ID: 973203655

View in Genome Browser
Species Human (GRCh38)
Location 4:47534460-47534482
Sequence CAGACTGAAATGCCTAATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973203650_973203655 -4 Left 973203650 4:47534441-47534463 CCTCTGAAGCCACAGACCCCAGA 0: 1
1: 0
2: 7
3: 43
4: 388
Right 973203655 4:47534460-47534482 CAGACTGAAATGCCTAATAGAGG 0: 1
1: 0
2: 0
3: 6
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973203655 Original CRISPR CAGACTGAAATGCCTAATAG AGG Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
909341068 1:74531641-74531663 CTTGCTGAAATGCCTAATAAAGG - Intronic
910693330 1:89986584-89986606 CGGACTTAAATGGCCAATAGAGG + Intergenic
916674034 1:167051346-167051368 CTGTCTGAAGTGCCTAATAAGGG + Intergenic
918034049 1:180848667-180848689 TGGACTGAAATGCCAAGTAGTGG + Intronic
918087861 1:181260755-181260777 CATCCTGAAAAGCCTCATAGAGG + Intergenic
919416773 1:197320342-197320364 CACACTGAATAGCCTAATAAAGG - Intronic
920335738 1:205244012-205244034 CAGAGTGAAATGCATAGAAGGGG + Intronic
920878190 1:209856633-209856655 CAGTCAGGAATGGCTAATAGAGG - Exonic
1064299991 10:14114806-14114828 CAGGCTGAGATGCCTACCAGCGG - Intronic
1068464008 10:57364035-57364057 CATATTCAAATGACTAATAGAGG + Intergenic
1070681493 10:78452215-78452237 CAAACTGAAATGACTAGTGGTGG + Intergenic
1071626765 10:87179699-87179721 CATAGTGAAAAGCCAAATAGGGG - Intronic
1075633527 10:124015591-124015613 CCAACTGAAATCCCTAGTAGGGG - Intronic
1076382511 10:130035104-130035126 CAGCCTGAGCTGCCTAATACAGG - Intergenic
1078545905 11:12246796-12246818 CAGCCTGAAATGCCTAACAATGG - Intronic
1079146734 11:17858877-17858899 CAGACTGGAATCCCTGATAGAGG + Intronic
1079544177 11:21612779-21612801 CAGGTTGAAATAACTAATAGAGG + Intergenic
1085979455 11:81706053-81706075 CAGACTGAACAGTCTAATACAGG - Intergenic
1087611216 11:100436020-100436042 GAGACTGAAATACCGATTAGAGG - Intergenic
1088923605 11:114279836-114279858 CAGAAAGAAATGCCTAATTTGGG + Intronic
1090420098 11:126568766-126568788 CAGAATGAAGTACCTAATAAGGG + Intronic
1091019820 11:132088833-132088855 CAGAGTTAAATTCCTGATAGAGG - Intronic
1092919155 12:13215167-13215189 CAGTCTGAAGTGCCTACTGGGGG + Exonic
1099972569 12:89515223-89515245 CAGACAGAAATCTCTAATTGGGG + Intronic
1100004344 12:89876104-89876126 CATTCTGAAATGCCTACTAGTGG - Intergenic
1111523386 13:89434548-89434570 CAGACTAAGATGCCTAACGGAGG - Intergenic
1115748705 14:36465837-36465859 CAGATTGAAATGGATATTAGCGG - Intergenic
1117437332 14:55729118-55729140 CAGAATGAAATTTCTAAAAGGGG + Intergenic
1118180162 14:63484265-63484287 CAGACTAAAAAGCCTGAGAGGGG + Intronic
1118940807 14:70335230-70335252 CAGACTGCAATACATAATATTGG + Intronic
1127517917 15:59714201-59714223 CAGAGTGAAATGACTAAGGGAGG - Intergenic
1129171583 15:73811355-73811377 GGGACTGAAATGCCAAAGAGAGG + Intergenic
1130318826 15:82822340-82822362 CACAGTGAAATGAATAATAGTGG + Intronic
1138316600 16:56075743-56075765 CAGAATGAAATGCCTAGTGATGG - Intergenic
1142930035 17:3276505-3276527 CAGAATGTTATACCTAATAGTGG - Intergenic
1150242009 17:63641963-63641985 CAGTGTGAAATGCCTCAGAGAGG + Intronic
1151087835 17:71401295-71401317 GAGACAGAAATACTTAATAGAGG - Intergenic
1152292449 17:79447845-79447867 CAAACTGTAATCCCTAATATTGG + Intronic
1153275021 18:3359945-3359967 CAGTCTGACATGCCTAAGTGGGG - Intergenic
1155835118 18:30572149-30572171 CAGACAGCAATGTCTAAAAGTGG + Intergenic
1157971712 18:52277365-52277387 CAGAGTGAAATTCATAAAAGAGG - Intergenic
1159594959 18:70374051-70374073 GTGTCTGAAATGCCTAGTAGAGG + Intergenic
925877775 2:8327547-8327569 CAGGGTGAAATGCCTCAGAGGGG - Intergenic
928666553 2:33555656-33555678 AAGACTGAAATTCCGAATAATGG - Intronic
929060814 2:37923087-37923109 TAGACTGACATTCCTAGTAGTGG + Intergenic
931651121 2:64469845-64469867 CAGATTCAAATGCCTACAAGGGG + Intergenic
