ID: 973190097

View in Genome Browser
Species Human (GRCh38)
Location 4:47376711-47376733
Sequence GAGGCACAAGCTAGGCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973190091_973190097 18 Left 973190091 4:47376670-47376692 CCATAGATGATCTCAGCAGGAAG 0: 1
1: 0
2: 1
3: 12
4: 137
Right 973190097 4:47376711-47376733 GAGGCACAAGCTAGGCTGACAGG 0: 1
1: 0
2: 0
3: 10
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973190097 Original CRISPR GAGGCACAAGCTAGGCTGAC AGG Intronic
900214911 1:1476207-1476229 TAGGCACGAACTGGGCTGACGGG - Intronic
900222122 1:1514561-1514583 TAGGCACGAACTGGGCTGACGGG - Intronic
900275549 1:1824629-1824651 GTGGCACAATCTCGGCTCACTGG + Intronic
900639260 1:3681092-3681114 GTGGCACAGGCCAGGCTGAGGGG - Intronic
901202588 1:7475076-7475098 GAAGCACAAGCTAGCTTAACAGG + Intronic
901466716 1:9426398-9426420 GAGACAAAAGCTGGGCTGACGGG - Intergenic
901549269 1:9983294-9983316 GTGGCACAACCTTGGCTCACTGG - Exonic
901617998 1:10557026-10557048 GAGGCAAAATCTAAGGTGACTGG - Intronic
902920471 1:19663749-19663771 GTGGCACAATCTTGGCTCACTGG + Intergenic
903544295 1:24113898-24113920 GAGGCACCAGCAAGAGTGACAGG - Intergenic
904947725 1:34211867-34211889 GAGGGAAAAGCTAGGCAAACAGG + Intronic
905364043 1:37439165-37439187 GAGCCACCAGCAAGGCTGAGAGG + Intergenic
905693661 1:39960168-39960190 GACGCACAGGATAGGCTGTCAGG + Intronic
908397644 1:63740872-63740894 GAGCTACAAGCTATGCTGCCTGG + Intergenic
910880847 1:91921181-91921203 GTGGCACAATCTCGGCTCACTGG + Intergenic
910888497 1:91991931-91991953 GTGGCACAATCTCGGCTCACTGG - Intronic
911373603 1:97024186-97024208 GAGGCACAAGCTATGCAGCCTGG - Intergenic
912672906 1:111648127-111648149 GTGGCACAATCTTGGCTCACTGG + Intronic
915132230 1:153703448-153703470 CTGGCACAATCTAGGCTCACTGG - Intergenic
916011213 1:160707628-160707650 GAGGCACATGCTTTGCTGAGAGG + Intronic
916222946 1:162462701-162462723 GTGGCACAATCTTGGCTCACTGG + Intergenic
917103879 1:171472778-171472800 CAGGCACAAGCTAGGGCGCCTGG - Intergenic
917613816 1:176716668-176716690 GTGGCACAATCTTGGCTCACTGG + Intronic
917839202 1:178963872-178963894 GTGGCACAATCTCGGCTCACTGG + Intergenic
921690916 1:218148707-218148729 TGGGCTCAAGCTAGGATGACAGG - Intergenic
921800854 1:219400152-219400174 GATGCAGAAGCTGGGCTGAAGGG - Intergenic
922519659 1:226237892-226237914 GTGGCACAATCTCGGCTCACTGG - Intronic
922800037 1:228360973-228360995 GAGGCTCCTGCCAGGCTGACAGG - Intronic
922940670 1:229462616-229462638 GTGGCACAATCTTGGCTCACTGG + Intronic
923069444 1:230549339-230549361 GAGGCTCCAGCTTGGCTGGCAGG + Intergenic
923855167 1:237838516-237838538 AAGACACAAGCTGGGCTGAAGGG + Intergenic
924521667 1:244811235-244811257 GAGGCAGAGGCCAGGCTGAACGG + Intergenic
1065039820 10:21680895-21680917 GTGGCGCAAGCTCGGCTCACTGG - Intronic
1065868717 10:29936866-29936888 GTGGCACAATCTCGGCTCACTGG + Intergenic
1066224801 10:33371854-33371876 GTGGCACAATCTCGGCTTACTGG + Intergenic
1069334215 10:67328688-67328710 GACGCAGAAGCTGGGCTGAAGGG - Intronic
