ID: 973190693

View in Genome Browser
Species Human (GRCh38)
Location 4:47381939-47381961
Sequence TTGGAGGGGGGAGGATACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 431}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973190693_973190707 14 Left 973190693 4:47381939-47381961 CCCCTGTATCCTCCCCCCTCCAA 0: 1
1: 0
2: 2
3: 43
4: 431
Right 973190707 4:47381976-47381998 CATTTTTATTGTCTAGGCTGGGG 0: 1
1: 1
2: 0
3: 49
4: 302
973190693_973190711 26 Left 973190693 4:47381939-47381961 CCCCTGTATCCTCCCCCCTCCAA 0: 1
1: 0
2: 2
3: 43
4: 431
Right 973190711 4:47381988-47382010 CTAGGCTGGGGGTAGGGATAAGG No data
973190693_973190706 13 Left 973190693 4:47381939-47381961 CCCCTGTATCCTCCCCCCTCCAA 0: 1
1: 0
2: 2
3: 43
4: 431
Right 973190706 4:47381975-47381997 ACATTTTTATTGTCTAGGCTGGG No data
973190693_973190703 8 Left 973190693 4:47381939-47381961 CCCCTGTATCCTCCCCCCTCCAA 0: 1
1: 0
2: 2
3: 43
4: 431
Right 973190703 4:47381970-47381992 TGACCACATTTTTATTGTCTAGG 0: 1
1: 0
2: 0
3: 20
4: 263
973190693_973190705 12 Left 973190693 4:47381939-47381961 CCCCTGTATCCTCCCCCCTCCAA 0: 1
1: 0
2: 2
3: 43
4: 431
Right 973190705 4:47381974-47381996 CACATTTTTATTGTCTAGGCTGG 0: 1
1: 0
2: 0
3: 22
4: 263
973190693_973190709 19 Left 973190693 4:47381939-47381961 CCCCTGTATCCTCCCCCCTCCAA 0: 1
1: 0
2: 2
3: 43
4: 431
Right 973190709 4:47381981-47382003 TTATTGTCTAGGCTGGGGGTAGG 0: 1
1: 0
2: 1
3: 18
4: 217
973190693_973190710 20 Left 973190693 4:47381939-47381961 CCCCTGTATCCTCCCCCCTCCAA 0: 1
1: 0
2: 2
3: 43
4: 431
Right 973190710 4:47381982-47382004 TATTGTCTAGGCTGGGGGTAGGG 0: 1
1: 0
2: 0
3: 11
4: 186
973190693_973190708 15 Left 973190693 4:47381939-47381961 CCCCTGTATCCTCCCCCCTCCAA 0: 1
1: 0
2: 2
3: 43
4: 431
Right 973190708 4:47381977-47381999 ATTTTTATTGTCTAGGCTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973190693 Original CRISPR TTGGAGGGGGGAGGATACAG GGG (reversed) Intronic
900391584 1:2436191-2436213 AAGGAGGGAGGAGGAAACAGAGG - Intronic
901019517 1:6248852-6248874 CGGGGGGGGGGAGGGTACAGAGG - Exonic
901065259 1:6491211-6491233 TGGGAAGGGTGTGGATACAGGGG + Intronic
901226345 1:7614895-7614917 CTGCTGGGGGGAGGGTACAGGGG + Intronic
902122309 1:14176703-14176725 TTGGAGGACTGAGCATACAGTGG - Intergenic
904030803 1:27532386-27532408 TCGGGGAGGGGAGGAGACAGTGG - Intergenic
904358894 1:29959797-29959819 ATGGAGGGGAGAGGATACTGGGG - Intergenic
905813175 1:40927942-40927964 TGGGAGGAGGGAGGAATCAGTGG + Intergenic
906391043 1:45416724-45416746 TGGGATGGGGGAGGAAATAGGGG - Intronic
906746273 1:48224291-48224313 CTGGAGGCGGGAGGACAGAGAGG - Intronic
908252343 1:62274837-62274859 TTGGAGGGGCGGGGCTGCAGGGG + Exonic
908306880 1:62827796-62827818 ATGGAGGGTGGAGGAGAGAGAGG - Intronic
909300630 1:74009128-74009150 TTGGAAGGTGGAGGTTGCAGTGG - Intergenic
910907228 1:92193456-92193478 TTGGTGGGGGGTTGCTACAGAGG - Intergenic
912273126 1:108230026-108230048 GTGGAGAGGGGAGGAGAGAGAGG - Intronic
912295094 1:108464296-108464318 GTGGAGAGGGGAGGAGAGAGAGG + Intronic
912447893 1:109751583-109751605 TCGGGGTGGGGAGGATTCAGTGG - Intronic
912689854 1:111796624-111796646 TTGGAGGGTGGAGGAGGGAGAGG + Intronic
912704957 1:111904817-111904839 GTGGAGCGGGGAGGGGACAGGGG + Intronic
913471030 1:119186578-119186600 TGGGGGAGGGGAGGATAGAGAGG - Intergenic
917536935 1:175881110-175881132 GTGGGGGAGGGAGGATACTGGGG + Intergenic
917713752 1:177712765-177712787 TTGGAGGGGGCAGGATGATGGGG - Intergenic
919266127 1:195268812-195268834 TTGGAGGTGGGAGAAGAAAGAGG + Intergenic
920070222 1:203297218-203297240 TTGGAGGGGTGAGGATATAGGGG - Intergenic
920081279 1:203374603-203374625 TTGGAGGCAGGAGGAAACAGAGG + Intergenic
920671889 1:208010009-208010031 TTGCAGGGAGGAGGGCACAGAGG + Intergenic
921912524 1:220565604-220565626 TGGGAGTGGGGAGGAAACAAAGG + Intronic
922740078 1:228009639-228009661 GTGGAGGGGGGAGAATCAAGGGG - Intronic
924818344 1:247463000-247463022 TTGGAGGGTGGTGAATACAGAGG + Intergenic
1063979861 10:11444597-11444619 TTGGAGGGAGGGGGAGACGGGGG - Intergenic
1064035282 10:11909157-11909179 TTTGAGGAAGGAGGATGCAGCGG - Intergenic
1064221941 10:13448550-13448572 TTGGAGGATGAAGGAGACAGGGG - Intronic
1066274527 10:33855881-33855903 TGGCAGGGTGGAGGAAACAGGGG - Intergenic
1067853089 10:49768151-49768173 TTGGAGGCGGCAGGATTCAGAGG + Intergenic
1070483591 10:76909345-76909367 TTGTAGGGAGGATGATTCAGAGG - Intronic
1071774602 10:88771394-88771416 GGGGAGGGGGAAGGATAAAGAGG - Intronic
