ID: 973197170

View in Genome Browser
Species Human (GRCh38)
Location 4:47458713-47458735
Sequence CTGAAGAAGCATGAGAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 394}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973197167_973197170 3 Left 973197167 4:47458687-47458709 CCGAAAATATAATAGCCAAGGCA 0: 1
1: 0
2: 1
3: 23
4: 274
Right 973197170 4:47458713-47458735 CTGAAGAAGCATGAGAATGAAGG 0: 1
1: 0
2: 3
3: 37
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973197170 Original CRISPR CTGAAGAAGCATGAGAATGA AGG Intronic
900830863 1:4964407-4964429 CTTCAGAAGCATGTGAGTGAAGG - Intergenic
901887579 1:12233668-12233690 CTGAAGCAGCATCAGAATGTAGG + Intronic
906261747 1:44397073-44397095 CTGGAGAAGGATGTGGATGAAGG + Intergenic
906669691 1:47645469-47645491 CTGGAGAGGCAAGAGAAGGATGG + Intergenic
907538370 1:55186829-55186851 CTGAAGATGGATGGGACTGATGG + Intronic
908153030 1:61324171-61324193 CTTTAGAAGGATGAGAATGTAGG + Intronic
908919154 1:69169313-69169335 CTGCAGAAGCCTCAGAATCATGG - Intergenic
909034927 1:70586184-70586206 CTGAATCAGCATGAGAATGCAGG + Intergenic
909838156 1:80283879-80283901 CTGAAAAAGCAAGAAAAAGAAGG + Intergenic
910642569 1:89479949-89479971 CTGAAGAAGCCTCACAATCATGG + Intergenic
911242252 1:95479294-95479316 CTGCAGAAGCCTCATAATGATGG - Intergenic
911279683 1:95908218-95908240 CAGATAAAGCATGAGAATGCTGG + Intergenic
911529522 1:99028139-99028161 GTGAAGAATCTTGAGAAGGAAGG - Intergenic
911988882 1:104665394-104665416 CTAAAGAAGCACTAGAATCAAGG - Intergenic
912095491 1:106137129-106137151 CAGAAGAAGAAGGAGAAAGAGGG + Intergenic
913110455 1:115652857-115652879 CGGCAGAAGCTGGAGAATGATGG + Intronic
915627657 1:157125455-157125477 CAGAACAAGCTTGAGAATGAAGG + Exonic
915663958 1:157427889-157427911 ATTAAGAAGAATGAGAAAGAAGG + Intergenic
916979107 1:170114098-170114120 CTATAAAAGCATGAGAATCATGG - Intergenic
919000032 1:191818906-191818928 ATGAAGAAGCTTCTGAATGAAGG - Intergenic
919712528 1:200741748-200741770 CTGAAGAAGAAAGGAAATGAAGG + Intronic
919787364 1:201268224-201268246 CTGGAGAAGGATGACAGTGATGG + Intergenic
919918572 1:202154204-202154226 CTGAGTGAGCATGACAATGAGGG + Exonic
920533902 1:206724738-206724760 GAGAAGAAGCAACAGAATGAGGG + Intronic
921983978 1:221289185-221289207 ATGAAGGAGAGTGAGAATGATGG + Intergenic
923068989 1:230545670-230545692 CTGATGTTGCATGAGAAAGAAGG + Intergenic
923150604 1:231229906-231229928 CTGAAGATGGATGGTAATGAGGG + Intronic
923301538 1:232645429-232645451 CTGAAGAAGCATGGAAAAGCAGG - Intergenic
923538813 1:234873540-234873562 AGGAAGAAGAATTAGAATGAAGG - Intergenic
924806444 1:247365456-247365478 CAGAAGAAGCAGGAAAATGTGGG + Intergenic
924911997 1:248523048-248523070 CTGCACAAGGATGAGAAGGATGG - Intergenic
1062886502 10:1020645-1020667 ATGAAGCACCATGAGGATGAAGG - Intronic
1063034889 10:2276653-2276675 CTGGAGAAGCAGGAGTATGGTGG - Intergenic
1063640488 10:7825415-7825437 CTGGAGAAGGATGGGGATGATGG - Intronic
1063793078 10:9477827-9477849 CTCTAGAAGCTTGAGAATCAAGG - Intergenic
1064354534 10:14604855-14604877 ATGAAAGAGAATGAGAATGAGGG - Intronic
1067911322 10:50349782-50349804 CTGCAGAGGCCTGAGAATCATGG - Intronic
1068173915 10:53431675-53431697 CCGAAGAAGCATTAGAAAGCTGG + Intergenic
1068228120 10:54133740-54133762 CTGAAGAAGCATGTTAGTCAAGG + Intronic
1069098234 10:64286572-64286594 TTGATGAAGCAGGAGAAAGAGGG - Intergenic
1069198097 10:65579901-65579923 CTGAACAAGGATGACAATAATGG + Intergenic
1069223528 10:65912402-65912424 CTGAAAGAGGATGAGAGTGAAGG + Intergenic
1069562915 10:69443610-69443632 CTAAAGAAGTAAGAGAAAGAAGG - Intergenic
1070456910 10:76626466-76626488 CTGAATAAACATTACAATGATGG - Intergenic
1071848364 10:89542875-89542897 GTTGAGAAGCATGATAATGAAGG - Intronic
1073144804 10:101273511-101273533 GGGAAGAGGCATGTGAATGAGGG - Intergenic
1073886609 10:108047044-108047066 CAAAAGAAGCAAGAGAATCAGGG + Intergenic
