic
936842267 2:116785477-116785499 CTGAAACCAGTTTTATCTAATGG + Intergenic
938392144 2:130914957-130914979 GTGAAAACCCTGCTATGGAATGG - Intronic
939441160 2:142251672-142251694 TTGACTACACTGTTATCTACTGG - Intergenic
940797502 2:158096145-158096167 GTAAATTCACTGTTTTCTAATGG - Intronic
941294581 2:163720444-163720466 ATGAAAAGAATGTTTTCTAATGG - Intronic
941572051 2:167182697-167182719 GTGAAAACACTAATATCTTGGGG + Intronic
942471260 2:176262972-176262994 GTGATAACACTGTTATATCAAGG - Intergenic
943194295 2:184723573-184723595 ATGAAAACACTAATATGTAATGG - Intronic
943366049 2:186968465-186968487 CTGAAACCAGTTTTATCTAATGG + Intergenic
943741754 2:191417720-191417742 GTGAAAAAATTGTTCTCTGATGG + Intronic
944404778 2:199371413-199371435 CAGAAAACAATGTTCTCTAAAGG + Intronic
944617628 2:201478393-201478415 GGGAAAATACTGATATCCAATGG - Exonic
945220444 2:207478172-207478194 GTGAAAAGGGTGTGATCTAATGG - Intergenic
945252226 2:207773243-207773265 AAGAAAACAATGTTATCTACTGG + Intergenic
945586403 2:211669360-211669382 GTGAAAACACTGTTAAATTTAGG - Intronic
948084183 2:235232682-235232704 GTGACAACATTGTCATCTCATGG - Intergenic
948349326 2:237325182-237325204 GTGACAACATTGTTATTTATAGG + Intronic
1170022276 20:11849766-11849788 CTGAAACCAGTTTTATCTAATGG + Intergenic
1170275081 20:14576675-14576697 TTGCAAACACTGTTATATAAGGG + Intronic
1170309482 20:14976497-14976519 GTGTAATCACTGTCATCTCAGGG + Intronic
1170722593 20:18897109-18897131 CTGAAACCAATTTTATCTAATGG - Intergenic
1171390274 20:24797136-24797158 CTGAAATCAGTTTTATCTAATGG - Intergenic
1176790359 21:13312472-13312494 GTTAACACACTGTTTTCTCATGG + Intergenic
1177989531 21:28020711-28020733 GTTAACACACTGTTTTCTCATGG + Intergenic
1179244224 21:39616619-39616641 TTCAAAAAATTGTTATCTAAAGG - Intronic
1179991733 21:44951810-44951832 CTGAAGACACTGCTAGCTAAGGG - Intronic
1180647658 22:17352832-17352854 ATAAAAACACTCTGATCTAATGG - Intergenic
1182672694 22:32010515-32010537 ATGAAAGCAATGTCATCTAAGGG + Intergenic
949750997 3:7352774-7352796 GTGAAAAGACTGATATCATATGG - Intronic
949787107 3:7753840-7753862 TTGAAAACAGTGTTCTCAAAGGG + Intergenic
950281793 3:11714298-11714320 CTGAAACTACTGTTATCTAAGGG + Intronic
952974809 3:38684718-38684740 GTGAAAGCACTGTTACCAAAAGG - Intergenic
954564432 3:51586866-51586888 GCCAAAACACTCTTATCTCAAGG + Intronic
955941975 3:64154754-64154776 GTGAAAACACAGCTATAGAATGG + Intronic
958474032 3:94557983-94558005 GTGAAACTTCTATTATCTAAAGG - Intergenic
959223757 3:103555214-103555236 GTAAAAACACTTTTGTATAATGG - Intergenic
959721281 3:109492262-109492284 ATGAAAATAGTATTATCTAAAGG - Intergenic
959832240 3:110877733-110877755 GAGAAAACACTTTTATTTTAGGG - Intergenic
961434471 3:126907057-126907079 GTGGAAACACGGTCATCTGATGG + Intronic
961490088 3:127250092-127250114 GTTAAAACAAAGTTTTCTAAAGG - Intergenic
964020882 3:152008994-152009016 GAGAAAACAGTGTTAACTATGGG + Intergenic
964359988 3:155885546-155885568 GTATAAACACAGTTTTCTAAAGG + Intronic
964450957 3:156812757-156812779 GGGAAAACACTTTAATCTCAAGG + Intergenic
965427342 3:168543458-168543480 GTTAAAATACTGTTAACCAAAGG - Intergenic
