ID: 973199593 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:47485215-47485237 |
Sequence | CTACGTCACGGAGGGCGGGG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 81 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 2, 4: 77} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
973199583_973199593 | -7 | Left | 973199583 | 4:47485199-47485221 | CCAGGCCCTGCCGCTGCTACGTC | 0: 1 1: 0 2: 0 3: 21 4: 232 |
||
Right | 973199593 | 4:47485215-47485237 | CTACGTCACGGAGGGCGGGGCGG | 0: 1 1: 0 2: 1 3: 2 4: 77 |
||||
973199582_973199593 | 4 | Left | 973199582 | 4:47485188-47485210 | CCGGTCAGTTGCCAGGCCCTGCC | 0: 1 1: 1 2: 3 3: 24 4: 322 |
||
Right | 973199593 | 4:47485215-47485237 | CTACGTCACGGAGGGCGGGGCGG | 0: 1 1: 0 2: 1 3: 2 4: 77 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
973199593 | Original CRISPR | CTACGTCACGGAGGGCGGGG CGG | Intergenic | ||