1074134919 10:110617980-110618002 CTGAAGAAGGACAGGAATGAGGG - Intergenic
1075813641 10:125247226-125247248 CTGAAGAAGAAAGAGAAACATGG + Intergenic
1076943629 10:133627434-133627456 CTGAGGAAGGGTGAGAATGGGGG - Intergenic
1079655556 11:22982782-22982804 CTGAAGAAGCCTCACAATCATGG + Intergenic
1081208351 11:40301065-40301087 CTAAAGAAGCTTGGGAAGGAAGG + Intronic
1081238203 11:40671625-40671647 CTGAATAAGGACAAGAATGAAGG - Intronic
1081285751 11:41267968-41267990 CTGAAGTAGCATTAGAATGATGG - Intronic
1081425243 11:42919432-42919454 CTGAGGAAGCCTCAGAATCATGG + Intergenic
1082175796 11:49057593-49057615 GTGAAGAAGCATTACAGTGACGG - Intronic
1084952035 11:72671705-72671727 CTGAAGGAGAATGATATTGAGGG + Intronic
1085108165 11:73863859-73863881 CAGAAGAAGCTTGACAAGGATGG - Intronic
1085733527 11:79019323-79019345 CCAAAGAAGTAAGAGAATGAAGG - Intronic
1086783731 11:90938823-90938845 CTCAAAAAGCAGGAGAGTGAAGG + Intergenic
1087092585 11:94288941-94288963 CTGCAGAAGCAGGAGGATAAGGG + Intergenic
1087573229 11:99957690-99957712 ATTAAGAAGCATGAGAATCCTGG + Intronic
1088009521 11:104983074-104983096 CTAAAGGAGGATGAGAATTATGG - Intergenic
1088351289 11:108891256-108891278 CTGCAGGATGATGAGAATGAAGG - Intronic
1091073061 11:132587352-132587374 CTGAAGAATCAAGACCATGAAGG - Intronic
1091086059 11:132723106-132723128 CTGAAGAAACAAGAGAACAAAGG + Intronic
1091506899 12:1080734-1080756 CTGAGGAAGCCTCAGAATCACGG - Intronic
1091541880 12:1469682-1469704 GTGAAGAAGGGTGAGAATGAGGG - Intronic
1091880940 12:3977719-3977741 CTGAGGAAGCAGGAGAAACATGG + Intergenic
1095041883 12:37451864-37451886 CTGATGAAACATGGGAAAGATGG + Intergenic
1096302677 12:50445312-50445334 GGGAAGAACCATGTGAATGATGG - Intronic
1096851675 12:54442898-54442920 CCGGAGAAGCAAGAGAATGAAGG + Intergenic
1096971279 12:55668378-55668400 CTGGAGAGGCAAGAGAATGCTGG - Intergenic
1097270501 12:57771273-57771295 CATAAGAAGCATGAGAAGGTTGG + Intronic
1097807434 12:63981184-63981206 CTAGGGAATCATGAGAATGATGG - Intronic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1099265724 12:80445005-80445027 CTGAAGAAACAGCAGAATGCAGG - Intronic
1100326395 12:93543692-93543714 CTGAGGAAGCATCTGAATGCAGG - Intergenic
1100342074 12:93688857-93688879 CTGAAGAAGAATTAGGGTGATGG - Intronic
1100609673 12:96180990-96181012 CTGAAGAGGCCTCAGAATCATGG + Intergenic
1101358890 12:104007959-104007981 CTGGAGAAGCCTCAGAATCATGG - Intronic
1102614541 12:114141979-114142001 TCCAAGAAGCATGAGAATGAAGG - Intergenic
1102749848 12:115282913-115282935 AGCAGGAAGCATGAGAATGAGGG + Intergenic
1103059876 12:117849974-117849996 CTCAAGAAGTAAGAGTATGATGG + Intronic
1104294100 12:127496047-127496069 CTGGAGAACCATCAGGATGATGG - Intergenic
1104433545 12:128737005-128737027 CTGAAGAAGAAAGAAAAGGAAGG + Intergenic
1106537321 13:30658600-30658622 CTGAAGCAGCATGAGCATGTGGG - Exonic
1106607258 13:31240558-31240580 GTAAAGAAGCTTGAGAAAGATGG + Intronic
1107395933 13:40017656-40017678 ATGAGGGAGCATGAAAATGAAGG + Intergenic
1108156021 13:47585253-47585275 CTGGAGAAGCCTCAGAATCATGG + Intergenic
1108650204 13:52470779-52470801 GTGAAGGAGCTTGAGAAGGAGGG + Intronic
1109233951 13:59792784-59792806 CTGAAAAAGTAGGAGAATGAAGG - Intronic
1110261415 13:73489526-73489548 CAGAAGAAACATGAAAATAAAGG + Intergenic
1110476708 13:75923838-75923860 CTGAAGATGGGGGAGAATGAAGG + Intergenic
1111154805 13:84308828-84308850 CTGAAGAGGCCTCAGAATGACGG - Intergenic
1111377423 13:87398955-87398977 CTTAGGTAGAATGAGAATGATGG - Intergenic
1111399269 13:87711101-87711123 ATGAAGAGACTTGAGAATGAAGG + Intergenic
1111784064 13:92765042-92765064 CTGAAGAAATATGAGATTGATGG - Intronic
1112634199 13:101197024-101197046 CTGAGGAGGCTTGAGAGTGAAGG - Intronic
1112697832 13:101970519-101970541 CTAAAGAAGCCTTAGAATCAAGG + Intronic
1112883366 13:104136803-104136825 CTAAAGCAACATAAGAATGAAGG + Intergenic
1112968133 13:105224778-105224800 CTGGAGAGGCCTCAGAATGATGG + Intergenic