1072167258 10:92826067-92826089 TTGCCGGGGTGAGGGTACAGGGG - Intergenic
1074116115 10:110458587-110458609 CTGGAGGGCGGTGGTTACAGGGG + Intergenic
1075346922 10:121689195-121689217 TTGGCGGGGGAGGGGTACAGGGG + Intergenic
1075627305 10:123972455-123972477 TGGGAGGGGAGAGGATGTAGGGG + Intergenic
1075627343 10:123972545-123972567 TGGGAGGGGAGAGGATGCAGGGG + Intergenic
1075634619 10:124022106-124022128 TAGTTGGGAGGAGGATACAGAGG - Intronic
1075736085 10:124665391-124665413 TTGGAGTGGAGAGGAGACACAGG - Intronic
1075806879 10:125195546-125195568 TTGGGTGGGGGAGGACAGAGGGG + Intergenic
1076504444 10:130962671-130962693 GTGGAGGGTGGAGGATTCCGTGG + Intergenic
1077580181 11:3412479-3412501 TGGGAGGTGGGAGGTTGCAGTGG + Intergenic
1079938822 11:26652430-26652452 TTGGAGGAGGCAGGCTACATGGG - Intronic
1080434999 11:32231798-32231820 TTGGTGGGGAGGGGATACATTGG - Intergenic
1080648072 11:34201704-34201726 GTGGAGGAGGGAGGAGACAGAGG - Intronic
1081565668 11:44259594-44259616 ATGGAGGGGGGAGGATTAAGTGG - Intergenic
1081576787 11:44323740-44323762 TTGATGGTGGGAGGACACAGGGG - Intergenic
1082013508 11:47467206-47467228 GTGGAGGGAAGAGGTTACAGGGG - Intronic
1082703283 11:56460420-56460442 TTAGAGTGGGGAGGAAAGAGTGG + Intergenic
1083598280 11:63930459-63930481 TTGGCAGGGGGAGGTTGCAGTGG + Intergenic
1084170136 11:67397024-67397046 CTGGAGAGGAGAGGATGCAGGGG - Intronic
1084180667 11:67444036-67444058 TGGGAGGGCGGAGGTTGCAGTGG - Intergenic
1084237105 11:67795306-67795328 TGGGAGGTGGGAGGTTGCAGTGG + Intergenic
1084835301 11:71797528-71797550 TGGGAGGTGGGAGGTTGCAGTGG - Intronic
1085011955 11:73147468-73147490 GTGGAGGGATGAGGTTACAGGGG + Intergenic
1085762553 11:79254889-79254911 TGGGAGGTGGAAGGAGACAGTGG + Intronic
1086479239 11:87216379-87216401 GTGCAGGGGAGAGGGTACAGTGG + Intronic
1086490245 11:87352323-87352345 GTGGAGGGGGGGGGGTACAGGGG - Intergenic
1086665525 11:89476974-89476996 TTGTAAGGGGGAGAATGCAGTGG + Intronic
1088401015 11:109422747-109422769 TTGGAGAGGGGAGAATACCAGGG + Intronic
1088555693 11:111058626-111058648 TGGGAGGGAGGTGGAGACAGAGG - Intergenic
1089064989 11:115655896-115655918 TTACAGAGGGGAGGAAACAGAGG - Intergenic
1089310888 11:117557432-117557454 CTGGAGGGGGTTGGGTACAGTGG + Intronic
1090081795 11:123618499-123618521 CTGGATGGGCCAGGATACAGGGG - Intronic
1090628539 11:128626673-128626695 TTGGAGGGGGGCTGAAGCAGGGG + Intergenic
1090653272 11:128824731-128824753 TTGGGGGCCGGGGGATACAGGGG + Intergenic
1091124361 11:133082412-133082434 GGGGAGGGGGGAGGATAGGGAGG - Intronic
1091142939 11:133251576-133251598 TTGGGGGGGGGAGGGGACACGGG + Intronic
1091652016 12:2317888-2317910 TGGGAGAGGTGAGGATGCAGTGG + Intronic
1092719323 12:11425210-11425232 TGGGAGGTGGGAGGATGGAGAGG - Intronic
1093899129 12:24609755-24609777 TGGGGTGGGGGAGGATAAAGTGG - Intergenic
1094161214 12:27392996-27393018 GTGGAGGGGAGAGAATACAGAGG - Intronic
1096648323 12:53049964-53049986 GTGGAGGGGGGAGGATGTGGGGG - Intronic
1096799969 12:54104008-54104030 TGGGAGGTGGGAGGGTACTGTGG - Intergenic
1096833523 12:54332932-54332954 GTGGAGGGGGCAGGAAAAAGAGG - Intronic
1096913290 12:55005470-55005492 TTGGAGGAGGAGTGATACAGGGG + Intergenic
1097119818 12:56722718-56722740 TTGGAGTGGCGAGAATACACTGG + Intronic
1097183783 12:57185507-57185529 TGGGGGAGGGGAGGGTACAGAGG - Intronic
1097633797 12:62097251-62097273 TTTGAGGGGGAAGGATAGAAAGG + Intronic
1098345575 12:69499522-69499544 TTGGAGGGTGGAGGGCAGAGGGG - Intronic
1098376665 12:69822538-69822560 TGGGGGGTGGGAGGATAAAGGGG + Exonic
1098963662 12:76764088-76764110 TCCGAGGGGGGAGGGGACAGAGG + Exonic
1099031960 12:77537235-77537257 TTGGTTGAGGGATGATACAGGGG + Intergenic
1099299906 12:80879265-80879287 TAGGAGGGGGTGGGATAGAGAGG + Intronic
1100980143 12:100157116-100157138 GTGGAGGGTGGAGGGTAGAGGGG - Intergenic
1101942356 12:109109402-109109424 TTGGAAGGGGGAGAATTTAGAGG + Intronic
1102568295 12:113811645-113811667 TGGGAGTGGGGAGGAAAAAGAGG - Intergenic
1102682900 12:114702575-114702597 TGGGGGGGGGGAGGAGAAAGAGG + Intergenic
1103507156 12:121449259-121449281 GTGGAGAGGGGAGGCTACGGAGG + Intronic
1104460034 12:128947885-128947907 TTGCAGGTGGCAGGAGACAGGGG + Intronic
1104467959 12:129005452-129005474 TTGGAGGGGGTAGGTGACATAGG + Intergenic
1104672246 12:130688780-130688802 TTGGGGGCCGGAGGAGACAGTGG - Intronic
1105472802 13:20707107-20707129 TTGGAGGGAGGAGGGCAGAGAGG - Intronic
1105508881 13:21034752-21034774 GTTGCTGGGGGAGGATACAGAGG + Intronic
