ID: 973200628

View in Genome Browser
Species Human (GRCh38)
Location 4:47497571-47497593
Sequence AAGCTAAGACTTCTACAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973200628_973200629 15 Left 973200628 4:47497571-47497593 CCTATCTGTAGAAGTCTTAGCTT 0: 1
1: 0
2: 1
3: 5
4: 114
Right 973200629 4:47497609-47497631 CATACTAGTATATAAAATTCTGG 0: 1
1: 0
2: 6
3: 24
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973200628 Original CRISPR AAGCTAAGACTTCTACAGAT AGG (reversed) Intronic
903832707 1:26184217-26184239 AGGCAAAGACGTCTTCAGATGGG - Exonic
909611711 1:77557796-77557818 AAGCTAAGACTTCTCTAAAAAGG - Intronic
910500483 1:87884476-87884498 AAGCTAAAACTTCTTCCCATGGG + Intergenic
910511309 1:88008622-88008644 AAGCTAAGTCTTCTACTTAAGGG + Intergenic
912083461 1:105969215-105969237 GAACTAAGACATCTTCAGATTGG + Intergenic
912537706 1:110387976-110387998 TATCTAAGAATTCTACAAATAGG - Intronic
913128210 1:115812913-115812935 AAGATAAGATTTCTCGAGATCGG - Intergenic
915749209 1:158189049-158189071 AAGGTTAGAATTCTACGGATTGG + Intergenic
918092828 1:181312116-181312138 AAACTCTGACTTCAACAGATGGG - Intergenic
918339632 1:183557632-183557654 CAACTTAGACTTGTACAGATAGG + Intronic
918685677 1:187411823-187411845 AACCAAAGAGTTCTACACATTGG - Intergenic
919988619 1:202693169-202693191 AAGCCATGGCTTCTCCAGATGGG - Intronic
1068436161 10:56993766-56993788 AAGCTAAGTCTTTTAGAGAAAGG - Intergenic
1070359365 10:75672438-75672460 GAGCTAAGGTTTCTACAGAAAGG - Intronic
1070410181 10:76132610-76132632 AAGCAAAGATTTCTGCAGACTGG + Intronic
1075339455 10:121633767-121633789 AAGCTAAAACTTCTGCACAAAGG + Intergenic
1077713402 11:4557938-4557960 GAGCCAAGACTTCCAGAGATGGG - Intergenic
1080085837 11:28280790-28280812 AAATTAAGAATTCTATAGATGGG - Intronic
1085203106 11:74713560-74713582 AAGTTCAGACTTCTGCAGTTGGG - Intronic
1087353220 11:97060126-97060148 GAGCAAGGACTTCTACAGCTAGG + Intergenic
1088087268 11:105996396-105996418 AAGCTAAGAGAGGTACAGATGGG - Intronic
1093244506 12:16719886-16719908 ATGCTAAGATTTCTTCAGAGAGG + Intergenic
1095287985 12:40439117-40439139 AGGCTATGATTTCTACAGTTTGG + Intronic
1100770633 12:97918525-97918547 AAGAAAAGACATCTACAGAATGG - Intergenic
1101017196 12:100513924-100513946 AAAATAAAACTTCTACAGTTAGG + Intronic
1101368955 12:104107258-104107280 CAGGAAAGACTTCTTCAGATTGG - Intergenic
1101375566 12:104168419-104168441 AAGATAATTCTTCCACAGATGGG - Intergenic
1106454276 13:29913028-29913050 ATGCTCAGACTCCTGCAGATGGG - Intergenic
1109478473 13:62916199-62916221 ATGCTAAGAGGTCAACAGATAGG - Intergenic
1109955040 13:69554662-69554684 AAGCAAAGATTTTTTCAGATTGG - Intergenic
1110200956 13:72850204-72850226 AAGCTAAGGCTTCTACCAAGAGG - Intronic
1110329627 13:74256590-74256612 AAGCTAGCACTTCAACACATTGG + Intergenic
1113404485 13:110025525-110025547 AAAGTAAGACATCTGCAGATAGG + Intergenic
1118709031 14:68504595-68504617 AAGCTCAGACAGCTAGAGATGGG + Intronic
1119547598 14:75483609-75483631 CATCTAAGACTTCATCAGATTGG + Intergenic
