ID: 973183323

View in Genome Browser
Species Human (GRCh38)
Location 4:47294478-47294500
Sequence ATGAGCGAGACTGTGGGCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 4, 2: 5, 3: 24, 4: 77}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973183323_973183327 14 Left 973183323 4:47294478-47294500 CCTACGCCCACAGTCTCGCTCAT 0: 1
1: 4
2: 5
3: 24
4: 77
Right 973183327 4:47294515-47294537 TCTGAGATCAAACTGCAAGGTGG 0: 2869
1: 1007
2: 456
3: 293
4: 360
973183323_973183328 22 Left 973183323 4:47294478-47294500 CCTACGCCCACAGTCTCGCTCAT 0: 1
1: 4
2: 5
3: 24
4: 77
Right 973183328 4:47294523-47294545 CAAACTGCAAGGTGGCAGCGAGG 0: 529
1: 1799
2: 1886
3: 1137
4: 705
973183323_973183332 29 Left 973183323 4:47294478-47294500 CCTACGCCCACAGTCTCGCTCAT 0: 1
1: 4
2: 5
3: 24
4: 77
Right 973183332 4:47294530-47294552 CAAGGTGGCAGCGAGGCTGGGGG 0: 551
1: 1826
2: 1919
3: 1085
4: 869
973183323_973183329 26 Left 973183323 4:47294478-47294500 CCTACGCCCACAGTCTCGCTCAT 0: 1
1: 4
2: 5
3: 24
4: 77
Right 973183329 4:47294527-47294549 CTGCAAGGTGGCAGCGAGGCTGG 0: 557
1: 1835
2: 1877
3: 1050
4: 738
973183323_973183330 27 Left 973183323 4:47294478-47294500 CCTACGCCCACAGTCTCGCTCAT 0: 1
1: 4
2: 5
3: 24
4: 77
Right 973183330 4:47294528-47294550 TGCAAGGTGGCAGCGAGGCTGGG 0: 578
1: 1878
2: 1931
3: 1093
4: 654
973183323_973183331 28 Left 973183323 4:47294478-47294500 CCTACGCCCACAGTCTCGCTCAT 0: 1
1: 4
2: 5
3: 24
4: 77
Right 973183331 4:47294529-47294551 GCAAGGTGGCAGCGAGGCTGGGG 0: 559
1: 1857
2: 1941
3: 1128
4: 834
973183323_973183326 11 Left 973183323 4:47294478-47294500 CCTACGCCCACAGTCTCGCTCAT 0: 1
1: 4
2: 5
3: 24
4: 77
Right 973183326 4:47294512-47294534 CAGTCTGAGATCAAACTGCAAGG 0: 3663
1: 1439
2: 732
3: 491
4: 588

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973183323 Original CRISPR ATGAGCGAGACTGTGGGCGT AGG (reversed) Intronic
901206375 1:7498487-7498509 ATGAGAGTGAGTGTGGGTGTGGG + Intronic
907238375 1:53066955-53066977 AAGAGCGAGAGTGTGGGCACAGG - Intronic
907316303 1:53574871-53574893 AGGAGCCTGACTGTGGGCGAGGG - Intronic
907456129 1:54576759-54576781 GTGAGCGAGACTGGAGGTGTGGG + Intronic
917002592 1:170375932-170375954 ATGAGAGAGAATGTGTGTGTGGG + Intergenic
918449465 1:184644837-184644859 GTGAGTGGGGCTGTGGGCGTGGG - Intergenic
924491099 1:244538689-244538711 ATGGGGGAAACTGTGGGCCTAGG - Intronic
1066317803 10:34265917-34265939 ATGGGCAAGACTGTGGGGGTCGG + Intronic
1069753205 10:70758014-70758036 ATGCCCGAGGCTGTTGGCGTTGG - Exonic
1070152100 10:73811429-73811451 CTGAGCGCGACCGTGGGCGGGGG + Intronic
1073661471 10:105480794-105480816 ATGAGCAAGACTCTGTGGGTAGG + Intergenic
1075743280 10:124709029-124709051 ATGAGCGAGACACTGGGCAAAGG - Intronic
1077250659 11:1559270-1559292 ATGAGGAGGAATGTGGGCGTAGG - Intronic
1077405102 11:2379232-2379254 CTGAGGGAGACTGTGGACCTGGG + Intronic
1081392791 11:42549092-42549114 ATGACCTAAACTGTGGACGTAGG + Intergenic
1081659944 11:44882005-44882027 ATGGGCCACACTGTGGGAGTTGG - Intronic
1084362303 11:68676930-68676952 ACGAGCGAGACTGTTGTCATCGG - Intergenic
1088990012 11:114945187-114945209 AAGAGAGAGACTGAGGGGGTAGG - Intergenic
1090737631 11:129624164-129624186 AGGACCGAGGCTGTGGGCATAGG - Intergenic