1106644251 13:31615807-31615829 TTGGAAGGGGGAGGAAGAAGTGG - Intergenic
1107076623 13:36327991-36328013 CTGCAGGGGTGAGGAGACAGGGG + Intronic
1107763660 13:43710137-43710159 TAGGAGGGGAGAGGAAAAAGAGG + Intronic
1110361290 13:74628641-74628663 ATGGAGGGGGAAGAATAGAGAGG + Intergenic
1111253005 13:85629208-85629230 TTGAAGAGGAGAGGATGCAGGGG + Intergenic
1111445198 13:88338751-88338773 CAGGAGGTGGGAGGATAGAGAGG - Intergenic
1112664209 13:101551084-101551106 GGAGAGGGGTGAGGATACAGAGG + Intronic
1114161115 14:20168782-20168804 GTGGAGATGGGAGGATAAAGAGG + Intergenic
1114250519 14:20956095-20956117 TTGGAGTTGTGAGGTTACAGTGG - Exonic
1114262615 14:21049111-21049133 TTGGATGGGAGGGAATACAGAGG - Intronic
1114524577 14:23359813-23359835 TTGGAGGGGGCAGCATAGATGGG + Exonic
1114653098 14:24299249-24299271 TTTGAGGGGAGAGGAGTCAGAGG + Intronic
1114712759 14:24795040-24795062 TTGGAGGGAGGAGGGAAGAGTGG - Intergenic
1116840941 14:49820626-49820648 GTGGAAGGGGGAGGAGAGAGGGG - Intronic
1117700395 14:58407024-58407046 ATGGAGGGAAGAGGATACTGAGG - Intronic
1118845859 14:69547507-69547529 CTGGAGGGTGGAGGTTGCAGTGG + Intergenic
1119674474 14:76543766-76543788 ATGGTGGGGGAAGGAAACAGAGG - Intergenic
1121341990 14:93110964-93110986 ATGGAGGGATGAGGAAACAGAGG - Intronic
1121991555 14:98562644-98562666 CTGGAGGGGGGAGGATGGGGAGG - Intergenic
1123090054 14:105738467-105738489 TAGGAGGGGACAGGAAACAGTGG + Intergenic
1123101882 14:105809029-105809051 TTGTTGGGGGTAGGACACAGGGG + Intergenic
1124063704 15:26319852-26319874 TTGGAGAGGGGAGCATTCAAGGG + Intergenic
1124125557 15:26935754-26935776 ATGCAGGGGGGAGGATATAGGGG - Intronic
1124818109 15:33017167-33017189 TGGGAGGAGGGAGGAATCAGTGG + Intronic
1125509325 15:40284130-40284152 GAGGAGGGGGGATGATACACAGG + Intronic
1126772870 15:52075122-52075144 TTGGAGGGGAGAGAATATAGAGG - Intergenic
1126885543 15:53145431-53145453 TTGGAGTGGGGAGAAGATAGTGG + Intergenic
1127363260 15:58263583-58263605 TTGCAGGGGAAAGGATAGAGCGG - Intronic
1129246708 15:74283328-74283350 GTGGAAGGGGCAGGAGACAGAGG - Intronic
1129804032 15:78438886-78438908 GTGGACGGGGGAGGAGACAGCGG - Intronic
1131094391 15:89646574-89646596 TTGGAATGAGGAGGTTACAGAGG - Intronic
1131308972 15:91270730-91270752 TGGGAGTGAGGAGGAAACAGGGG + Intronic
1131366516 15:91846346-91846368 AGGGAGGGAGGAGGATAGAGAGG - Intergenic
1131391612 15:92053741-92053763 TTGGAAGAGGAAGGACACAGAGG + Intronic
1132596162 16:751276-751298 CTGGCGGGTGGAGGAAACAGTGG + Intronic
1132999448 16:2841645-2841667 TGGGAGGGAGGAGAAGACAGAGG + Intergenic
1133348713 16:5087722-5087744 TGGGAGGTGGGAGGTTGCAGTGG + Intronic
1133390234 16:5404140-5404162 TTGGAGGGGTGAGGAGATATGGG + Intergenic
1133528584 16:6631080-6631102 TTGGAGGGGGGTTGGTGCAGAGG + Intronic
1133577532 16:7108019-7108041 TTGGGGGGGAGAGGGTAGAGAGG + Intronic
1134846993 16:17448684-17448706 GTGGAGGGGGGAGGAGGAAGAGG + Intronic
1135543242 16:23348462-23348484 AGGGAGGGGGGAGGGTAAAGAGG + Intronic
1136094468 16:27945121-27945143 TTGGAGGTGGGAGGATTGAGGGG + Intronic
1136687500 16:32003823-32003845 ATGGCGGGGGGAGGAGTCAGTGG - Intergenic
1136725964 16:32357763-32357785 TCGGGGGGGGGAGAAAACAGTGG + Intergenic
1136788113 16:32947374-32947396 ATGGCGGGGGGAGGAGTCAGTGG - Intergenic
1136881670 16:33906415-33906437 ATGGCGGGGGGAGGAGTCAGTGG + Intergenic
1138516797 16:57540594-57540616 CTGGAGGAGGCAGGATCCAGTGG + Intergenic
1140463066 16:75157072-75157094 TAGGAGTGGGAAGGAGACAGCGG - Intronic
1140660902 16:77190806-77190828 TTGGCGGGGGGAGTAGACAGCGG + Intergenic
1141181919 16:81759564-81759586 TTGGAGGAAGTAGGATACGGTGG - Intronic
1141214036 16:82007852-82007874 TTTTAGGGCGGAGGAAACAGAGG - Intronic
1141630674 16:85286199-85286221 TTAGCGGGAGGAGGACACAGTGG + Intergenic
1142234565 16:88915592-88915614 GTGGAGGGGGGAGCGTAGAGGGG + Intronic
1142409320 16:89908074-89908096 TGGGAGGAGGGAGGAGACAGGGG - Intronic
1203090340 16_KI270728v1_random:1209031-1209053 ATGGCGGGGGGAGGAGTCAGTGG - Intergenic
1203132069 16_KI270728v1_random:1696396-1696418 TCGGGGGGGGGAGAAAACAGTGG - Intergenic
1142808744 17:2385551-2385573 GTGGAAGGGGGAGGAGTCAGGGG - Exonic
1143070002 17:4283759-4283781 TTGGAGGAGAGAGGAAACAAAGG + Intronic
1143624530 17:8102097-8102119 TTGGAGGCAGGAGGCTAGAGAGG - Intronic
1144269986 17:13606191-13606213 TTGAAGGTGGGAGGCTTCAGAGG - Intergenic
1144685256 17:17221828-17221850 TTGGAGGGGAGGGGATGCAAGGG + Intronic