965813721 3:172615808-172615830 GTGAAATCACTGATATTTCATGG - Intergenic
965949390 3:174287597-174287619 GTGAAAGCAGTATTTTCTAATGG + Intergenic
966041897 3:175501378-175501400 GTTAAAAGATTGTTATCAAAAGG + Intronic
967109051 3:186277067-186277089 ATTAAAACCCTCTTATCTAACGG + Intronic
967267475 3:187703129-187703151 GTGAAGACACGGTTACCTGAAGG + Intronic
967557982 3:190881501-190881523 GTGAAAAAAGTGATAGCTAATGG + Intronic
967746017 3:193056176-193056198 TTGAAAATATTGTTATATAATGG - Intergenic
968067778 3:195768219-195768241 GTGAAAGCAGTGTAATCAAAGGG + Intronic
973174771 4:47191603-47191625 GTGAAAACACTGTTATCTAAGGG - Intronic
975049877 4:69849304-69849326 GTTAAAACACAGAAATCTAAAGG - Intronic
975884874 4:78953112-78953134 CTGAAAGCACTGTTTTCTCATGG - Intergenic
976496687 4:85738317-85738339 TTGAAAACACATTTATCCAAAGG - Intronic
978457524 4:108910411-108910433 GTTAAAAGACTGTTAAATAAGGG - Intronic
979527505 4:121732838-121732860 GTGAAAAAACTGTTTTCACAAGG + Intergenic
980272815 4:130608777-130608799 GTGAAAACACTGATATTTGGGGG - Intergenic
980757110 4:137179225-137179247 CTGAAACCAGTTTTATCTAATGG + Intergenic
981201179 4:141981274-141981296 GTGAAAACATTGGTAGGTAAGGG - Intergenic
982242010 4:153309248-153309270 GGGAAAAAAGTGTTATGTAAAGG + Intronic
983520198 4:168700518-168700540 GTAAAAAGACTATTTTCTAAAGG - Intronic
983822935 4:172218608-172218630 GTGAAATCTCAGTTTTCTAATGG + Intronic
984356908 4:178672221-178672243 GTCAAAACATTGTTTTCTAAAGG + Intergenic
986279104 5:6308543-6308565 GTGAAAGCACTGTTATTCCATGG + Intergenic
987729167 5:21745606-21745628 GTGAAAACTCTGTTATACAATGG - Intergenic
988267043 5:28965585-28965607 GTCAAAATAATGTTTTCTAACGG + Intergenic
989341380 5:40379296-40379318 GGGTAAACAGTGTTAACTAAAGG - Intergenic
989736081 5:44708615-44708637 ATGAAAATAGTGTTATCTGAGGG + Intergenic
989980547 5:50638522-50638544 GGGAAAACACTTTTGTGTAAAGG - Intergenic
990193532 5:53288322-53288344 CTGAAATCACTCTTTTCTAATGG + Intergenic
992391277 5:76332987-76333009 GAGAATCCACTGTTATCTATGGG + Intronic
992964541 5:81986272-81986294 GTGAACACACAGTTAACTGATGG + Intronic
997638277 5:135431287-135431309 GGGAAAACATTATTATTTAATGG + Intergenic
997925304 5:138025258-138025280 TTGTAATCACTGTTATCTCATGG - Intronic
998208557 5:140176245-140176267 GTGACAACACTCTTCTCTGATGG + Intronic
998889686 5:146732960-146732982 TTGAAAACAATGCTATCTATTGG + Intronic
998946455 5:147344875-147344897 ATGAAAACACTGTTCTCTGAAGG - Intronic
1000456757 5:161458932-161458954 CTGAAAACACTATAATATAAAGG - Intronic
1001238319 5:170048692-170048714 GTGAAAACAGTGTGATCTTGTGG + Intronic
1004120309 6:12815177-12815199 GTGAAAAAGCAGTTATCTACAGG - Intronic
1010367674 6:75070945-75070967 GTTAAAAAACTGTTATTTTAGGG - Intergenic
1010752280 6:79629143-79629165 CTGACAATACTGTAATCTAAGGG - Intergenic
1011878280 6:91990292-91990314 GTGAACACAGTGTGATATAAGGG + Intergenic
1014459870 6:121683430-121683452 CTAAAAACACAGTTATCTCAAGG + Intergenic
1014658851 6:124141300-124141322 GTGGAAACATTTTTAGCTAACGG - Intronic
1015332084 6:131991741-131991763 GTGATAAAACTATTTTCTAAAGG - Intergenic