1121964644 14:98292663-98292685 AAGCTAACACTTTTACATATGGG - Intergenic
1126905490 15:53360084-53360106 AAGCCCAGAGTTCTACAGAAAGG - Intergenic
1127019432 15:54729483-54729505 AACTTAAGACTTCTATAGAGGGG + Intergenic
1128668781 15:69558686-69558708 TAGCTAAGACTTCTCCTTATAGG + Intergenic
1128778282 15:70340675-70340697 AAACTATGACTTGTACAGAAAGG + Intergenic
1130586015 15:85183107-85183129 AAGCCCAGTCTTATACAGATAGG + Intergenic
1135701003 16:24632391-24632413 AATCAAAGACTTCTAGAGTTTGG - Intergenic
1139656938 16:68393823-68393845 AAGCAAAGTCTTCTAAAAATTGG - Intronic
1143161253 17:4872917-4872939 AAGGTTAGACTTCTCCAGAAAGG + Intronic
1147600489 17:41742199-41742221 AAGCTGAGACCTCTACACACGGG - Intergenic
1149027637 17:52048150-52048172 AAGTTAAGACTTTTGCAGATAGG - Intronic
1152666488 17:81572934-81572956 AAGTTGAGACTTTGACAGATTGG - Intronic
1153736464 18:8074186-8074208 TTGCTAAGACTACCACAGATTGG - Intronic
1156078109 18:33305086-33305108 AAGCTAATCCTTCAACAGATGGG - Intronic
1157655258 18:49380690-49380712 AAGCTAAGAATTCATCAGAAGGG + Intronic
1160899116 19:1418226-1418248 AATCTACGACTTCTCCATATTGG - Exonic
928158510 2:28898912-28898934 AAGCAAGGAGTTGTACAGATGGG - Intronic
931139027 2:59436674-59436696 ACCCTAAGACTTCTACTGGTTGG + Intergenic
932323060 2:70835933-70835955 AAGCTCAGACTTCTGAGGATGGG - Intergenic
934885840 2:98023514-98023536 AAGATAACTTTTCTACAGATGGG - Intergenic
935615783 2:105080171-105080193 AAAATAAGACTTCTAGAGGTAGG + Intronic
936033699 2:109092370-109092392 AAGCTCAAACTTCTTCTGATTGG - Intergenic
937812632 2:126216106-126216128 AAGATAAAACTTCTAGAAATAGG - Intergenic
939292817 2:140217482-140217504 AAGCTAAGCCCTCACCAGATTGG - Intergenic
941749443 2:169119530-169119552 AAGCAATGAATTCTACAGCTGGG + Intergenic
942517678 2:176770877-176770899 AAGCTAATAGTTGTAGAGATGGG + Intergenic
942747890 2:179256509-179256531 AAGATAAAACTTTAACAGATGGG + Intronic
946219347 2:218213214-218213236 ATCCTAAGGCTTCCACAGATGGG + Intergenic
1174715712 20:52756014-52756036 ATGCTAAGACTTCTTCATGTTGG - Intergenic
1178056526 21:28805268-28805290 AAGCTAGAACTGCTATAGATGGG - Intergenic
1182825056 22:33257865-33257887 AGGCTGTGACTTCTACATATGGG - Intronic
949775287 3:7625813-7625835 AAGGTAGGACTTCTAAAGAGAGG + Intronic
950673736 3:14541953-14541975 AAGCTAAGACTGCTCCAGAGTGG - Exonic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
951985042 3:28610011-28610033 AACCTAAGACTGCTACTTATTGG - Intergenic
952892040 3:38049778-38049800 AAGATAAGACTTCTATACAAAGG - Intronic
964715363 3:159715308-159715330 AAGCTGAAACTTCTAAAAATCGG + Intronic
964999075 3:162928593-162928615 AAGGAATGACATCTACAGATTGG - Intergenic
965491714 3:169345321-169345343 AACCTAAGACTTCCAGGGATAGG + Intronic
965544378 3:169900425-169900447 GAGAAAAGACTTCTACAGAGAGG + Intergenic
966294369 3:178401911-178401933 AAGGCAAGACTTCTTCATATGGG + Intergenic
971120488 4:23699051-23699073 TAGCAAAGACTTCAACAGAAAGG - Intergenic
973200628 4:47497571-47497593 AAGCTAAGACTTCTACAGATAGG - Intronic