1144872733 17:18380878-18380900 TTGGTGGGTGGAGGGGACAGTGG - Intronic
1144954436 17:19011922-19011944 TTGGAGGGGGCAGTCTACAGAGG + Intronic
1145291966 17:21554010-21554032 ATTGAGGGGGCAGGAGACAGGGG - Intronic
1145415086 17:22708274-22708296 AGGGATGGGGGAGGTTACAGGGG - Intergenic
1146271745 17:31489426-31489448 TTGGTGGGGGGAGGATATGGGGG - Intronic
1146663460 17:34681014-34681036 TTGTACTGGCGAGGATACAGTGG + Intergenic
1147148480 17:38499492-38499514 ATGGCGGGGGGAGGAGTCAGTGG - Intronic
1148458140 17:47821845-47821867 TTGGCGGGAGGAGGGGACAGGGG - Intergenic
1149792135 17:59488607-59488629 TTGAGGAGGGGAGGATTCAGTGG - Intergenic
1149881765 17:60299133-60299155 TTGGAGGGGATAGGGGACAGAGG - Intronic
1150344877 17:64396992-64397014 TTGCAGTGGGGAGGGTGCAGAGG - Intronic
1151159547 17:72153366-72153388 TTGGAGGTGGGAGCAGAAAGTGG + Intergenic
1151724434 17:75876188-75876210 GTGGAGGGAGGAGGAGGCAGTGG - Intronic
1151785066 17:76271443-76271465 TTGGTGTGGGGAGGAGAGAGGGG + Intergenic
1152074546 17:78150776-78150798 TTGGAAGGTTGAGGATACAGGGG + Intronic
1152830762 17:82495869-82495891 TTGGAGGGTGGAGGAGAGAGAGG - Intergenic
1153280695 18:3411662-3411684 TTGGATGGAGGAAGACACAGAGG - Intronic
1153945112 18:10011121-10011143 TTGGGGGAGGGAGGATATAGAGG + Intergenic
1154051520 18:10963918-10963940 TGGGAGGGGGGAGTAGAAAGTGG + Intronic
1154301083 18:13193260-13193282 AGGGAGGGGTAAGGATACAGAGG - Intergenic
1154395720 18:13986814-13986836 TTGAAGGTGGGAGGAGAGAGAGG + Intergenic
1154528061 18:15313233-15313255 TTAGATGGGGGGGGAAACAGAGG + Intergenic
1155382523 18:25239779-25239801 TAGGAGGGGGGAGGAGAAGGAGG + Intronic
1156474219 18:37395416-37395438 CAGGAACGGGGAGGATACAGAGG - Intronic
1157501675 18:48194878-48194900 TGGGAGGGGGGAGGGGGCAGAGG + Intronic
1157731358 18:50007072-50007094 TTTGAGGAGGGAGGATACCACGG - Intronic
1158430107 18:57377578-57377600 TTGCAGGGGAGAGGATGCATGGG - Intergenic
1158672814 18:59492068-59492090 CTGGAAGGGGGAGGTTGCAGTGG + Intronic
1159170802 18:64763835-64763857 TTGTAGGTGGGAGGAGAGAGAGG + Intergenic
1159916559 18:74193668-74193690 GTGGAGGGGGGATGATGGAGGGG - Intergenic
1160392656 18:78546922-78546944 GTGGAGGGGGGAGGAGAGGGTGG + Intergenic
1160392665 18:78546941-78546963 GTGGAGGGGGGAGGAGAGGGTGG + Intergenic
1161043107 19:2120568-2120590 TGGGAGGTGGGAGGATCCATGGG - Intronic
1161271249 19:3390548-3390570 TTTGATGGGGGAGGAAACTGAGG - Intronic
1161350832 19:3790602-3790624 TTGGAGGGAGGAGGAGAAAATGG - Intronic
1161518218 19:4708780-4708802 TTGGAGGGTGGAGGGTGGAGGGG + Intronic
1161910967 19:7193539-7193561 CAGGAGGGGGGAGGACACATGGG + Intronic
1161948378 19:7453194-7453216 TTGGGGGGGGGAGGGTAGGGTGG - Intronic
1161961536 19:7526194-7526216 TTGTACGGGGGAGGACACAGTGG + Intronic
1162327544 19:10007807-10007829 TTGGAGGCAAGAGGAAACAGAGG - Intronic
1162536599 19:11266085-11266107 TGGATGGGGTGAGGATACAGGGG + Intergenic
1162847486 19:13404622-13404644 CTGGCAGGGGGAGGACACAGAGG - Intronic
1162980441 19:14235775-14235797 GAGGAGGGGGGAGGACAGAGGGG - Intergenic
1163005840 19:14396219-14396241 TTGGAAAAGGGAGGAGACAGTGG + Intronic
1163195442 19:15716403-15716425 TGGGATGGGAGAGGATGCAGAGG + Intergenic
1163334798 19:16663854-16663876 TTGGTGGGGGGTGGAGATAGGGG - Intronic
1163415482 19:17183970-17183992 TTGGAGGGAGGGGGAGATAGTGG - Intronic
1165068744 19:33243170-33243192 TGGGAGGTGGGAGGAAACAGAGG + Intergenic
1165824703 19:38699046-38699068 ATGGAGGGGGTGGGGTACAGGGG + Intronic
1165912329 19:39237006-39237028 ATGGGGGGAGGAGGATAGAGAGG + Intergenic
1166094740 19:40531528-40531550 CTGGAGTGGGGAGGAGAAAGGGG + Intronic
1166360926 19:42252726-42252748 TTGGGGGGGGGAGAATGAAGAGG + Intronic
1166505773 19:43370599-43370621 TTGGAGGTGGGAGGACAATGTGG + Intergenic
1166895915 19:46021906-46021928 TGGGATGGGGGAGCAGACAGAGG - Intronic
1167036905 19:47000143-47000165 CTGGAGGGGAGAGGACACTGAGG + Intronic
1167255009 19:48422067-48422089 TTGGAGGGCGGAGGTCACTGAGG + Intronic
1167872390 19:52382200-52382222 TTGGGAGGGGGAGGTTGCAGTGG + Intronic
1168017921 19:53588215-53588237 CTGGAGGGGGCTGGGTACAGTGG - Intergenic
1168261319 19:55196665-55196687 TTGGAGGTGGGAGGACAGCGGGG - Exonic
926318322 2:11728455-11728477 TGGGGAGGGGGAGGTTACAGTGG - Intronic
928472245 2:31585958-31585980 TTGGACAGGGGAGGAAAGAGTGG + Intergenic
929549406 2:42879970-42879992 CTGGACGGGGGAAGAGACAGAGG + Intergenic
929562763 2:42966174-42966196 TTGGAAGGGGGAGGACCCTGGGG + Intergenic
929915414 2:46131541-46131563 GTGGAGTGGGGAGGAAAGAGAGG + Intronic