1113210306 13:107970488-107970510 CTGAAGAGGCCTCAGAATCATGG - Intergenic
1113828129 13:113272871-113272893 CTGAGGCGGCATGAGAATGCAGG + Intergenic
1114809221 14:25876759-25876781 CTTAAAAAGCATGAAAATGGAGG - Intergenic
1117224697 14:53643421-53643443 ATGAAAAAGCATGAAAATGAAGG - Intergenic
1119207562 14:72805999-72806021 CTGAAGGTGCCTGAGAATGAAGG - Intronic
1119457856 14:74771796-74771818 CTGAAGGAGAGAGAGAATGAGGG + Intronic
1120701711 14:87705561-87705583 CTGAAGCATGATGAGAAAGAGGG + Intergenic
1122361239 14:101166963-101166985 CTGAAGAAGCACAAAATTGAAGG - Intergenic
1123776295 15:23583997-23584019 CTGAAGAATCCTGAGAATGTAGG - Intronic
1124050646 15:26194370-26194392 CTGAAGAAACATGAGACCTAGGG + Intergenic
1124216229 15:27808934-27808956 GTGAAGAGGAAGGAGAATGATGG - Intronic
1125383610 15:39113735-39113757 GAGAAGAAGCCTGAGAAGGAAGG + Intergenic
1126269052 15:46791313-46791335 CTGCAGCAGCAGGAAAATGACGG + Intergenic
1126293062 15:47103674-47103696 CTGATGAAACATGGGAAAGATGG - Intergenic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126560668 15:50040335-50040357 CTGAAGAGGCAAAGGAATGAAGG - Intronic
1126736422 15:51736459-51736481 ATGAAGGAGCATCAGTATGAAGG - Intronic
1126947812 15:53843655-53843677 ATGAAGAAGACTGAAAATGAAGG + Intergenic
1127315913 15:57793474-57793496 CTGAAGAAAAATGAAAATCAGGG - Intergenic
1127743089 15:61933213-61933235 CTGCAGAACCAGCAGAATGATGG + Intronic
1128177671 15:65570525-65570547 CTGAAGAAACAGGAGGTTGAAGG + Intronic
1129011357 15:72420771-72420793 CTGAAGCAGAATGAGGAAGAGGG - Intergenic
1129175762 15:73838791-73838813 CTGAAGTTGCATGAGAATTCAGG - Intergenic
1129816967 15:78563916-78563938 ATCAATAATCATGAGAATGATGG - Intergenic
1132057821 15:98665474-98665496 TTGAAGAAGGAAGAGACTGAAGG - Intronic
1132373016 15:101310889-101310911 CTGAAAAAGACTGAAAATGAGGG - Intronic
1132418151 15:101639422-101639444 TTGAAAAAGCCTGAAAATGAAGG - Intronic
1133077224 16:3289223-3289245 CTGGAGAAGCATCAGGATAAAGG - Intronic
1133355258 16:5131608-5131630 CTGAAGAAGCCTCAAAATCATGG + Intergenic
1133379466 16:5317991-5318013 CTGAAGAGGCAGGGGAATGCAGG + Intergenic
1133455639 16:5940161-5940183 CTTAAGAAGTATTGGAATGATGG + Intergenic
1136654757 16:31703200-31703222 CTGAAGAAGAAGGAGCCTGAAGG + Intergenic
1137572401 16:49575429-49575451 CTGAAGAACCTAGAGAGTGAAGG - Intronic
1137805557 16:51301882-51301904 CTGAAGAAGCAGCAGAAAGAAGG - Intergenic
1138470787 16:57234119-57234141 CTGAAGGAGCATGAGAAAACGGG - Intronic
1138659109 16:58507438-58507460 TTGTAGAAGAATGAGAAGGAGGG - Intronic
1139232461 16:65297122-65297144 CTGCAGCAGAATCAGAATGAGGG - Intergenic
1139730279 16:68938241-68938263 CTGAAGAACAATGAGAAGGTTGG + Intronic
1140119414 16:72070693-72070715 CTGAACAAGCATCAAACTGAAGG - Intronic
1140681851 16:77392960-77392982 CTGAAAAAGCAGGAAAATGTAGG + Intronic
1140806005 16:78532949-78532971 CTGATGAAGCAAGAGTAGGAGGG + Intronic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141525909 16:84611652-84611674 ATGAATAAACAGGAGAATGAAGG + Intronic
1141718554 16:85741624-85741646 CAGAAGCAGGATGACAATGAGGG - Intronic
1143641065 17:8197827-8197849 TTGAACCAGCATGAGAGTGATGG + Intergenic
1143795399 17:9332088-9332110 CTGAAGAAACAACAAAATGAAGG - Intronic
1143805215 17:9420587-9420609 CTTAGTAAGCATGAGCATGAAGG - Intronic
1144008570 17:11123808-11123830 CTGGAGAATGATGAGAATAAGGG - Intergenic
1146736046 17:35240225-35240247 CTCTAGAAGCTTGAGAATGTGGG + Intergenic
1148720399 17:49748482-49748504 CTGAGGAATCAAGAGAATGGTGG + Intronic
1149051534 17:52310796-52310818 CTGAAGAGGCCTCAGAATCATGG + Intergenic
1151534710 17:74732220-74732242 CTGAAGCAGCATGTGTATGAGGG - Intronic
1151561434 17:74871993-74872015 CTGGAGCAGCAGGTGAATGATGG + Intronic
1151561578 17:74872756-74872778 CTGGAGAAGGGTGAGACTGAAGG - Intronic
1152167083 17:78716729-78716751 CCGGGGCAGCATGAGAATGAAGG - Intronic