1095699283 12:45174733-45174755 ATGAGGGGGCCGGTGGGCGTGGG - Intergenic
1096281050 12:50254067-50254089 CTGAGAGAGACTGTGTGGGTGGG - Intronic
1096535252 12:52268035-52268057 CTTAGGGAGACTGTGGGGGTTGG + Intronic
1099976308 12:89549050-89549072 ATCAGGGAGACTGTGGGCATAGG + Intergenic
1103736564 12:123064508-123064530 AGGAGCCAGACTGTGCGCGATGG - Intronic
1105532436 13:21231671-21231693 GTGAGCAAGTCTGTGGGCCTGGG + Intergenic
1105937934 13:25119102-25119124 CTGAGCGAGCTCGTGGGCGTCGG - Intergenic
1108059223 13:46515842-46515864 ATGAGCAGGACTGTGGGAGTTGG - Intergenic
1108565810 13:51695946-51695968 ATCAGCAAGACTGTGGGCGTAGG + Intronic
1110001495 13:70209077-70209099 ATGAGCGAGACTCTGGGCATAGG - Intergenic
1114801150 14:25777090-25777112 ATCAGCGAGACTGTGGGCATAGG + Intergenic
1119358359 14:74026153-74026175 AAGAGAGAGACTGGGGGCGGTGG + Intronic
1202830428 14_GL000009v2_random:22664-22686 ATGAGCAAGACTGTGTGTGTAGG + Intergenic
1124384469 15:29195067-29195089 GTGAGGTAGAATGTGGGCGTAGG + Intronic
1130922255 15:88357428-88357450 ATGAGCGAGACTCTGGGCGTAGG - Intergenic
1135405008 16:22191187-22191209 ATGAGGGAGAATCTGGGGGTGGG - Exonic
1136272018 16:29153948-29153970 ATGAGCGAGACGGTGGGGGGGGG - Intergenic
1142371942 16:89687298-89687320 AGGAGAGAGCCTCTGGGCGTTGG + Intronic
1142998757 17:3777360-3777382 GTGAGAGAGGCTGTGGGCATCGG - Intronic
1146219583 17:31006844-31006866 ATGAGCTACACTGTGGGACTTGG - Intergenic
1146954762 17:36931106-36931128 ACCAGACAGACTGTGGGCGTTGG + Intergenic
1152427136 17:80224327-80224349 ATGAGTGAGAGTGTGAGAGTGGG + Intronic
1157700972 18:49761463-49761485 ATGTGTGAGAGTGTGGGGGTGGG - Intergenic
1157849866 18:51038238-51038260 CAGAGCGAGACTGTGGGGGGGGG + Intronic
1160289505 18:77578100-77578122 GTGAGCAAGACTGTGGGCATGGG - Intergenic
1160504258 18:79418149-79418171 TTGATGGAGACTGTGGGGGTCGG + Intronic
1161350167 19:3786688-3786710 ATGGGCGACACTGAGGGAGTTGG - Intronic
1162292618 19:9791583-9791605 ATGCGGGAGTCTGTGGGCGGAGG - Intronic
1163812573 19:19442939-19442961 AGGAACGAGAGTGTGGGCGAGGG + Intronic
1164921101 19:32089267-32089289 ATGAGCGGGCCTGTGGGCACTGG - Intergenic
1168238461 19:55078047-55078069 ATGAGAGAGACTGTGGGACTGGG - Intronic
1202642264 1_KI270706v1_random:105109-105131 ATGAGCAAGACTGTGTGTGTAGG - Intergenic
926289468 2:11517108-11517130 ATGAGTGAGATTTTGGGTGTAGG + Intergenic
927277187 2:21272147-21272169 ATGAGCAAGGCTCTGGGTGTGGG + Intergenic
934969463 2:98751205-98751227 ATGGGAGAGACAGTGGGGGTGGG - Intergenic
946902375 2:224384662-224384684 ATGAGAGAGAGTGGGGGCGATGG - Intronic
948745910 2:240094102-240094124 ACTACAGAGACTGTGGGCGTAGG + Intergenic
948765695 2:240217611-240217633 GTGAGTGGGACTGAGGGCGTGGG - Intergenic
1171889367 20:30695293-30695315 ACGAGCAAGACTGTGTGTGTAGG - Intergenic
1176129000 20:63488383-63488405 ATGAGGCAGACGGTGGCCGTAGG - Exonic
1176609614 21:8867502-8867524 ATGAGCAAGACTGTGTGTGTAGG + Intergenic
1177069663 21:16488230-16488252 AGGTGCTAGAATGTGGGCGTGGG - Intergenic
1180359669 22:11876735-11876757 ATGAGCAAGACTGTGTGTGTAGG + Intergenic
1183932834 22:41246023-41246045 ATGGGTGGGACTGTGGGGGTCGG - Exonic
953752414 3:45618811-45618833 AGGAGGGAGGCTGTGGACGTGGG + Intronic
963031877 3:140986798-140986820 ATGAAAGAGACTGTGGCTGTGGG + Intergenic