930509821 2:52330328-52330350 TAGGAGGGAGGAGGAAATAGTGG + Intergenic
930764296 2:55069358-55069380 TTTGAGGGGGGCGGTTACAGAGG - Intronic
931581298 2:63778280-63778302 TTGGAGGGTGGAGGTTGCAGTGG - Intronic
932161758 2:69466452-69466474 CTGGAGGGGTCTGGATACAGCGG + Intronic
932413001 2:71558352-71558374 CTGGAGGTGGGAGGACAGAGTGG + Intronic
932574596 2:72955777-72955799 TTGCAGTGGGGAGGACACAGAGG + Intronic
932845926 2:75135897-75135919 ATGGAGAGGGGAGAATATAGGGG - Intronic
933206511 2:79513272-79513294 GGGGAGGGGGGAGGATGGAGAGG - Intronic
936041457 2:109153113-109153135 ATGGAGGGGGAAGGAATCAGTGG + Intronic
936872407 2:117148421-117148443 GAGGCGGGGGGAGGATAGAGAGG - Intergenic
937709954 2:124969229-124969251 TTGGAGGGGAGAGCAAAAAGAGG + Intergenic
941654922 2:168133091-168133113 TTGGTGGGGGGATGGTGCAGAGG - Intronic
941683947 2:168428622-168428644 TTGGTGGGGTGAGGATGAAGCGG + Intergenic
942898195 2:181083551-181083573 GTGAAGGAGGGAGGACACAGAGG - Intergenic
944177892 2:196853963-196853985 TTGGAAGGTTGAGGCTACAGTGG - Intronic
948527562 2:238580959-238580981 TCGGGGGAGGGAGGAGACAGAGG - Intergenic
1168764664 20:373556-373578 TTTAAGGAGGGAGGAGACAGTGG - Intronic
1168962154 20:1877125-1877147 ATACAGGGGGGTGGATACAGGGG - Intergenic
1168962160 20:1877139-1877161 ATACAGGGGGGTGGATACAGGGG - Intergenic
1171400595 20:24871019-24871041 CTGGGCTGGGGAGGATACAGGGG - Intergenic
1171970547 20:31562280-31562302 CTGGAGAGGGGAAGATTCAGGGG + Intronic
1172360842 20:34311776-34311798 AGGGAGGGGCGTGGATACAGCGG - Intronic
1172467278 20:35165535-35165557 GTGTTGGGGGGATGATACAGGGG + Intergenic
1172753719 20:37269088-37269110 CTGGAAGGCGGAGGTTACAGTGG - Intergenic
1173904010 20:46612884-46612906 TTGAAGGTGGGGGGATGCAGAGG - Intronic
1174036883 20:47673953-47673975 TTGGAGCGGGGAGCAGGCAGTGG - Intronic
1174175746 20:48643746-48643768 TTGGGAGGGGGAGGTTGCAGTGG - Intronic
1174280451 20:49435166-49435188 GTGGAGGAGGGAGGAGAGAGAGG - Intronic
1174944257 20:54967496-54967518 TTGGAGGGTCGAAGATATAGGGG - Intergenic
1175221643 20:57420756-57420778 TGGGAGGGTGCAGGCTACAGGGG + Intergenic
1175397316 20:58675303-58675325 CAGGAGGGAGGAGGAGACAGCGG - Intronic
1175412626 20:58780846-58780868 GTGGAGGGGAGAGGAGAAAGAGG + Intergenic
1176028367 20:62997911-62997933 TCGGAGGGGTGAGCATAGAGAGG - Intergenic
1176899388 21:14420729-14420751 TTGGAAAGGGGAGGAGATAGTGG + Intergenic
1177576253 21:22960016-22960038 TGGGAGGGTGGAGGTTACAGTGG + Intergenic
1178255116 21:31045052-31045074 TTGGGAGGGGGAGGGAACAGAGG - Intergenic
1178790258 21:35693256-35693278 TTGGAGGGGACAGGGGACAGAGG - Intronic
1180308169 22:11146857-11146879 TCGGGGTGGGGAGGAAACAGTGG - Intergenic
1180546645 22:16508670-16508692 TCGGGGTGGGGAGGAAACAGTGG - Intergenic
1181110366 22:20599158-20599180 CTGGAGGGAGGAGGCTGCAGAGG + Intergenic
1181306086 22:21918082-21918104 TTGGGTGGGTGAGGCTACAGAGG + Intergenic
1181662389 22:24361794-24361816 TTGGAGGGGGCAGGAGAGGGGGG - Intronic
1181769683 22:25116358-25116380 GTGGAGGGGGTGGGGTACAGTGG - Intronic
1182078587 22:27512485-27512507 TTGGACGGTGGAGGGTAGAGAGG + Intergenic
1182919977 22:34070287-34070309 TTGGAGGTGGGAGGTAAGAGAGG - Intergenic
1182995714 22:34810052-34810074 CTGGAGGGCGGAGGTTGCAGTGG + Intergenic
1183313687 22:37125490-37125512 CTGGAGGGAGGGGGATAGAGGGG + Intergenic
1183315683 22:37135738-37135760 TTGGAGGGAGGTGGAGAGAGGGG - Intronic
1183878239 22:40802743-40802765 TTGGAGTAGGGAGGAGGCAGTGG - Intronic
1184078353 22:42198950-42198972 TTGGAGGGGGCAGGGCGCAGTGG - Intronic
1184925442 22:47633238-47633260 CTGGAGGGAGGAGGAGACATGGG + Intergenic
949399593 3:3652093-3652115 GTGGGGAGGGGAGGGTACAGGGG - Intergenic
950025871 3:9819587-9819609 TTGGAGTGGAGGGGACACAGAGG + Intronic
952004931 3:28832571-28832593 TTGGGGGTGGGAGGAGGCAGAGG + Intergenic
952080481 3:29752089-29752111 TTGGAGGGTGGTGAATGCAGAGG + Intronic
953056573 3:39392247-39392269 TTGGCGGGGTGAGGATAGGGTGG + Intronic
953157008 3:40384847-40384869 TTGGTGGGGGGGGGTTGCAGTGG + Intergenic
953342822 3:42149966-42149988 TTGGAGGGGATAGGAAACTGGGG + Intronic
954798744 3:53175007-53175029 ATGGAGGGTGGAGGAGACAGTGG - Intronic
954915752 3:54147617-54147639 TTGTACAGGGGAGGAAACAGAGG - Intronic
955555035 3:60127674-60127696 CTGGAAGGTGGAGGCTACAGTGG - Intronic
955934553 3:64090228-64090250 TTGGTGGGGAGGGGATGCAGGGG - Intergenic
956012325 3:64844874-64844896 TTTGAGGGTGGGGGGTACAGGGG + Intergenic