1154031398 18:10756844-10756866 AGGATGAAGGATGAGAATGAGGG + Intronic
1155213783 18:23624519-23624541 CTGAAGAAGAATGAGATTCATGG + Intronic
1155290940 18:24340888-24340910 CTGATGAAACATGACAATGAAGG - Intronic
1155412265 18:25559618-25559640 CTTAAGAAGCAGGAGACTGTCGG + Intergenic
1155836300 18:30589401-30589423 CTGAAGATGCCAGAGAAAGAAGG + Intergenic
1157198153 18:45636967-45636989 CTGAAGATGCAAGAGACAGAGGG - Intronic
1157510959 18:48274175-48274197 CAGAAAAAGCATGAGATTAAGGG - Intronic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1158201322 18:54944468-54944490 CTGAAGAAGAATGTCTATGATGG + Intronic
1158832231 18:61292230-61292252 CTGAAGCACCATGAAAATTATGG + Intergenic
1158859486 18:61578514-61578536 CAGAAGCAGCATGCGGATGATGG + Intergenic
1159895543 18:73992238-73992260 CTGAAAAAGCATAGGGATGAAGG + Intergenic
1161367856 19:3891366-3891388 CTGCAGAAGGGTGAGAGTGAAGG - Intronic
1162174753 19:8822800-8822822 TTGAAGAAGGATGGGAAGGATGG - Intronic
1163518976 19:17780795-17780817 CTGAGGAAGCAGGAGAGGGAGGG + Intronic
1164662935 19:29994325-29994347 CTGACCAACCATGTGAATGAGGG - Intronic
926058189 2:9788859-9788881 CTGAAGAAGAGTGAAGATGAAGG + Intergenic
926162669 2:10499864-10499886 CTGAAGAAGGAAGTGAAGGATGG + Intergenic
927047313 2:19292272-19292294 CATAAGCAGCATGAGCATGATGG - Intergenic
927235592 2:20871590-20871612 CTGATGAAGAAGGAGAAAGAAGG + Intergenic
927749369 2:25653371-25653393 CTGAAGAGGCCTCAGAATCATGG - Intronic
927925965 2:27013934-27013956 CTCATGAAGCATCAGAATGATGG - Intronic
928203122 2:29264045-29264067 CTGAAGAAGCACGAAAAAGTTGG - Intronic
928269353 2:29842422-29842444 CTGGTAAAGCCTGAGAATGATGG - Intronic
928356029 2:30615390-30615412 GTGAAATAGGATGAGAATGAAGG + Intronic
929750498 2:44707299-44707321 GTGAGGAAGCATGATACTGAAGG + Intronic
930215608 2:48693278-48693300 TTTCAGAACCATGAGAATGAAGG - Intronic
930362162 2:50394845-50394867 CTGGAGGAGCATGAGCAGGAAGG - Intronic
930414946 2:51079026-51079048 TTGAAGAATCAAGGGAATGAAGG + Intergenic
931256747 2:60580976-60580998 GTAACGTAGCATGAGAATGAAGG - Intergenic
931692813 2:64849749-64849771 CTCAAGGAGCATGAGAGTGAAGG + Intergenic
932085454 2:68753686-68753708 CTGAAAAAACATGAGAACGTGGG - Intronic
932142495 2:69292377-69292399 CTGAGAAAGCATGAGACTGCAGG - Intergenic
932166496 2:69512589-69512611 CTAAAGAAGCAAGTGAATGAAGG - Intronic
933439485 2:82293442-82293464 CTCAAGAAGCAAGATATTGAAGG - Intergenic
933597990 2:84301957-84301979 ATGCTGGAGCATGAGAATGAAGG - Intergenic
934160440 2:89244531-89244553 CATAAGCAGCAGGAGAATGAGGG - Intergenic
934206837 2:89937907-89937929 CATAAGCAGCAGGAGAATGAGGG + Intergenic
935340506 2:102055598-102055620 CTGAGGATGCATGAGAATCCTGG + Intergenic
935807968 2:106767544-106767566 CTGAAGAGGCAAGAGAAACAGGG - Intergenic
936006888 2:108897085-108897107 CTGAAGAGGGATGAGATTGGGGG - Exonic
936668805 2:114631385-114631407 CTGAAGAAACCTGTGAATGAGGG + Intronic
936686900 2:114838103-114838125 CTGAAGGACCATGTGAATAAAGG + Intronic
936961621 2:118081076-118081098 ATGAAGAATCTTGAGAATTAGGG + Intergenic
937095374 2:119232051-119232073 CAGAAACAGCCTGAGAATGAGGG + Intronic
937136126 2:119555047-119555069 CTGAAGCAGCATGGGATTGGGGG + Intronic
937840228 2:126518054-126518076 CAGAACAAGCATGAGAAGGAAGG + Intergenic
938035210 2:128029012-128029034 CTTTAGAAGTTTGAGAATGAAGG - Intergenic
938571788 2:132568197-132568219 CAGATGAAACATGAGAATGCAGG + Intronic
938673500 2:133607000-133607022 CTGTGGGAGCTTGAGAATGAAGG + Intergenic
939129719 2:138220220-138220242 ATGAAGAACCATGAGGTTGATGG + Intergenic
939839287 2:147167963-147167985 TTGAAGAATCAAGAGAATAAGGG - Intergenic
940008197 2:149029265-149029287 CTGAAGAAGCAGAAGAATATAGG - Intergenic
941203109 2:162539035-162539057 CTGAAGAAGCTGAAGACTGAAGG - Intronic
941924675 2:170883371-170883393 CTGAAGAGAAAGGAGAATGAAGG + Intergenic
942038847 2:172037920-172037942 CTGAAGCAGCATGAGAATCCTGG + Intronic
