ID: 973199593

View in Genome Browser
Species Human (GRCh38)
Location 4:47485215-47485237
Sequence CTACGTCACGGAGGGCGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973199583_973199593 -7 Left 973199583 4:47485199-47485221 CCAGGCCCTGCCGCTGCTACGTC 0: 1
1: 0
2: 0
3: 21
4: 232
Right 973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG 0: 1
1: 0
2: 1
3: 2
4: 77
973199582_973199593 4 Left 973199582 4:47485188-47485210 CCGGTCAGTTGCCAGGCCCTGCC 0: 1
1: 1
2: 3
3: 24
4: 322
Right 973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG 0: 1
1: 0
2: 1
3: 2
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973199593 Original CRISPR CTACGTCACGGAGGGCGGGG CGG Intergenic