957963578 3:87292714-87292736 TGGGAGGGGGGAGCAAACTGTGG + Intergenic
958100231 3:88999416-88999438 TTGAAGGGTGGTGAATACAGAGG - Intergenic
960977330 3:123187932-123187954 GTGGAGGGGTGAGGAGTCAGAGG - Intronic
961301781 3:125926464-125926486 TGGGAGGTGGGAGGTTGCAGTGG - Intergenic
961886687 3:130101374-130101396 TGGGAGGTGGGAGGATGCAGTGG + Intronic
962201047 3:133401455-133401477 TTGGACAGGGAAGGATGCAGAGG + Intronic
962299291 3:134223766-134223788 TTAGAGGGGGAAAGATACTGAGG + Intronic
963038999 3:141055183-141055205 TTGGAGGGCAGAGGGTGCAGTGG + Intronic
963062506 3:141235862-141235884 TTTGAGGGTGGAGGATAAACAGG - Intronic
963555244 3:146779256-146779278 TTGGAGGGTGGAGGTTGTAGTGG - Intergenic
964162917 3:153667633-153667655 TTGGCGGGGGGAGGGTGCACGGG - Intergenic
964766873 3:160187981-160188003 TAGGGGTGGGGAGGAGACAGAGG - Intergenic
967241113 3:187440647-187440669 TTGGACAGGGGAGGAAACTGAGG - Intergenic
968096148 3:195932152-195932174 GAGGAGGGAGGAGGATAAAGAGG + Intergenic
968429086 4:544775-544797 TTGGAAAGGGGAGGAAAGAGTGG - Intergenic
969509448 4:7609482-7609504 CTGGACGGGGGAGGTCACAGAGG - Intronic
969664769 4:8550953-8550975 TAGGACGGGGAAGGAGACAGGGG - Intergenic
969762778 4:9201705-9201727 TTGCAGGTGGGAGAATACTGAGG + Intergenic
970199236 4:13585707-13585729 TTGTAGTGGGAAGGATGCAGTGG + Intronic
971319649 4:25595105-25595127 CTGGAGGGCGGAGGTTGCAGCGG + Intergenic
971745006 4:30567722-30567744 TGGGAGGTGGGAGGAGAGAGGGG + Intergenic
972807155 4:42540796-42540818 TGGAAGGAGGGAGGATAAAGAGG + Intronic
973190693 4:47381939-47381961 TTGGAGGGGGGAGGATACAGGGG - Intronic
973651494 4:53001178-53001200 TTTGGGGAGGGAGCATACAGTGG + Intronic
974505922 4:62772012-62772034 TTGAAGGGTGGTGAATACAGGGG - Intergenic
974543895 4:63275424-63275446 GTGGAAGGGGGAGGCTACAGTGG - Intergenic
974711273 4:65598960-65598982 GTGAAGGGGGGAGGTTTCAGGGG + Intronic
975988496 4:80230445-80230467 TTGGAGGAGGGAAGAAGCAGAGG + Intergenic
976008019 4:80454152-80454174 TTGGAAGGTGCAGGATAGAGTGG + Intronic
976381098 4:84399957-84399979 TTGGATTTGGGAGGATATAGAGG + Intergenic
978175541 4:105727448-105727470 TCGGAGGGCGGAGGTTTCAGTGG + Intronic
979851182 4:125573122-125573144 TTGGAAAGGGGAGGAAAAAGGGG - Intergenic
980661741 4:135868990-135869012 GTGGAGGTGGGAGGATGGAGAGG + Intergenic
981612039 4:146603985-146604007 ATGGTGGAGGGAGGGTACAGAGG + Intergenic
983144496 4:164196902-164196924 TTGGAGGGGGGAGGGGATATGGG + Intronic
983381536 4:167001277-167001299 TTGGAGGGGAGAGGGAATAGGGG - Intronic
983864317 4:172745729-172745751 TTGGAGAGGGGATGAGAGAGTGG + Intronic
984300561 4:177912063-177912085 TTGAAGGGTGGTGAATACAGAGG + Intronic
984453736 4:179938475-179938497 TTGGGGGAGGGAGGATAGAAAGG + Intergenic
985032255 4:185801034-185801056 TTGGTGGGGGGAGGAAAATGAGG - Intronic
986404327 5:7410752-7410774 GAGGAGGGGTGAGGATACATAGG + Intronic
986795105 5:11202636-11202658 TGGGAGAGGGGAGGCTGCAGGGG - Intronic
987767888 5:22258431-22258453 TTGGTGGTGGGGAGATACAGAGG - Intronic
988280145 5:29134681-29134703 TTGGTGTGGGGAATATACAGGGG - Intergenic
988680651 5:33481066-33481088 ATGGAGGGGAGAGGATGAAGGGG - Intergenic
989204007 5:38793693-38793715 TGGGAGGAGGGAGGATAGACAGG - Intergenic
990618265 5:57530454-57530476 TTTGAGGAGGGAGCACACAGTGG + Intergenic
990654177 5:57936090-57936112 GACGAGGGAGGAGGATACAGAGG - Intergenic
992624805 5:78627330-78627352 CTGGAGAGGGGAGGATAGAAAGG - Intronic
993307431 5:86289935-86289957 GTGGAGAGGGGAGGAGAGAGAGG + Intergenic
994188871 5:96845307-96845329 CTGGAAGGTGGAGGTTACAGTGG - Intronic
994235557 5:97358332-97358354 TTGGAAAGGGGAGGAAAGAGTGG - Intergenic
995533655 5:113114843-113114865 TTGAAGGGTGGTGAATACAGAGG - Intronic
996133344 5:119809167-119809189 TTGGAAAGGAGAGGAAACAGTGG - Intergenic
996776412 5:127137147-127137169 TTGGAGGCAGGAGGGTAAAGTGG + Intergenic
996968343 5:129331874-129331896 TTGGAAAGGGGAGGGAACAGTGG + Intergenic
997286257 5:132680865-132680887 TTGTAGGGGGTAAGATACAGGGG + Intronic
997519631 5:134514518-134514540 GTGGAGGTGGGAAGATACAGGGG - Intergenic
998188943 5:140005831-140005853 TAGGAGGGGGTAGGGTTCAGGGG + Intronic
998416847 5:141952314-141952336 TTGGAGCAGGGAGGAAGCAGGGG + Intronic
998897987 5:146820738-146820760 TTGGAGAGGGGAGGAGACGGAGG - Intronic
999404649 5:151296269-151296291 CTGGAGGGGAGAGGAGAAAGGGG + Intronic
999758518 5:154682835-154682857 TGGGATGGGGGAGGAGAAAGAGG - Intergenic
999921747 5:156329149-156329171 CGGAAGGGGGAAGGATACAGAGG + Intronic