944339628 2:198580812-198580834 TGGAAGAGGCATGAGAATAAAGG + Intergenic
945991133 2:216396221-216396243 CTGAAGCAGAATGAGAGAGAGGG + Intergenic
946875005 2:224120079-224120101 CTGAAGAAGCCTCAAAATCATGG - Intergenic
946916269 2:224525809-224525831 CTGAGGAATTATGATAATGAAGG - Intronic
947059274 2:226144310-226144332 CTGAAGATGCATGATTGTGATGG - Intergenic
947653809 2:231809397-231809419 CTGAAGAAGCCTAAGAGTGCTGG + Intergenic
947852960 2:233303399-233303421 ATGAAGCAGCAGGAGAATGGGGG + Intergenic
1171177707 20:23065997-23066019 CTGAAGAAGAATGAGTCTGAAGG - Intergenic
1171481004 20:25455662-25455684 CTGAAGGAGCAGGTGAGTGATGG - Exonic
1171504506 20:25623035-25623057 CTGATGAAGCATGAAGAGGACGG + Intronic
1171536309 20:25894918-25894940 CTGATGAAACATGGGAAAGACGG + Intergenic
1171773842 20:29347934-29347956 CTGAAGAGGCCTCAGAATCATGG + Intergenic
1171804790 20:29666242-29666264 CTGATGAAACATGGGAAAGATGG - Intergenic
1171815851 20:29785486-29785508 CTGAAGAGGCCTCAGAATCATGG + Intergenic
1171839269 20:30190185-30190207 CTGATGAAACATGGGAAAGATGG + Intergenic
1172130073 20:32649767-32649789 CTGAAGAAGGGTGAGGCTGAGGG - Intergenic
1173743471 20:45419046-45419068 CTGAGGAAGCAGGAAACTGAGGG - Intronic
1174768337 20:53274293-53274315 CTGGAGAAGCATGAAAATAGTGG - Intronic
1174897214 20:54462417-54462439 CTGAAGAGGCCTCAGAATCATGG - Intergenic
1176582757 21:8547350-8547372 CTGACGAAACATGGGAAAGATGG - Intergenic
1177488789 21:21794193-21794215 CTGAGGAACCAAGAGAATGCCGG - Intergenic
1177555480 21:22682457-22682479 CAGAAGAAGAAGGAAAATGAGGG - Intergenic
1177678318 21:24332100-24332122 CTGAACATTCATTAGAATGAAGG + Intergenic
1178733768 21:35130584-35130606 ATGAAAAAGCAAGAGAATTAAGG - Intronic
1178820036 21:35966668-35966690 CTGGGGAAGCAGGAGTATGAGGG + Intronic
1179217522 21:39380469-39380491 CTTACGAAGGATGAGAAGGACGG - Exonic
1179412311 21:41171241-41171263 CTGAATGAGCAACAGAATGAAGG + Intronic
1180265588 22:10524397-10524419 CTGACGAAACATGGGAAAGATGG - Intergenic
1180319302 22:11306049-11306071 CTGAAGAGGCCTCAGAATCATGG + Intergenic
1181508458 22:23377637-23377659 ATGAAGAAGGAAGAGAAAGAAGG + Intergenic
1181886238 22:26024438-26024460 CTGGAGCAGCATGAGCAAGAGGG + Intronic
1182053532 22:27331556-27331578 CAGAAGGAGAATGAGATTGAGGG + Intergenic
1183153570 22:36056454-36056476 CTGGAGTACCATGAGAATCATGG - Intergenic
1183699716 22:39444465-39444487 CAGAAGCAGCAGGAGAATCAGGG + Intergenic
1184223389 22:43114987-43115009 CTGCAAAATCCTGAGAATGAGGG - Intronic
950932406 3:16803606-16803628 CAGAGGAAGCTTGAGGATGAGGG + Intronic
951176343 3:19605287-19605309 GTCATGAAGCATGACAATGATGG - Intergenic
951632440 3:24736584-24736606 CAGATGAAGAATGAGAATCAAGG - Intergenic
951995727 3:28726092-28726114 CAGACAAAGGATGAGAATGAAGG - Intergenic
952083569 3:29790729-29790751 CTCAAAAAGCAAGAAAATGAGGG - Intronic
952486475 3:33816670-33816692 CTGAATAAGCATCAGATTGAGGG + Intronic
952715217 3:36473049-36473071 CTGGAGAAGCCTCAGAATCATGG + Intronic
953017438 3:39091660-39091682 CTGAAGATGCATGAGGTTGGAGG - Exonic
953573783 3:44096322-44096344 CTGCAGAAAGATGAGAATGGAGG - Intergenic
953621673 3:44538121-44538143 ATGAAGAAGCATGAGGAGGGAGG + Intergenic
953917858 3:46932036-46932058 CGACAGAAGCATGAAAATGAGGG + Intronic
954251793 3:49373441-49373463 CTCAAGAAAAATGAGAATGTTGG + Intronic
954553850 3:51503370-51503392 CGGGAGAAGGAGGAGAATGAAGG - Intergenic
954585680 3:51734287-51734309 ATGAACAAGCATCAGAATCAGGG + Intergenic
955809699 3:62774453-62774475 ATTAAAAAGTATGAGAATGATGG - Intronic
956456725 3:69428771-69428793 CTAGAGAAGGATGAGAGTGATGG - Intronic
956677023 3:71744954-71744976 CAGATGAAGTAAGAGAATGAAGG + Intronic
957059104 3:75467250-75467272 CTGAAGAAGCCTTAAAATCATGG + Intergenic
959437499 3:106334719-106334741 CTGAGGGAGCAAGCGAATGAGGG - Intergenic
962120931 3:132559086-132559108 CTGAAAAAGCAAAAGAATCAGGG + Intronic