1069402635 10:68064899-68064921 GAGGCAGAGGCTAGGGTGAGTGG + Intronic
1070284693 10:75074228-75074250 GTGGCACAATCTTGGCTCACTGG - Intergenic
1070849842 10:79554470-79554492 GTGGCACAATCTTGGCTCACTGG - Intergenic
1073500679 10:103934122-103934144 GTGGCACAATCTCGGCTCACCGG + Intergenic
1073825087 10:107311653-107311675 GTGGCACAATCTCGGCTCACTGG - Intergenic
1074643043 10:115410378-115410400 GTGGCACAATCTTGGCTCACTGG + Intronic
1075766339 10:124895932-124895954 GTGGCACAATCTTGGCTCACTGG + Intergenic
1076897568 10:133320724-133320746 GTGGCACAATCTTGGCTCACTGG + Intronic
1078087381 11:8242444-8242466 GAGACACAGACTATGCTGACAGG - Intronic
1078845064 11:15113209-15113231 GTGGCACAATCTTGGCTCACTGG + Intronic
1083086992 11:60159371-60159393 GAGCAACAAGCTAAGATGACTGG - Intergenic
1083281857 11:61631773-61631795 GTGGCACAATCTTGGCTCACTGG - Intergenic
1084699920 11:70779867-70779889 GGGGCACCAGCAAGGGTGACTGG - Intronic
1090421698 11:126579902-126579924 GTGGCACAATCTTGGCTCACTGG + Intronic
1090684386 11:129099878-129099900 GACACAGAAGCTAGGCTGAAGGG + Intronic
1091818714 12:3458513-3458535 GAGGAACAAGCACGGCTCACAGG - Intronic
1092929171 12:13299125-13299147 GAGGCACAAGCCAAGCTTAGAGG - Intergenic
1093619940 12:21277100-21277122 GAGCCACAAGCTGTGCTGCCTGG - Intronic
1093935898 12:25000386-25000408 GTGGCACAATCTCGGCTCACTGG - Intergenic
1096580530 12:52581822-52581844 GAGCCAGAAGCTAGCCTGGCAGG + Intergenic
1096725932 12:53562574-53562596 GTGGCACAATCTCGGCTCACCGG - Intronic
1097001420 12:55880218-55880240 GTGGCACAATCTCGGCTCACTGG - Intergenic
1098366904 12:69713008-69713030 GTGCCACATGCCAGGCTGACTGG + Intergenic
1099786687 12:87273608-87273630 GTGGCACAATCTTGGCTTACTGG + Intergenic
1099863269 12:88246195-88246217 GTGGCACAATCTTGGCTCACTGG + Intergenic
1100903717 12:99273633-99273655 GTGGCACAATCTCGGCTCACTGG + Intronic
1102079752 12:110088299-110088321 GCGGCACAATCTCGGCTCACTGG + Intergenic
1103178835 12:118889922-118889944 GTGGCACAATCTTGGCTCACTGG + Intergenic
1103320947 12:120092623-120092645 GAGGCACCAGCCAGGCCCACAGG + Intronic
1105574873 13:21641028-21641050 GTGGCACAATCTCGGCTCACTGG + Intergenic
1108891436 13:55265454-55265476 GAGGCAGAAGCGAGGCAGATTGG - Intergenic
1110223284 13:73094899-73094921 GTGGCACAATCTTGGCTCACTGG + Intergenic
1113925030 13:113936780-113936802 GTGGCACCAGGGAGGCTGACCGG + Intergenic
1115473019 14:33788011-33788033 AAGGCCCAAGGCAGGCTGACAGG - Intronic
1116079344 14:40153951-40153973 GAGCCACAAGCCATGCTGCCTGG - Intergenic
1116541568 14:46107902-46107924 GTGGCACAATCTCGGCTCACTGG + Intergenic
1118578306 14:67267047-67267069 GTGGCACAATCTTGGCTCACTGG - Intronic
1119103812 14:71905630-71905652 CAGGCACATGCCACGCTGACCGG + Intergenic
1119237179 14:73029457-73029479 GTGGCACAATCTTGGCTCACTGG - Intergenic
1119767080 14:77196888-77196910 GGGGCACAGGCTGGGCTGAGGGG - Intronic
1120038900 14:79729886-79729908 GAGGCACTAATTGGGCTGACTGG + Intronic
1120427416 14:84365937-84365959 GTGGCACAATCTTGGCTCACTGG + Intergenic