1000962625 5:167618334-167618356 TGGGAGGGGAGAGCTTACAGGGG - Intronic
1001783722 5:174393437-174393459 TGGGAGGGGAGAGGATGAAGAGG + Intergenic
1002940660 6:1712893-1712915 TTGGAGGGCTGAGGAGAAAGTGG + Intronic
1003535198 6:6970208-6970230 TTGGAGGAGGGAGGCTGGAGGGG + Intergenic
1005306944 6:24523004-24523026 CTGGAGGGGTGGGGATAGAGAGG + Intronic
1005533620 6:26733295-26733317 CTGGAAGGTGGAGGTTACAGTGG + Intergenic
1005537175 6:26768359-26768381 CTGGAAGGTGGAGGTTACAGTGG - Intergenic
1005739461 6:28776731-28776753 TGGGAAGGGGGAGGAAAGAGGGG - Intergenic
1006558297 6:34887969-34887991 TTGGAGGGGAGAGGAGATCGCGG + Exonic
1007368291 6:41409459-41409481 GTGGAGTGGGGAGGAGAGAGAGG + Intergenic
1007416786 6:41695707-41695729 ATGGAGGGGGAGGGATAAAGAGG + Intronic
1008282122 6:49609242-49609264 TTGGTGGGGGTAGGAGGCAGAGG - Intronic
1008602609 6:53110579-53110601 TTGGAGGGAGGGAGTTACAGAGG - Intergenic
1009781733 6:68280097-68280119 ATGGAGAGGGGAGGGTAAAGAGG + Intergenic
1009881378 6:69570771-69570793 TTGGCGGGGGGAGCATAAAAGGG - Intergenic
1011406344 6:87019068-87019090 TTGCAGGTGGGAGAATCCAGAGG - Intergenic
1011591460 6:88974348-88974370 TGGGAGGGGGGAGGTAAGAGGGG - Intergenic
1012714334 6:102649287-102649309 TTGGAAAGGGGAGGAAAGAGTGG + Intergenic
1012973468 6:105755584-105755606 ATGGAGTGGGGTGGGTACAGAGG - Intergenic
1013167212 6:107605041-107605063 GTGGAGGGGGGAGGAGGAAGAGG - Intronic
1013565176 6:111351913-111351935 ATGGAGAAGGGATGATACAGTGG + Intronic
1016097550 6:140056802-140056824 TAGGAAGGAGGAGGATCCAGTGG + Intergenic
1018040760 6:159919758-159919780 CTGGAAGTGGGAGGGTACAGAGG + Intergenic
1019573596 7:1725341-1725363 GTGGAGAGGAGAGGAGACAGTGG + Intronic
1019780863 7:2938837-2938859 TGGGAGGGAGGAGGTTTCAGAGG + Intronic
1020097834 7:5378239-5378261 TTGGATGGGGGATGACAGAGCGG - Intronic
1020320131 7:6933812-6933834 TGGGAGGTGGGAGGTTGCAGTGG + Intergenic
1020463848 7:8454093-8454115 GTGGAGTGGGGAGGAGAGAGAGG + Intronic
1022791449 7:33693307-33693329 TTGGAGGGGGATCTATACAGTGG - Intergenic
1023166984 7:37352938-37352960 TTGGGTGGGGGAGGATGCACCGG - Intronic
1023603246 7:41901737-41901759 TTTGGGAGGGGAGGATACTGAGG - Intergenic
1024601827 7:50988806-50988828 ATGGAGGAGGGAGGAATCAGTGG + Intergenic
1026228362 7:68462649-68462671 GGGGAGGGGAGAGGAGACAGTGG - Intergenic
1026281026 7:68921862-68921884 TTGAAGGGTGGTGAATACAGAGG - Intergenic
1027270438 7:76515673-76515695 TGGGCGGGGTGAGGATTCAGAGG + Intronic
1028531405 7:91842428-91842450 TTGGAGGGTGGTGAATACAGAGG - Intronic
1028736948 7:94225084-94225106 TGGGAGGAGGGAGGATCCTGAGG - Intergenic
1028751596 7:94389711-94389733 GTGGGGAGGGGAGGATAAAGAGG - Intergenic
1028947830 7:96601013-96601035 TTGGAGGAGGAAGGATGAAGGGG + Intronic
1029221737 7:98995639-98995661 ATGGTGGGGGGGGGATACTGTGG - Intronic
1029885630 7:103867931-103867953 AGGGAGGTGGGAGGACACAGTGG - Intronic
1033710812 7:143941720-143941742 GTGGTGGGGGTAGGGTACAGAGG - Intergenic
1033727896 7:144140667-144140689 TTGAAGTGGGGAGTATACAAAGG + Intergenic
1034827740 7:154282029-154282051 TTGGACAGGGGAGGAAACAGAGG - Intronic
1035072660 7:156156784-156156806 TGGGAGGAGAGAGGAGACAGAGG - Intergenic
1035567612 8:651717-651739 TGGGAGGGGGGAGAAGACTGAGG + Intronic
1036017084 8:4796929-4796951 ATGGAGGGGGCAGGACAGAGCGG + Intronic
1036272871 8:7323440-7323462 TTGCAGGTGGGAGAATACTGAGG + Intergenic
1036348479 8:7986908-7986930 TTGCAGGTGGGAGAATACTGAGG - Intergenic
1036619627 8:10415975-10415997 TTGGAGGAGAGAGGACACACGGG - Intronic
1036843749 8:12147373-12147395 TTGCAGGTGGGAGAATACTGAGG - Intergenic
1036865121 8:12389691-12389713 TTGCAGGTGGGAGAATACTGAGG - Intergenic
1037409574 8:18582223-18582245 TTGGAGAGTTGAGGATGCAGAGG - Intronic
1037424784 8:18743840-18743862 TTTGAGGGGGGAGGTTAAGGTGG + Intronic
1037507746 8:19549202-19549224 TTCGAGGGGAGAGGATGGAGAGG - Intronic
1037753437 8:21697030-21697052 GAGGAGAGGGGAGGAGACAGAGG + Intronic
1038048364 8:23786473-23786495 GTGGAGGGGGGCGGGTGCAGGGG - Intergenic
1038701982 8:29857395-29857417 TTTGAGGTAGGAGGAGACAGTGG - Intergenic
1038891351 8:31727997-31728019 TAGGAGGGGGCAGGACAGAGCGG + Intronic
1041167290 8:55102419-55102441 GTGGCGGGAGGAGGAGACAGCGG + Exonic
1041644416 8:60237049-60237071 ATGGAGAGGGCAGGATACAGAGG + Intronic
1042314298 8:67409240-67409262 TTTGAGGGAGAAGGATACACAGG + Intergenic
1043075783 8:75697811-75697833 TTGGAGGAGGGAGTATAAAAAGG - Intergenic