962419590 3:135216254-135216276 ATGTAGCAGCATCAGAATGAGGG - Intronic
962672957 3:137727561-137727583 CTGATGAGGCATCAGAATCATGG + Intergenic
963556997 3:146804352-146804374 CTCAAGTGGCATGAGAGTGATGG + Intergenic
963613117 3:147497444-147497466 CTGAAAATGCAAAAGAATGAGGG + Intronic
964409702 3:156384887-156384909 GTGAAAAAGCATGGGAAGGAGGG + Intronic
964857588 3:161163459-161163481 CTGAAGAAGGGAGAGAGTGAAGG + Intronic
964963605 3:162460714-162460736 AGGAAGAAGCATGAGAAAAAAGG + Intergenic
965434116 3:168625946-168625968 CTTACTTAGCATGAGAATGAGGG + Intergenic
965829323 3:172766446-172766468 CTGAAGAATGATTAGAAGGAAGG + Intronic
966470374 3:180282389-180282411 CTGAAGAAGCCAGTGATTGAAGG - Intergenic
966604578 3:181809530-181809552 CTGAAGAAATGAGAGAATGATGG - Intergenic
966926129 3:184645713-184645735 CTGAAGGAACACGTGAATGAGGG + Intronic
967254775 3:187578769-187578791 TTGAAGAAGCGAGAGAATAAAGG - Intergenic
968106840 3:196007287-196007309 CTGAAAAAGAAAGAGAAAGAAGG - Intergenic
968460252 4:721191-721213 CTGGGGAACCATGAGAATCAGGG - Intronic
969003012 4:3997435-3997457 CTGAAGAAGCCTCAAAATCATGG + Intergenic
969042207 4:4307904-4307926 CAGAGAAAGCATGAGAAGGATGG - Intronic
969810921 4:9647379-9647401 CTGAAGAAGCCTCAAAATCATGG - Intergenic
970346878 4:15160799-15160821 CTGAGGATGGAGGAGAATGAGGG + Intergenic
970746578 4:19305292-19305314 ATGAACAAGGATGAGAATTAGGG - Intergenic
971600062 4:28581250-28581272 CTGCAGAAGCCTCAGAATCATGG - Intergenic
972230240 4:37063990-37064012 AAGAAGAGGCATGAGACTGATGG + Intergenic
972230408 4:37066000-37066022 CTGAAGAAGAAAGAGCATGGTGG + Intergenic
973197170 4:47458713-47458735 CTGAAGAAGCATGAGAATGAAGG + Intronic
973906344 4:55535691-55535713 CTGTGGAAGCATGGGAAAGAAGG + Intronic
974818162 4:67032899-67032921 AGGAAGAACCATTAGAATGATGG + Intergenic
974920599 4:68234262-68234284 CTGAAGAATGATAGGAATGAGGG - Intronic
976405711 4:84658869-84658891 CAGAAGAAGCAGGAGAATGTGGG - Intergenic
976783334 4:88786832-88786854 GTGAAAAAGAATGCGAATGAGGG + Intronic
977066537 4:92323536-92323558 ATGAAAGAGCAAGAGAATGAGGG - Intronic
978163003 4:105571617-105571639 CTGAAGAGGCATGAGCAGGCAGG - Intronic
979823879 4:125208689-125208711 ATGAAGAAGTATAAGAAAGAGGG + Intergenic
980386684 4:132094048-132094070 CCGAAGAAGCCTGATAATGGAGG + Intergenic
982422182 4:155210427-155210449 GAGAGGAAGCATGAGATTGAAGG - Intronic
982893751 4:160890200-160890222 ATGCAGAAGCAAGAGAAAGAAGG + Intergenic
982905047 4:161057395-161057417 TTGAAGTAGGATGAGAAGGATGG - Intergenic
984200393 4:176713779-176713801 GGGAAGAAGCATAACAATGATGG + Intronic
985323073 4:188735530-188735552 CTGAAGAAGAAAGAAAAGGAAGG - Intergenic
985446985 4:190027896-190027918 CTGAGGAAGGGTGAGAATGGGGG - Intergenic
986345216 5:6828483-6828505 CTGTAGAATGATGAGAATGTAGG + Intergenic
986843614 5:11727188-11727210 CTCAGGTAGCATGAGATTGATGG - Intronic
987012485 5:13781688-13781710 CTGAAGAGGCCTCAGAATCACGG - Intronic
987068931 5:14317650-14317672 GTGAAGAATGATGAGAATGATGG - Intronic
987550079 5:19368348-19368370 CTGAATAAGGACGAGAGTGAAGG - Intergenic
988680725 5:33481266-33481288 ATGAAGAGGAAGGAGAATGAAGG - Intergenic
991051457 5:62277060-62277082 TTGAAAAAGCATACGAATGAAGG - Intergenic
991681037 5:69139666-69139688 CTGAAGTAGAATGACAAGGACGG - Intergenic
991964160 5:72074382-72074404 CTGAATAAGCAAGGGAAGGAAGG - Intergenic
993543931 5:89187536-89187558 ATGAAGAAGAATGAGATAGAGGG - Intergenic
993858592 5:93105633-93105655 CTTATGAAGTATCAGAATGAAGG - Intergenic
994697136 5:103086450-103086472 GTGAAGAAGCAAGATAATGAGGG - Exonic
995070001 5:107909483-107909505 TTGAACAACAATGAGAATGATGG + Intronic
995420097 5:111955000-111955022 ATGAAGATGCATGAGGAAGAAGG + Intronic
995608036 5:113879376-113879398 CAGAAGAAGCAGGAAAATGTGGG + Intergenic
996315754 5:122158876-122158898 GGGAAGAAGCTGGAGAATGAAGG + Intronic
997997419 5:138597732-138597754 CTTCAGAAGAAAGAGAATGAAGG - Intergenic