1015467653 6:133565403-133565425 GTTAAAACATTGTTATGTAGAGG + Intergenic
1017966896 6:159274892-159274914 GTACAAAAACTGTTTTCTAAAGG - Intergenic
1018970008 6:168521082-168521104 ATGAAAACAGTGTTTTATAATGG - Intronic
1020371152 7:7433225-7433247 TAGAAAACTCTGTTGTCTAAAGG - Intronic
1021185031 7:17554419-17554441 GTGAAAACACTGGTGTTGAAGGG - Intergenic
1021595463 7:22311889-22311911 TTGAAAGCACTTTTATCTCATGG + Intronic
1022123976 7:27338162-27338184 GAGAAATCACTGATATCAAAGGG + Intergenic
1024616627 7:51120185-51120207 GTCAAAACAGTGTTGTCAAATGG + Intronic
1024883905 7:54119871-54119893 CTGAAAATACTCTTATTTAAAGG - Intergenic
1028204674 7:88002795-88002817 GTGAAAACAGTCTTATAAAATGG - Intronic
1028533257 7:91862478-91862500 GTGAAAACATTTTTATATACTGG + Intronic
1030573561 7:111258028-111258050 GTTAAAACACCTTTCTCTAAAGG + Intronic
1031305254 7:120117807-120117829 GTGAAAACCTTGTTAAGTAAGGG - Intergenic
1032045431 7:128603232-128603254 ATGAAAACAATGTTTTCAAAAGG - Intergenic
1033209184 7:139447839-139447861 CTGAAACCAGTTTTATCTAATGG + Intergenic
1033839142 7:145352841-145352863 CTGAAACCAGTTTTATCTAATGG - Intergenic
1034362484 7:150512932-150512954 GGGAAAATACTGATATCCAATGG + Intergenic
1036295261 8:7529613-7529635 GAGAAAACAATGTTCTTTAAAGG + Intergenic
1036327309 8:7791405-7791427 GAGAAAACAATGTTCTTTAAAGG - Intergenic
1041582303 8:59475565-59475587 GGTAAAACAAAGTTATCTAAGGG + Intergenic
1044232698 8:89797719-89797741 CTGAAACCAGTTTTATCTAAAGG + Intergenic
1046286891 8:112105414-112105436 GTTAAAACACTGTTAATCAATGG - Intergenic
1046305480 8:112359434-112359456 CTCAAGACACTGTTCTCTAACGG - Intronic
1046308924 8:112408212-112408234 TTAAAAACACTTTTATCTAGAGG + Intronic
1046949268 8:120004191-120004213 GAGAAAACTCTGTCATCTAATGG + Intronic
1047257823 8:123229118-123229140 GTGACAACACTGTTCTAGAACGG + Intronic
1047852686 8:128875883-128875905 GTGAAGACCCTATAATCTAATGG - Intergenic
1048731778 8:137450006-137450028 GTGAAACCACTGTTAGAAAAAGG + Intergenic
1050829615 9:9994285-9994307 TTGAAAATACTTTTATCTTATGG + Intronic
1051652501 9:19342931-19342953 TTGAAAATATTGTTATTTAAAGG + Intronic
1052644255 9:31211883-31211905 TTGAAAACACTGTTAACTGAAGG - Intergenic
1053367624 9:37534815-37534837 GGGAAAACACTCTTATCTCTGGG + Intronic
1054599349 9:67104571-67104593 GTGCAAACACTCTTATTAAATGG - Intergenic
1056240367 9:84640156-84640178 GAAAAAACATTTTTATCTAAGGG + Intergenic
1058175155 9:101727106-101727128 GAAAAAACACTGTTACCGAAGGG - Intronic
1187483991 X:19684739-19684761 GGGAAAACACTGGTGTTTAAAGG - Intronic
1188867337 X:35329074-35329096 CTGAAATCACTGTCATCTTAGGG + Intergenic
1189819893 X:44859957-44859979 CAGAAAACACTGCTATTTAAAGG - Intergenic
1196908415 X:120461541-120461563 GTGACAGAAATGTTATCTAAAGG - Intronic
1196960861 X:120999985-121000007 TTGAAACCAGTTTTATCTAATGG - Intergenic
1197144981 X:123161693-123161715 TTGAATAAACTGTTATCTACTGG + Intergenic
1198654152 X:138895303-138895325 GTGAGGACACTTTTATCTGATGG + Intronic
1199607968 X:149591894-149591916 GTGAAGATCCTGTTATATAAAGG + Intergenic
1199631152 X:149777462-149777484 GTGAAGATCCTGTTATATAAAGG - Intergenic