ID: 973199593

View in Genome Browser
Species Human (GRCh38)
Location 4:47485215-47485237
Sequence CTACGTCACGGAGGGCGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973199583_973199593 -7 Left 973199583 4:47485199-47485221 CCAGGCCCTGCCGCTGCTACGTC 0: 1
1: 0
2: 0
3: 21
4: 232
Right 973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG 0: 1
1: 0
2: 1
3: 2
4: 77
973199582_973199593 4 Left 973199582 4:47485188-47485210 CCGGTCAGTTGCCAGGCCCTGCC 0: 1
1: 1
2: 3
3: 24
4: 322
Right 973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG 0: 1
1: 0
2: 1
3: 2
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973199593 Original CRISPR CTACGTCACGGAGGGCGGGG CGG Intergenic
900226831 1:1536915-1536937 CTACGTCACCGAGGGGAAGGTGG - Intronic
900749035 1:4382381-4382403 CCACTTCATGGAGGGAGGGGAGG + Intergenic
903330084 1:22592832-22592854 CGCCGTCAAGGAGGGAGGGGTGG + Intronic
908342210 1:63193150-63193172 CCAGGTCACAGAGGGCTGGGCGG + Intergenic
915333846 1:155129394-155129416 CGGCGTCAGGGAAGGCGGGGAGG - Intronic
1071379850 10:85047563-85047585 ATACTTCACAGGGGGCGGGGTGG + Intergenic
1077062646 11:624640-624662 CCACGTCCCGGAGGGCCAGGAGG - Exonic
1077318002 11:1927824-1927846 CTAAGTCAGGGAGGCCAGGGCGG + Intronic
1081938135 11:46918590-46918612 CTGCGGCGCGGGGGGCGGGGCGG - Exonic
1084304375 11:68272001-68272023 TGACGTCACGGAGGGCGGGGCGG + Intronic
1084692115 11:70733689-70733711 CTAGGTCATGGAGAGGGGGGTGG + Intronic
1085312832 11:75526140-75526162 CTACCTCGGAGAGGGCGGGGCGG + Intergenic
1085514802 11:77105904-77105926 CCAGGTCACAGAGGGCGTGGAGG + Intronic
1090480945 11:127067541-127067563 CTAAGACACAGAGGGAGGGGTGG - Intergenic
1096544423 12:52327969-52327991 GTACAGCACGGAGGGTGGGGTGG - Intergenic
1106452425 13:29895052-29895074 CTACTTGGCGGGGGGCGGGGGGG + Intergenic
1107022529 13:35766208-35766230 CTACGTGACAGATGGTGGGGAGG + Intergenic
1114645650 14:24254717-24254739 CCACGTCAAGGAGAGCGGGCAGG - Exonic
1118976091 14:70677734-70677756 CTAAGACACGGAGGAGGGGGAGG + Intergenic
1124129541 15:26971692-26971714 CTGCGGCACGGCGGGCCGGGAGG + Intronic
1125079445 15:35656699-35656721 CTACGTCTGGGAGGGAGGTGGGG + Intergenic
1125674759 15:41495973-41495995 CGACGGCTCGGAGGGCGGCGGGG - Intronic
1132812763 16:1809488-1809510 AGAGGACACGGAGGGCGGGGAGG + Intronic
1134238656 16:12487555-12487577 CTTCTCCACGGAGGGCTGGGTGG - Intronic
1139657556 16:68398033-68398055 CTTCGTCAGGGAGGGAGGGAGGG + Intronic
1142623750 17:1179981-1180003 CAACTTCGCGGGGGGCGGGGCGG + Intronic
1142859106 17:2749974-2749996 CTACGCCAGGGCGGGAGGGGCGG - Intergenic
1145884160 17:28371358-28371380 CGATGTCACGTGGGGCGGGGAGG + Intronic
1146416238 17:32635684-32635706 CTCCGTCTCGGGTGGCGGGGGGG + Intronic
1148495120 17:48048723-48048745 CATCGGGACGGAGGGCGGGGTGG + Intronic
1148842510 17:50508243-50508265 CTAGGCCACGGGGGGCGGGTGGG - Intergenic
1150108507 17:62478895-62478917 GTGCGGCGCGGAGGGCGGGGGGG - Intronic
1151606759 17:75142551-75142573 CTCCGTCAAGGGGGGAGGGGAGG + Intronic
1167648808 19:50719050-50719072 GTACGCCAGGGAGGGCGAGGCGG + Intronic
1168240708 19:55087512-55087534 CTTTGTCCTGGAGGGCGGGGTGG - Exonic