998233108 5:140374235-140374257 TTGGAGAAGCATGAAGATGAGGG - Intronic
998361190 5:141589191-141589213 AAGAATAAGCATGAGAAAGAAGG + Intronic
998513422 5:142732496-142732518 CTGAAGGAGCAGGAGACTGAGGG - Intergenic
998919196 5:147049163-147049185 GTGAAGAAACATTTGAATGATGG + Intronic
1000179999 5:158799650-158799672 CAGAACAAGCATGAGATTAATGG + Intronic
1000865535 5:166509658-166509680 CTGAAGAAGGACAAGAAAGAGGG + Intergenic
1001735139 5:173991214-173991236 CTGGAAAATCATGAGAATCAAGG - Intronic
1002650914 5:180692982-180693004 CTGAAGACACATGAACATGATGG + Intergenic
1003265651 6:4563155-4563177 CCAAAGAAGCATGAGACAGATGG - Intergenic
1003346833 6:5277109-5277131 CTGAAGAAGAAGCTGAATGAAGG + Intronic
1003418877 6:5938206-5938228 CTGAAGACACCTGAGAAGGAAGG + Intergenic
1003968495 6:11276669-11276691 CTGCAAAAGCATCAGAATCAGGG - Intronic
1005037827 6:21573312-21573334 CTGAAGAAGAAAAACAATGATGG - Intergenic
1005160535 6:22856644-22856666 CTGCGGAAGCATGAAAATCACGG + Intergenic
1005783960 6:29222972-29222994 GTGTAGAAGAAGGAGAATGAAGG - Intergenic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1007335289 6:41151083-41151105 CTGAAGAATCACCAGCATGAAGG + Intronic
1008102036 6:47401979-47402001 CTTAAGAACAACGAGAATGATGG + Intergenic
1008828175 6:55724726-55724748 CCAAAGAAGCATCAGAATTAAGG + Intergenic
1008852296 6:56037349-56037371 CTGAATAACCATGACATTGAAGG - Intergenic
1010364665 6:75035423-75035445 CTGGAAAAGCAGGAGAATGCTGG + Intergenic
1010803229 6:80202301-80202323 CTGAAGATGCAGGAGAGAGATGG - Intronic
1011559915 6:88603801-88603823 CTGCAGAAGCATGATAGGGATGG - Intergenic
1012476788 6:99622292-99622314 CTGAGGAAGCCTCAGAATCATGG - Intergenic
1014139708 6:117927226-117927248 AGGAAGAAGCACAAGAATGAAGG + Intronic
1014691835 6:124571592-124571614 CTGAGGAGGCATCAGAATCATGG - Intronic
1014714465 6:124848402-124848424 CGGAAGAAGCAGGAAAATGTGGG + Intergenic
1014826757 6:126055762-126055784 CTGAGGAAGCATGAAAAAGATGG - Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1017083024 6:150686711-150686733 CGCAAGAAGGATGAGAATGTGGG + Intronic
1019049293 6:169170755-169170777 CTGAAGATGCATGAGGATGAGGG + Intergenic
1020321963 7:6945563-6945585 CTGAAGAAGCCTCAAAATCATGG + Intergenic
1020538544 7:9431159-9431181 TTGAAGAAGGATGATGATGAAGG - Intergenic
1022517280 7:30984048-30984070 CTGAAGAGACAGGAGAATCAGGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023519934 7:41039819-41039841 CTGAGGAAACATGAGCAAGAAGG - Intergenic
1023564700 7:41512378-41512400 CTGAAGAAGAATTTGATTGATGG - Intergenic
1023597741 7:41850187-41850209 GTGAAGAAGTATAAGAATCATGG - Intergenic
1025171670 7:56763829-56763851 ATGAAGAATCATGAGAGAGAGGG + Intergenic
1025287785 7:57681624-57681646 CTGATGAAACATGGGAAAGATGG + Intergenic
1025700195 7:63811719-63811741 ATGAAGAATCATGAGAGAGAGGG - Intergenic
1028215374 7:88125802-88125824 CTGAAGAAGCAGTAGAAAGGGGG + Intronic
1028556239 7:92128345-92128367 CTGAAGAATCATGAGAAGAAAGG - Intronic
1028630764 7:92931480-92931502 CTGTAGAAGCAGCAGAATGGTGG + Intergenic
1031376517 7:121033238-121033260 CTGAAGAAACATGAGGGTGTGGG + Intronic
1031620335 7:123927401-123927423 CTGAAGTAGCATCGGAAGGAGGG + Intronic
1033514336 7:142091322-142091344 CTGAAGAAAGATGAAAATAAGGG + Intronic
1035260700 7:157659586-157659608 CTGAAGATGTATGGGAAAGAAGG - Intronic
1036962299 8:13258219-13258241 CTAAAGAAGAATGTGAAGGAGGG - Intronic
1037005115 8:13768476-13768498 TGAAATAAGCATGAGAATGAAGG + Intergenic
1037025329 8:14028541-14028563 GTGCAGAAGCAAGAGACTGAAGG - Intergenic
1037657824 8:20901545-20901567 CTGAAGAAGCCTCACAATCATGG + Intergenic
1038530636 8:28315739-28315761 GTGAAGAATCATGAGTATGCTGG + Intergenic
1039937276 8:42056612-42056634 CTGAAGATGCATGAGACAGAAGG - Intergenic
1040858412 8:51973937-51973959 CGGAAGGAGCAGGAAAATGACGG - Intergenic
1042324567 8:67515379-67515401 CTGAAGAGGCTAGAGAATGTAGG - Intronic