1124810807 15:32936364-32936386 GAGACACTAGCTGGGCTGATTGG - Intronic
1127424606 15:58843206-58843228 GTGGCACAATCTTGGCTCACTGG + Intronic
1129108859 15:73325903-73325925 GAGGCAGAAGCAAGGATGCCTGG + Intronic
1130508350 15:84568291-84568313 GTGGCACAATCTCGGCTTACTGG - Intergenic
1130683802 15:86019756-86019778 TGGGCACAAGCTAGGCAGAGAGG - Intergenic
1133125763 16:3645067-3645089 GTGGCACAATCTTGGCTCACTGG - Intronic
1136156692 16:28387809-28387831 GTGGCACAACCTCGGCTCACTGG + Intronic
1136206394 16:28727472-28727494 GTGGCACAACCTCGGCTCACTGG - Intronic
1137327511 16:47456631-47456653 GTGGCACAAGCTCAGCTCACTGG - Intronic
1138091290 16:54176819-54176841 GAGGCACGAGGGAGGCTGACAGG - Intergenic
1139434238 16:66926894-66926916 TAGGCAAAAGCTGGGCTGAGGGG + Intergenic
1139612478 16:68069048-68069070 GAGGTAGAGGCTAGGTTGACAGG + Intronic
1143614676 17:8042704-8042726 GAGGCATAAGGCTGGCTGACAGG + Intronic
1143864960 17:9917062-9917084 GAGCCCCCAGCTAGGCTGTCCGG + Exonic
1144031209 17:11325006-11325028 GAGCCAGAAGCTAGGATGTCAGG - Intronic
1144534405 17:16073765-16073787 TAGGCATAAGCTAGGCTTGCAGG + Intronic
1144574510 17:16420418-16420440 GAGGCACAGCCAAGACTGACAGG - Intronic
1147747956 17:42707317-42707339 GTGGCACAATCTTGGCTCACTGG + Intronic
1148680239 17:49469683-49469705 TAGGCTCTGGCTAGGCTGACAGG + Intronic
1151525765 17:74665803-74665825 AAGGCACAATCTTGGCTCACTGG - Intergenic
1158596229 18:58818369-58818391 GTGGCACAATCTCGGCTCACTGG + Intergenic
1159160055 18:64632274-64632296 GTGGCACAATCTTGGCTCACTGG + Intergenic
1159560498 18:69987618-69987640 GAATCACTAGCAAGGCTGACTGG + Intergenic
1160509131 18:79443635-79443657 GAGGCAGAGGCTGGGCAGACGGG - Intronic
1162830168 19:13279542-13279564 GTGGCACAATCTTGGCTCACTGG + Intronic
1163469882 19:17489878-17489900 GAGGGAATAGCAAGGCTGACTGG + Intronic
1164711941 19:30362998-30363020 GTGGCACAATCTTGGCTCACTGG - Intronic
1166014080 19:39967009-39967031 GTGGCACAATCTTGGCTCACTGG + Intergenic
1166641330 19:44497625-44497647 TGGGCACAAGCTGGGCTTACAGG - Intronic
1168026951 19:53649367-53649389 GCGGCACAATCTCGGCTCACTGG - Intergenic
1168043639 19:53778570-53778592 GTGGCACAATCTCGGCTCACTGG + Intergenic
1168284487 19:55323863-55323885 GTGGCACAATCTTGGCTCACTGG + Intronic
1168361987 19:55749081-55749103 GTGGCACAATCTCGGCTCACTGG - Intergenic
925294847 2:2769575-2769597 GAGGCAGAAGCCAGGCTGAAAGG - Intergenic
925324025 2:3001964-3001986 GATGCACAAGCTTGCCTGCCAGG + Intergenic
925991621 2:9259468-9259490 GAGGTACAAGCCAGGCTGAGGGG - Intronic
928157394 2:28889018-28889040 GGGGCACAATCTCGGCTCACTGG - Intergenic
929803189 2:45121898-45121920 GTGGCACAATCTCGGCTCACTGG + Intergenic
930804588 2:55477649-55477671 GTGGCACAATCTCGGCTCACTGG + Intergenic
931565855 2:63615049-63615071 AAGACACTAGCTAGGCAGACAGG + Intronic
932612605 2:73210941-73210963 GAGGCCCTAGCCAGGCTGCCTGG + Exonic
933843142 2:86303866-86303888 CAGGCAGAAGCTAGGCTGAGGGG + Intronic
933849607 2:86355337-86355359 GAGACACAGGCTAGGCTGCTTGG + Intergenic