1168341229 19:55624289-55624311 CTATGTCATGGTGGGCGGGGTGG - Intronic
927706623 2:25300166-25300188 CCACGGCACGGAAGGTGGGGCGG - Exonic
933751170 2:85602740-85602762 CCACGTCCCGGCGGGCGGCGCGG - Intronic
934304580 2:91810366-91810388 CCGCGGCACGGTGGGCGGGGGGG - Intergenic
934328677 2:92042384-92042406 CCGCGGCACGGTGGGCGGGGGGG + Intergenic
938238142 2:129722869-129722891 CTGCGCCAGGCAGGGCGGGGAGG + Intergenic
938555013 2:132416427-132416449 CTGGGTGACGGAGGGTGGGGCGG + Intergenic
948205605 2:236161270-236161292 CAAAGCCACGGAGGGCAGGGCGG + Intergenic
1171951927 20:31427778-31427800 CTCCGTCAGGGAGGGAGGTGGGG + Intergenic
1174364560 20:50048626-50048648 CTGCGTCACTGAGAGCTGGGAGG + Intergenic
1175562279 20:59940340-59940362 CGGCGTCACGAGGGGCGGGGCGG - Intronic
1176072760 20:63235537-63235559 CTGCGTCACGCAGAGCAGGGAGG - Intergenic
1176084022 20:63287786-63287808 CGACGGCGGGGAGGGCGGGGAGG + Exonic
1183298340 22:37045361-37045383 CTAGGTCACAGAGGGGTGGGGGG + Intergenic
1185313725 22:50170183-50170205 CTGCGTGGCGGGGGGCGGGGTGG + Intergenic
951056348 3:18150394-18150416 CTATGTCACAGAGAGCAGGGTGG + Intronic
953411637 3:42693563-42693585 CTGGGTCATAGAGGGCGGGGGGG - Intronic
954444810 3:50540908-50540930 CTGCGTCAGGGAGGGTGGGGTGG - Intergenic
961163654 3:124750027-124750049 CCCCGTCCCGGAGGGAGGGGGGG - Intergenic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
969330596 4:6471896-6471918 CTGCCTCCCGGAGGGCGGCGCGG + Intronic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
977587027 4:98785313-98785335 CTAAGTCACAAAGGGCAGGGAGG - Intergenic
980988415 4:139717746-139717768 CTAGGACACGGAGGGAGGAGGGG + Exonic
985781112 5:1872342-1872364 CCAGGCCACGGGGGGCGGGGGGG - Intergenic
996913135 5:128678866-128678888 CTAAGTCACAGGGGGCAGGGTGG - Intronic
1006485782 6:34340403-34340425 CTCCATCATGGAGGGAGGGGAGG - Intronic
1018869320 6:167769154-167769176 CTAAGCCACGCAGGGCTGGGAGG + Intergenic
1019477935 7:1252914-1252936 CCACGTAGAGGAGGGCGGGGCGG + Intergenic
1024063262 7:45714252-45714274 CTACGCCACGGAGGGAAGGATGG - Exonic
1024472158 7:49775407-49775429 CCACGTCCCGGCGGGCGGGCGGG - Exonic
1029068041 7:97872175-97872197 CTGCGGTAGGGAGGGCGGGGCGG - Intronic
1029539498 7:101174307-101174329 CTATGTCAGTGAGGGTGGGGTGG - Intronic
1034560699 7:151877611-151877633 CTACGGCAGGGCGGGCGCGGGGG - Intergenic
1036813519 8:11884609-11884631 CTGTGTCAGGGAGGGTGGGGAGG + Intergenic
1038444959 8:27596816-27596838 CTCTGTCTCGGGGGGCGGGGGGG + Intergenic
1038786150 8:30618276-30618298 CTCTGTCTCGGGGGGCGGGGGGG + Intronic
1041358267 8:57022533-57022555 CTCCGTCAGGGAGGGAGGTGGGG + Intergenic
1045068931 8:98479478-98479500 CTCCGTCTCGGGGGGGGGGGGGG + Intronic
1047703457 8:127473382-127473404 CTACTTGTCGGAGGGTGGGGAGG - Intergenic
1047724236 8:127670424-127670446 CCACGTCACGTAGGGCCTGGTGG - Intergenic
1051287391 9:15510770-15510792 CGACGCCACCGAGGGGGGGGCGG + Intronic
1059340880 9:113597013-113597035 CTCCGTCACAGGGGGCAGGGAGG - Exonic
1060214636 9:121731446-121731468 CTACTTCAAGGAGGGCAGAGGGG - Intronic
1061526677 9:131170985-131171007 CTACATGACTGAGGGCAGGGAGG - Intronic
1189763234 X:44343694-44343716 CGGCGTCACGGAGGGAGGAGGGG + Intergenic