1042559687 8:70064060-70064082 CAGAACAAGCAACAGAATGAGGG + Intronic
1043005922 8:74818528-74818550 CTGAAGAAGAATAAGCATGAAGG - Intronic
1043425591 8:80145426-80145448 CTGAAGAAGCTAGACTATGAAGG + Intronic
1046096689 8:109570953-109570975 CTAAAGAAGCAGGAGAGGGAGGG + Intergenic
1046138606 8:110061897-110061919 CTGAAGAAGGGAGGGAATGAGGG + Intergenic
1046796960 8:118383990-118384012 CTGAAGAAAAAGCAGAATGAAGG + Intronic
1046851971 8:118984827-118984849 CTGAAGAAGCCTCATAATCATGG + Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1049309366 8:141925161-141925183 CTCAGAATGCATGAGAATGAAGG - Intergenic
1050708970 9:8438039-8438061 CTGAAGCAGGAAAAGAATGAGGG + Intronic
1050734470 9:8747628-8747650 CAGAAGAAGAAATAGAATGAAGG + Intronic
1050853574 9:10321095-10321117 CTAAAGCTGCATGAGAATGGAGG - Intronic
1052082248 9:24221466-24221488 ATATAGAAGCATGAGAATGAGGG - Intergenic
1052629980 9:31025349-31025371 TTGAAGAAGAATGAGGTTGAGGG + Intergenic
1052681148 9:31694685-31694707 CTGAAGAAGAAGGAAAGTGAAGG - Intergenic
1052917281 9:33933140-33933162 CTGAGGTGGAATGAGAATGATGG - Intronic
1054864249 9:69983669-69983691 CTGAAGGAGCAAGAGAAAGAAGG - Intergenic
1055851528 9:80636579-80636601 TTGGAATAGCATGAGAATGAGGG - Intergenic
1056498057 9:87179705-87179727 CTGAAAATGCATGAACATGAAGG + Intergenic
1058989205 9:110238923-110238945 CAGAAGAAGCATGAGCTTAATGG - Intergenic
1058989732 9:110243231-110243253 CTGAGTAAGCAGGAAAATGATGG - Intergenic
1059805613 9:117797034-117797056 ATGAGGAAGCATGATCATGATGG + Intergenic
1059970248 9:119659939-119659961 TTGAAGAATGATGAGAATGTTGG + Intergenic
1060202708 9:121661054-121661076 GTGAAGAAGCGGGAGGATGAGGG + Intronic
1060257546 9:122045958-122045980 CTGGAGATGCATGACAGTGATGG + Intronic
1062415043 9:136444386-136444408 CTGATCAAGCATGAGAACGTTGG - Intronic
1203367532 Un_KI270442v1:271800-271822 CTGAAGAGGCCTCAGAATCATGG + Intergenic
1186093553 X:6075703-6075725 GAGAAGAAGCAAGAGAATGGGGG - Intronic
1186327330 X:8494034-8494056 CTGACAAAGCATCAGAAGGAGGG - Intergenic
1186607748 X:11109715-11109737 CGGAATAATTATGAGAATGAAGG + Intergenic
1187782098 X:22838537-22838559 CTGAAGAAGTTAGACAATGACGG + Intergenic
1188323480 X:28770355-28770377 CTGATGAAGCTTGAGCTTGAGGG - Intronic
1188883342 X:35518046-35518068 CAGAAGAAGAATTAGACTGAGGG + Intergenic
1189539161 X:41968129-41968151 CAGAAGCAGCATCAAAATGAGGG + Intergenic
1190476821 X:50836462-50836484 ATGAAGAAGTATAAGAATGCAGG - Intergenic
1191887489 X:65903715-65903737 CTGAGGAAACTTGGGAATGATGG - Intergenic
1191969580 X:66798638-66798660 ATGAAGAAAAATGAGAATGAAGG - Intergenic
1193055445 X:77144549-77144571 CGGAGGAAGAATGAGATTGATGG + Intergenic
1194297542 X:92144547-92144569 CTGGAGAAGCCTCAGAATCATGG - Intronic
1194980200 X:100432715-100432737 CTGAATAAAGATGGGAATGAGGG - Intergenic
1195009058 X:100717404-100717426 CTGGATAAGCAGGAGAACGAGGG + Intronic
1195390620 X:104358364-104358386 CTGAAAAATTATGAGGATGAGGG + Intergenic
1195934469 X:110111758-110111780 TTGTAGAAGCATGAGAATGAAGG + Intronic
1196987902 X:121294985-121295007 GTGTAGAAGCATGAGAATTAAGG + Intergenic
1197478576 X:126953251-126953273 CTGAAAAAACTTGAGAATGTTGG - Intergenic
1198723670 X:139653219-139653241 TGGAAGAAGGGTGAGAATGAGGG + Intronic
1200575528 Y:4884501-4884523 CTGAGGAAGCCTCATAATGATGG - Intergenic
1200615115 Y:5369448-5369470 CTGGAGAAGCCTCAGAATCATGG - Intronic
1200825757 Y:7638698-7638720 CTGAAAAGGCAGGAGAGTGATGG - Intergenic
1201434675 Y:13944044-13944066 CTGACAAAGCATCAGAAGGAAGG + Intergenic
1201504636 Y:14684512-14684534 GAGAAGAAGCAAGAGAATGGGGG + Intronic
1202058406 Y:20860033-20860055 CTGAAGAAGTATGAGACCCAGGG + Intergenic
1202234298 Y:22692390-22692412 CTGAAAAGGCAGGAGAGTGATGG + Intergenic
1202308861 Y:23503776-23503798 CTGAAAAGGCAGGAGAGTGATGG - Intergenic
1202561940 Y:26166812-26166834 CTGAAAAGGCAGGAGAGTGATGG + Intergenic