973830031 4:54749742-54749764 AAACACATACTTCTACAGATTGG + Intergenic
975320194 4:73001426-73001448 CAGCTAAGGCTCCTACATATGGG + Intergenic
975793367 4:77980596-77980618 TTGCTAAGTCTGCTACAGATAGG - Intergenic
975865756 4:78722183-78722205 AACCTGAGATTTCTCCAGATTGG + Intergenic
977061836 4:92269243-92269265 ATGCTAAAAATTCAACAGATGGG - Intergenic
979720397 4:123893421-123893443 AGACAAAGACTTCAACAGATAGG + Intergenic
980412318 4:132438022-132438044 AATATGTGACTTCTACAGATTGG - Intronic
982833995 4:160099565-160099587 AAACTAAGACTTCTAGAGCAAGG - Intergenic
983909668 4:173223830-173223852 AAGCCAAGACTTATACAGATAGG - Intronic
986294425 5:6425393-6425415 AAGCTACAACTTGTAAAGATGGG + Intergenic
987303891 5:16620075-16620097 AAGCTAAGACTTAGAATGATGGG + Intergenic
988700370 5:33667662-33667684 AACCAAACACTTCTAAAGATAGG + Intronic
993747270 5:91615966-91615988 AAGCTCAGAATGCTACAGAAAGG - Intergenic
994957096 5:106546050-106546072 AAGCTGAGACTGCTGCAGAGTGG + Intergenic
995945553 5:117640786-117640808 AAGGTAAGACTTTTAAAGGTTGG - Intergenic
1000039933 5:157478017-157478039 AGGCTAAGGCTTCTAGAGACAGG + Exonic
1000282491 5:159794168-159794190 GGGTTAAGACTTCAACAGATGGG - Intergenic
1000441260 5:161266030-161266052 GTGCTAAGACTTCTATAGCTTGG + Intergenic
1000587237 5:163115370-163115392 AACCTAAGACTGCTACCCATTGG - Intergenic
1002515244 5:179753071-179753093 GAGATAAGAGTTCCACAGATGGG - Intronic
1003008908 6:2408348-2408370 TAGTTAAGACTTCTCAAGATAGG + Intergenic
1004360663 6:14967956-14967978 ATGCAAAGACTTCCACAGAAGGG + Intergenic
1010650561 6:78449699-78449721 AAGCTAAGACATATAGAGAACGG - Intergenic
1013418660 6:109946941-109946963 GAGTAAAGACATCTACAGATTGG + Intergenic
1019199630 6:170303994-170304016 AAGCTAGGACTTATACAGTAGGG - Intronic
1022199172 7:28099405-28099427 AAGTTAAAACTTCTACACTTTGG + Intronic
1024453008 7:49570336-49570358 AAGCAAAGAATTCTAGACATGGG + Intergenic
1026404938 7:70055493-70055515 AAGCAAGGACTCTTACAGATGGG - Intronic
1029320323 7:99753089-99753111 AAGGTAAGACTTTAACAGAAGGG - Intergenic
1031557586 7:123197393-123197415 AAGCATAGACTTCTTCAGTTTGG + Intronic
1045676556 8:104614342-104614364 AAGATAAGTTTTCCACAGATTGG + Intronic
1046201598 8:110934791-110934813 AAGCTAAGCCCTCTCTAGATTGG - Intergenic
1049073232 8:140373157-140373179 AAGCTAAGACTCCTACCCCTGGG + Intronic
1050411907 9:5374927-5374949 AATCTAAGATTTCTACAGAAAGG + Intronic
1051096261 9:13469086-13469108 AAGATAAGAGTGGTACAGATGGG + Intergenic
1052907840 9:33852465-33852487 TGGCTAAGACTTCCACACATTGG + Intronic
1058791288 9:108448448-108448470 AGGCTAACACTTCTAAAGTTTGG - Intergenic
1059754863 9:117283124-117283146 AAGCTTAGACTTCCACATACCGG - Intronic
1061015530 9:127979246-127979268 AGCCTTGGACTTCTACAGATGGG - Intronic
1061907379 9:133705560-133705582 AAGGTGATAATTCTACAGATGGG - Intronic
1189059120 X:37733769-37733791 AAGGAAAAACATCTACAGATTGG - Intronic
1194755470 X:97733868-97733890 ACACTAAAACTTCTACAGACAGG + Intergenic
1197448924 X:126587032-126587054 AAGCTTAGATTTCTCCAAATAGG - Intergenic