1202736296 3_GL000221v1_random:2271-2293 ATGAGTAAGACTGTGTGTGTAGG + Intergenic
972812915 4:42610010-42610032 ATGAGCGTTACTGTGGAAGTGGG - Intronic
973183323 4:47294478-47294500 ATGAGCGAGACTGTGGGCGTAGG - Intronic
975395530 4:73869623-73869645 CTGAGCGAGGCTGTCGGCGCTGG - Intronic
975401467 4:73944159-73944181 GTGAGCGGGACTGTTGGCGCGGG + Intergenic
979549804 4:121977915-121977937 ATGAGAGAGACTGTGGATGAAGG + Intergenic
983362405 4:166743889-166743911 ATCAGCGAGACTGGGGGAGGGGG + Intronic
1202769635 4_GL000008v2_random:190995-191017 ATGAGCAAGACTGTGTGTGTAGG - Intergenic
992130914 5:73692267-73692289 ATGTGTGAGACTGTGTGTGTGGG + Intronic
994230560 5:97306727-97306749 ATGAGCAAGGCTCTGGACGTGGG + Intergenic
996514887 5:124358607-124358629 GTGAGTGAGACTGCAGGCGTGGG - Intergenic
997184845 5:131871375-131871397 ATGAGCGAGACTCTGGGCGTAGG - Intronic
1001736322 5:174006649-174006671 AGGAGCGGGTCTGTGGGAGTCGG + Intergenic
1003390248 6:5707477-5707499 GTGAGCAAGTCTGTGGGCCTGGG - Intronic
1004832799 6:19495504-19495526 ATCAGCGAGACTGTGGGCGTAGG - Intergenic
1008361083 6:50620220-50620242 ATCAGTGAGACTGTGGGAGTAGG - Intergenic
1010280008 6:74012942-74012964 ATCAGTGAGACTCTGGGCGTAGG + Intergenic
1014659194 6:124145935-124145957 ATGATCTTGACTGTGGGAGTAGG + Intronic
1022310684 7:29194126-29194148 AGCAGCGAGACAGTGGGGGTGGG - Intronic
1022396389 7:29990759-29990781 ATTAGCGAGGCTGGTGGCGTGGG - Intergenic
1023204131 7:37729721-37729743 ATGTGCAAGACTGTGTGAGTGGG + Intronic
1025122156 7:56314307-56314329 ATGAGCGAGACTGTGGGCATAGG + Intergenic
1027703002 7:81492319-81492341 ATGAGCCACACTGTGTGAGTAGG - Intergenic
1030082822 7:105792099-105792121 ATGTGTGTGACTGTGGGGGTGGG - Intronic
1032881892 7:136099313-136099335 GTTAGCGAGACTGTGGGCGTAGG + Intergenic
1033062961 7:138125422-138125444 ATGAGAGAGACAGTGGGAGGGGG + Intergenic
1039234124 8:35483145-35483167 ATTAGAGAGACTCTGGGCATTGG + Intronic
1041581307 8:59462595-59462617 ATCAGCAAGACTGTGGGCGTAGG + Intergenic
1045450249 8:102317311-102317333 ATCAGCGAGACTCTGAGCGTAGG - Intronic
1053659058 9:40251886-40251908 ATGAGCAAGACTGTGTGTGTAGG + Intronic
1053909431 9:42881259-42881281 ATGAGCAAGACTGTGTGTGTAGG + Intergenic
1054360091 9:64104665-64104687 ATGAGCAAGACTGTGTGTGTAGG + Intergenic
1054371181 9:64398187-64398209 ATGAGCAAGACTGTGTGTGTAGG + Intronic
1054525541 9:66124336-66124358 ATGAGCAAGACTGTGTGTGTAGG - Intronic
1054678808 9:67887905-67887927 ATGAGCAAGACTGTGTGTGTAGG + Intronic
1062533682 9:137012462-137012484 GTGAGCGAGGCTGCGGGCCTGGG - Intronic
1203694528 Un_GL000214v1:84722-84744 ATGAGCAAGACTGTGTGTGTAGG - Intergenic
1203705025 Un_KI270742v1:32710-32732 ATGAGTAAGACTGTGTGTGTAGG + Intergenic
1203558982 Un_KI270744v1:33101-33123 ATGAGCAAGACTGTGTGTGTAGG - Intergenic
1203641745 Un_KI270751v1:19341-19363 ATGAGCAAGACTGTGTGTGTAGG + Intergenic
1187453205 X:19417420-19417442 ATGAGTGAGGCTCTGGGCGTAGG - Intronic
1192042409 X:67636692-67636714 ATGAGCTAAACTTTGGGCTTTGG - Intronic
1196865822 X:120069884-120069906 AGGAGCGAGAGAGTGGGTGTGGG - Intergenic
1196877274 X:120166396-120166418 AGGAGCGAGAGAGTGGGTGTGGG + Intergenic
1197759789 X:130019994-130020016 ATGTGCCAGGCAGTGGGCGTGGG + Intronic
1198276068 X:135097396-135097418 AAGAGCAAGACTGTGGGGGGAGG + Intergenic