935893480 2:107707093-107707115 GTGGCACAATCTTGGCTCACTGG + Intergenic
944517062 2:200522832-200522854 GAGGCTCAGGCCAGGCTGCCTGG + Intronic
945253561 2:207784993-207785015 GAGGCCCAAGCTAGGCTGGTGGG + Intergenic
946053858 2:216884661-216884683 GAAGCAGCAGCTGGGCTGACAGG + Intergenic
948174472 2:235932227-235932249 GAGGCTCATCCTAGGCTGCCTGG - Intronic
1171264644 20:23760905-23760927 GTGGCACAATCTCGGCTCACTGG + Intergenic
1171769730 20:29313443-29313465 GAAGCTGAAGGTAGGCTGACGGG + Intergenic
1171936550 20:31279858-31279880 GACGCAGATGCTAGGCTGAATGG + Intergenic
1175657481 20:60784047-60784069 GAGGCACCAGCAAGAATGACAGG - Intergenic
1177023741 21:15895989-15896011 GAGTCACAAGCTGTGCTGCCTGG - Intergenic
1179138400 21:38700545-38700567 GAGGCAAAGACCAGGCTGACAGG + Intergenic
1179950813 21:44707955-44707977 GGGGCACAGGCTAGGCAGCCAGG - Intronic
1180759826 22:18192341-18192363 GTGGCACAATCTCGGCTCACTGG - Intergenic
1180770137 22:18376642-18376664 GTGGCACAATCTCGGCTCACTGG - Intergenic
1180775842 22:18432359-18432381 GTGGCACAATCTCGGCTCACTGG + Intergenic
1180808917 22:18743395-18743417 GTGGCACAATCTCGGCTCACTGG + Intergenic
1180828078 22:18879597-18879619 GTGGCACAATCTCGGCTCACTGG - Intergenic
1181071843 22:20348371-20348393 GTGGCACAATCTCGGCTCACTGG + Intergenic
1181194913 22:21177316-21177338 GTGGCACAATCTCGGCTCACTGG + Intergenic
1181214532 22:21315458-21315480 GTGGCACAAACTCGGCTCACTGG - Intergenic
1181524929 22:23476696-23476718 GTGGCACAATCTCGGCTCACTGG - Intergenic
1181712960 22:24702690-24702712 GTGGCACAATCTCGGCTCACTGG - Intergenic
1183394840 22:37565918-37565940 GGGGCAGAAGCTAGGCACACGGG - Intronic
1183988371 22:41581924-41581946 GTGGCACAATCTCGGCTCACTGG - Intronic
1184604989 22:45567555-45567577 GTGGCACAATCTTGGCTCACTGG - Intronic
1203231969 22_KI270731v1_random:117826-117848 GTGGCACAATCTCGGCTCACTGG - Intergenic
1203278176 22_KI270734v1_random:105596-105618 GTGGCACAATCTCGGCTCACTGG - Intergenic
949328251 3:2891386-2891408 GTGGCACAACCTCGGCTCACTGG - Intronic
950451119 3:13066476-13066498 GAGGCACAGGCTGGGCTGTGAGG + Intronic
950687117 3:14626636-14626658 GTGGCACAATCTCGGCTCACTGG + Intergenic
956101729 3:65775388-65775410 ATGGCACAATCTAGGCTTACTGG - Intronic
958414636 3:93859208-93859230 GAGTGAAAAGCTAGGTTGACAGG + Intergenic
962579867 3:136788621-136788643 GAGGCTCAAGCGGGCCTGACTGG - Intergenic
965520617 3:169665564-169665586 GAGACAAACACTAGGCTGACTGG + Intergenic
965574924 3:170208288-170208310 GAGGCACGAGCTAGGGAGCCCGG - Intergenic
966571332 3:181447124-181447146 GTGGCACAATCTTGGCTCACTGG + Intergenic
966880365 3:184346547-184346569 GATGCACATTCTGGGCTGACGGG + Exonic
966894141 3:184429652-184429674 GAGGCAGAAGCCAGCCTGCCTGG - Intronic
969369284 4:6720986-6721008 GAGGCGGGAGCTGGGCTGACGGG - Intergenic
971023889 4:22568919-22568941 GGGGCACAATCTTGGCTCACTGG + Intergenic
971596425 4:28534895-28534917 GTGGCACAATCTTGGCTCACTGG - Intergenic
972237504 4:37150866-37150888 GAGCCTCAAGCTATGCAGACTGG + Intergenic