1043538287 8:81230204-81230226 ATGGAGGGGAGAAGACACAGTGG + Intergenic
1044737530 8:95294648-95294670 TTGGAGGGGTAAGGAAACAGGGG + Intergenic
1045681208 8:104662334-104662356 TTTGATGGATGAGGATACAGAGG + Intronic
1045844677 8:106619936-106619958 TAGGAGGGAGGAGGAGAGAGAGG - Intronic
1045881515 8:107045941-107045963 TTGGGGGAGGGAGGATGGAGAGG + Intergenic
1045968346 8:108051901-108051923 TTGGAGGGTGGTGGAGGCAGGGG + Intronic
1046321951 8:112590439-112590461 TTGGAGGGGGTGGGAGACAAAGG + Intronic
1048329212 8:133460886-133460908 TTGGAGGGGTGGGGACAAAGAGG + Intronic
1049154157 8:141056777-141056799 TTGGAGGGAGGAGGTGAAAGTGG - Intergenic
1049252941 8:141598841-141598863 TTGGGGGTGGGAGGAGAAAGAGG + Intergenic
1050041400 9:1497769-1497791 CTGGAGGGAGGAGGGTAAAGAGG - Intergenic
1051082978 9:13314138-13314160 TTGGTGGGAGAAGGGTACAGAGG - Intergenic
1051123334 9:13775703-13775725 TAGGAGGGGGGACGGTAGAGAGG - Intergenic
1052989471 9:34510775-34510797 TTAAAGGGGGGAGGGGACAGGGG - Intronic
1053145137 9:35706964-35706986 ATGGTGTTGGGAGGATACAGGGG - Intronic
1053379337 9:37636138-37636160 TGGGAGGGGAGAGGAGGCAGTGG + Intronic
1055072789 9:72184356-72184378 TTGGAGGGGGAAGGATGAATAGG - Intronic
1055679181 9:78697020-78697042 TTGGAGGGCGGGGGATACTCCGG + Intergenic
1055875369 9:80935549-80935571 TTGGATGGGGGAGGACAGAATGG - Intergenic
1056255454 9:84794996-84795018 TTGGGGGGTGGAGGGCACAGGGG - Intronic
1056546951 9:87621109-87621131 TTGGAGGAGGGAGGGTAGAAAGG - Intronic
1057226436 9:93295749-93295771 ATGGAGAGGGGAGGATAGAGAGG - Intronic
1057226816 9:93296942-93296964 ATGCAGAGGGGAGGAAACAGAGG - Intronic
1057273008 9:93661077-93661099 TTGGAGGGGAGGGGGTTCAGGGG + Intronic
1057923851 9:99124523-99124545 TTGGGGGGGGCAGTATCCAGGGG + Intronic
1058624686 9:106922755-106922777 TTGGAGAAGGGAGGAAAGAGAGG + Intronic
1059220888 9:112617838-112617860 TTGGGGGGGGAGGGATAGAGAGG - Intronic
1059396859 9:114039938-114039960 GGGGAGGGGGGAGGACACACAGG + Intronic
1060265120 9:122107523-122107545 GTGGATGGGGGAGGCTGCAGAGG + Intergenic
1060438220 9:123614626-123614648 TGGGAGGGGAGAGGAAACAAGGG + Intronic
1060671556 9:125474265-125474287 TTGGTGGTGGGAGGTTACTGGGG - Intronic
1060943431 9:127556344-127556366 TTGGTGGGGGTTGGTTACAGAGG - Intronic
1061942590 9:133891522-133891544 ATGGAGGGGGAAGGATGGAGAGG + Intronic
1062517435 9:136943671-136943693 TTGGGGGGTGGGGGGTACAGGGG - Intronic
1062542678 9:137048544-137048566 GTGGAGGGGTGGGGATACAGGGG + Exonic
1062722227 9:138050479-138050501 CTGGAGTGGAGAGGAAACAGAGG - Intronic
1185887109 X:3792688-3792710 TTGGAGGGAGGAGGTGAAAGAGG + Intergenic
1187214307 X:17261329-17261351 TTGGAAGGGGAAGGGTACAGGGG + Intergenic
1187413284 X:19069813-19069835 TTGGAGGGTGGTGAATGCAGAGG - Intronic
1187731848 X:22263598-22263620 TTGGGTGGGGGAGGATCCAGAGG + Intergenic
1188078458 X:25807512-25807534 TTGGAAAGGGGAGGAAAGAGTGG - Intergenic
1188256533 X:27967798-27967820 TTCTAGGAGGGAGGAGACAGTGG + Intergenic
1188509323 X:30917789-30917811 TTGGAGAGGGGTCAATACAGAGG - Intronic
1188815262 X:34705363-34705385 TTGGAAAGGGAAGGAAACAGTGG - Intergenic
1189902693 X:45723460-45723482 TTGGAGGGGAGAGGATAGAACGG - Intergenic
1190785824 X:53647575-53647597 CTGGAGAGGGGAGGAAAAAGAGG + Intronic
1190931634 X:54953573-54953595 TTGGAGAGGGGAGCATTCTGGGG - Intronic
1192180930 X:68915030-68915052 TTGGTGGGCAGAGGATCCAGAGG + Intergenic
1192973019 X:76253478-76253500 TTGGAGAGGGGATAATTCAGTGG + Intergenic
1193301430 X:79892811-79892833 TTGGAGGAGAGAGGATACTCTGG - Intergenic
1193812411 X:86067287-86067309 TTGGGGGGTGGAGGAGACATGGG - Intergenic
1194083524 X:89498485-89498507 TTGGAAAGGGGAGGAAAGAGTGG - Intergenic
1194762045 X:97806598-97806620 ATGGAGGGAGGAGGAGAAAGAGG + Intergenic
1196649903 X:118158032-118158054 GTGGAGCGGGGAGGAGACAGGGG + Intergenic
1197075802 X:122350936-122350958 TTGGAAAGGGGAGGAAAGAGTGG + Intergenic
1197578357 X:128251113-128251135 ATGGGGTGGGGAGGAAACAGTGG + Intergenic
1198675185 X:139123706-139123728 TCTTAGTGGGGAGGATACAGTGG - Intronic
1199342607 X:146698906-146698928 TTTGAGGAGGAAGAATACAGAGG - Intergenic
1199443001 X:147889802-147889824 TTGGAAAGGGGAGGAAACAGTGG - Intergenic
1199611745 X:149623156-149623178 TTGGAGAGGGGAGGATAAAGAGG - Intronic
1199822194 X:151460761-151460783 CTAGAGGGGAGAGGATAGAGGGG - Intergenic
1199921562 X:152410226-152410248 TTGTGGGGGGAAGGATAAAGAGG + Intronic
1200436173 Y:3154366-3154388 TTGGAAAGGGGAGGAAAGAGTGG - Intergenic