973190097 4:47376711-47376733 GAGGCACAAGCTAGGCTGACAGG + Intronic
974851136 4:67406229-67406251 GTGGCACAATCTTGGCTCACTGG + Intergenic
978578265 4:110207746-110207768 GTGGCACAATCTTGGCTCACTGG + Intergenic
978643877 4:110905948-110905970 GAGTCTCAAGCTAGACTGCCTGG - Intergenic
979865807 4:125751519-125751541 GAGGGAAATTCTAGGCTGACAGG - Intergenic
981358310 4:143818494-143818516 GAGGCACAACCTCAGCTCACTGG + Intergenic
981369562 4:143944623-143944645 GAGGCACAACCTCAGCTCACTGG + Intergenic
981579219 4:146235750-146235772 GGGGCAGAAGGAAGGCTGACTGG + Intergenic
982928956 4:161377319-161377341 GTGGCACAATCTCGGCTCACTGG + Intergenic
983420299 4:167507625-167507647 GACACAGAAGCTAGGCTGAAGGG - Intergenic
983619285 4:169743048-169743070 GTGGCACGATCTCGGCTGACTGG - Intronic
986916939 5:12632055-12632077 GTGGCACAATCTCGGCTCACTGG - Intergenic
987339502 5:16927381-16927403 GTGGCACAATCTCGGCTCACTGG + Intronic
987889867 5:23863570-23863592 GTGGCACAATCTCGGCTCACTGG + Intergenic
990579100 5:57151140-57151162 GAGGCATGAGCTATGCTGCCCGG + Intergenic
991608622 5:68428200-68428222 GAGGCACAAGCCAGGATGGAGGG + Intergenic
993895661 5:93530500-93530522 GAGGCAAAGACTAGGCTGATGGG - Intergenic
994119718 5:96100332-96100354 GAGGCAGAAGCTAGCATGTCAGG - Intergenic
996927555 5:128846207-128846229 GAGCCACAAGCTATGCAGCCTGG - Intronic
997146628 5:131441190-131441212 GAGGCTAAAGGAAGGCTGACTGG - Intronic
997552428 5:134765125-134765147 GTGGCACGATCTAGGCTCACTGG + Intronic
999214253 5:149918668-149918690 GTGGCACAATCTTGGCTCACTGG + Intronic
1003603772 6:7541860-7541882 GAGGCATAAGCGAGGCGGGCCGG - Exonic
1003897704 6:10623348-10623370 GTGGCACAATCTCGGCTCACTGG + Intronic
1004459472 6:15822211-15822233 GAGGCACAAGCTACTGTGTCTGG - Intergenic
1005391050 6:25333505-25333527 GTGGCACAATCTTGGCTCACAGG - Intronic
1006886539 6:37386735-37386757 GATGGACAAGCTAGGCTGGTGGG - Intronic
1011386349 6:86802348-86802370 GAGCCACAAGCTGTGCTGCCTGG + Intergenic
1012233602 6:96787739-96787761 GAGGCCCAAGCTAGGTTGATTGG + Intergenic
1012449405 6:99339153-99339175 CAGGCAAAAGCTTGGCTGAGTGG + Intronic
1014651933 6:124050507-124050529 GAGCCCCAAGCCAGGCTGAAGGG - Intronic
1015895043 6:138008827-138008849 GAGGCACATGCTAGGCGCTCAGG + Intergenic
1016816008 6:148303734-148303756 GTGGCACAATCTTGGCTCACTGG - Intronic
1018350349 6:162951916-162951938 GAGGCACAAGCAAAGCTGATGGG - Intronic
1019283257 7:211134-211156 GAGGCCCAGGGGAGGCTGACGGG - Intronic
1021239062 7:18178140-18178162 GTGGCACAATCTTGGCTTACTGG + Intronic
1025066057 7:55857009-55857031 GTGGCACAATCTTGGCTTACTGG - Intronic
1026224954 7:68432077-68432099 GAGGCACAAGGTAGGGAAACTGG - Intergenic
1026925210 7:74187370-74187392 GTGGCACAATCTTGGCTCACTGG - Intronic
1027202947 7:76074323-76074345 AAGGCACAAGCTGGGCCTACAGG + Intergenic
1029421957 7:100476519-100476541 GAGGAACAAGCCAGGCTGTGGGG - Intronic
1029523379 7:101078980-101079002 GTGGCACGATCTAGGCTCACTGG - Intergenic
1031167747 7:118250276-118250298 GAGGCACAGGCAAGGTTGATGGG - Intergenic
1032271918 7:130416782-130416804 GAGGCACCTGCTAGGCTTATCGG + Intronic
1032650763 7:133875732-133875754 GAGGCCAAAGCTAGGTTTACAGG - Intronic
1032940841 7:136788732-136788754 GTGGCACAATCTTGGCTCACTGG - Intergenic
1033469708 7:141634260-141634282 TAGGCTCAAGCTAGGCTGTAGGG + Intronic
1033822973 7:145156173-145156195 GTGGCACAATCTCGGCTTACTGG + Intergenic
1034014594 7:147568025-147568047 GTGGCACAATCTCGGCTCACTGG - Intronic
1034684647 7:152959258-152959280 GAGTAACAAGCAAAGCTGACAGG + Intergenic
1034930549 7:155158186-155158208 GTGGCACAATCTTGGCTCACTGG - Intergenic
1035702400 8:1646719-1646741 GAGGCACAGTCTCTGCTGACAGG + Intronic
1037099205 8:15022400-15022422 GTGGCACAATCTCGGCTCACTGG + Intronic
1039570294 8:38581151-38581173 AAGGCACACTCTAGGCTGCCCGG - Intergenic
1040365373 8:46709922-46709944 GTGGCACAATCTTGGCTCACTGG + Intergenic
1041110029 8:54475330-54475352 GAGGGAGAAGCTGGGATGACAGG + Intergenic
1042108915 8:65358023-65358045 GAGGTAAAACCCAGGCTGACTGG - Intergenic
1043656440 8:82673971-82673993 GACACAGAAGCTAGGCTGAATGG + Intergenic
1044147225 8:88732168-88732190 TAGGCACAAGCTACGTTGCCTGG - Intergenic
1044773981 8:95668677-95668699 GAAGCCCAAGCCAGGCTGTCAGG + Intergenic
1045220114 8:100190721-100190743 GTGGCACAATCTTGGCTCACTGG + Intronic
1046314655 8:112483422-112483444 GTGGCGCAAGCTCGGCTCACTGG - Intronic
1046943643 8:119954915-119954937 GTGGCACAATCTTGGCTCACTGG + Intronic
1051734975 9:20188687-20188709 GAAGCAGGAGCTAGGATGACGGG + Intergenic
1052267898 9:26595423-26595445 GAATCACTAGCTGGGCTGACTGG - Intergenic
1055854389 9:80668767-80668789 GTGGCACAATCTCGGCTCACTGG + Intergenic
1056131124 9:83587442-83587464 GTGGCACGATCTAGGCTCACTGG - Intergenic
1056366796 9:85913077-85913099 GTGGCACAATCTCGGCTCACTGG + Intergenic
1059101914 9:111480354-111480376 GCGGCACAATCTTGGCTCACTGG + Intronic
1060284725 9:122239271-122239293 GTGGCACAATCTCGGCTCACTGG + Exonic
1061980400 9:134099892-134099914 GTGGCACAATCTTGGCTCACTGG - Intergenic
1062107487 9:134763902-134763924 GAGGCACAGGCGAGGCTGGCTGG + Intronic
1062161164 9:135080764-135080786 CAACCACGAGCTAGGCTGACAGG + Intronic
1187612810 X:20960989-20961011 GAGTCACAAGCTATGCAGCCTGG - Intergenic
1190168682 X:48094190-48094212 GTGGCACAATCTCGGCTCACTGG - Intergenic
1190358497 X:49627440-49627462 CAGGCACCAGCTAGCATGACAGG + Intergenic
1193102581 X:77632055-77632077 GTGGCACAATCTTGGCTCACTGG + Intronic
1194144556 X:90246583-90246605 GACACAGAAGCTAGGCTGAAGGG + Intergenic
1196557018 X:117100278-117100300 GTGGCACAATCTTGGCTTACTGG - Intergenic
1196814787 X:119656452-119656474 GAGGCAGAAACCAGTCTGACAGG + Intronic
1197014328 X:121605212-121605234 GATGCAGAACCTAGGCTGAGTGG - Intergenic
1198158408 X:133984922-133984944 GAGGCACCAGCTCGGCTGTGGGG + Intronic
1198788129 X:140313543-140313565 GAGCCACAAGCTATGCAGCCTGG - Intergenic
1200490313 Y:3815888-3815910 GACACAGAAGCTAGGCTGAAGGG + Intergenic
1200511273 Y:4083252-4083274 GAGCCACAAGCTATGCAGCCTGG - Intergenic