937524948 2:122757069-122757091 CAGCCTGAACTGACTAAGAGAGG + Intergenic
937650629 2:124315260-124315282 CAGACAGAAAGGCGTATTAGGGG - Intronic
943354915 2:186841608-186841630 TAGAAATAAATGCCTAATAGTGG + Intronic
947687652 2:232104164-232104186 CAGACTGAAGTTCATGATAGAGG + Intronic
1169775475 20:9247798-9247820 CAGAGTGCAATGCCCAAGAGTGG - Intronic
1170342265 20:15342462-15342484 CAGACTCAAATTCCTACTACAGG - Intronic
1172204039 20:33149474-33149496 CATGCTCAAATGCCTATTAGGGG + Intergenic
1173779184 20:45739948-45739970 AAGTATGAAATGCATAATAGAGG - Intergenic
1174207603 20:48852120-48852142 CAAACTCAAATGCCTGAAAGGGG - Intergenic
1182867089 22:33613265-33613287 CAGACTGCAGTTCCTGATAGTGG + Intronic
1182868466 22:33625517-33625539 CAGTCAGAAATGCCCAAAAGTGG + Intronic
1183300144 22:37054889-37054911 CAGCCTGAAATGGCTAAGATGGG - Intronic
951893198 3:27585950-27585972 CAGACTGAAATGTAGAATATAGG - Intergenic
956827749 3:73014597-73014619 CAGATTTAAAAGCCTAATAATGG - Intronic
957505614 3:81116576-81116598 CACAGAGAAATCCCTAATAGAGG - Intergenic
959163306 3:102744587-102744609 CAGACTGAATTGCTGAAAAGGGG + Intergenic
962883527 3:139601435-139601457 AAGACTCAAATGACTAATATAGG + Intronic
963126264 3:141819848-141819870 CATACTGATATGTCTGATAGGGG + Intergenic
967786746 3:193505312-193505334 CAGACTGTAATGCCTAAAGAGGG + Intronic
968416834 4:444930-444952 CAGACTGAAGTGCTGAATACAGG + Intronic
968421848 4:491539-491561 CAGACTGAAATGTTAAATACAGG + Intronic
970148559 4:13065518-13065540 CAGTCTGTAATGACTAAAAGAGG - Intergenic
971439216 4:26661642-26661664 GAACCTGAAATGCCTATTAGTGG - Intronic
973203655 4:47534460-47534482 CAGACTGAAATGCCTAATAGAGG + Intronic
977099607 4:92794011-92794033 AAGACTGGAATGCCGATTAGTGG + Intronic
978440275 4:108727112-108727134 CAGAATGAAAGGCTTCATAGAGG - Intergenic
980327754 4:131370384-131370406 CAGACTCAATTACCAAATAGAGG - Intergenic
981865204 4:149409275-149409297 CAGACTGAAAGGCTTAGCAGGGG + Intergenic
983262315 4:165470540-165470562 CAGACAGAAAAGCCTAAAACTGG - Intronic
983329056 4:166301174-166301196 CACTCTGAAATGCAAAATAGTGG - Intergenic
985408999 4:189663824-189663846 CATTCTAAAATTCCTAATAGTGG - Intergenic
990986631 5:61646718-61646740 CATTCTGCAATGCCTCATAGAGG - Intronic
991061588 5:62382105-62382127 CAGAATGAAATTCCTAATTTGGG + Intronic
993932455 5:93956421-93956443 AAGACTGAAATTCCTAAAATTGG - Intronic
996846471 5:127904466-127904488 CAGACTGAAAAGCCTCATTTTGG + Intergenic
998453800 5:142254836-142254858 CAGAATGACATGGCTAATAATGG - Intergenic
1003157785 6:3610834-3610856 CAGAATAAATTGTCTAATAGAGG - Intergenic
1005588954 6:27304983-27305005 CAGAATGATAGACCTAATAGGGG + Intronic
1006911122 6:37564288-37564310 CAGACTGGAATTGTTAATAGAGG + Intergenic
1008542667 6:52558787-52558809 CACATGGAAAAGCCTAATAGAGG - Intronic
1012731621 6:102889427-102889449 AAGACTGAAATACACAATAGGGG - Intergenic
1017949327 6:159122688-159122710 CAGACTGAAGCTCATAATAGTGG + Intergenic
1022261815 7:28712931-28712953 GAGACTGAAATGCTAAAGAGAGG - Intronic
1022998897 7:35787170-35787192 CAGTCTGAAAAGACTAATAGAGG + Intergenic
1025963171 7:66242638-66242660 AAGACTGAAATACCTAATACAGG - Intronic
1028553896 7:92102342-92102364 CAGACTCCATTGACTAATAGAGG + Intronic
1028658214 7:93235349-93235371 CTGAGTGAAATGGCAAATAGAGG + Intronic
1032169102 7:129569467-129569489 AAAAGTGACATGCCTAATAGTGG + Intergenic
1032211927 7:129923216-129923238 CAGATTGAATTGCATAATAATGG - Intronic
1032422681 7:131795385-131795407 CAAACTGAAAGACTTAATAGTGG - Intergenic
1034751461 7:153572637-153572659 CAGACTAATATGCCGAATAAAGG + Intergenic
1042617990 8:70670819-70670841 CAGATTGAAATGCCTGATGTAGG - Intronic
1044483395 8:92719873-92719895 AAGACTGAAATGATTAACAGTGG - Intergenic
1046856607 8:119039406-119039428 CAGACTGTAAGACCTAAGAGGGG + Intronic
1050131016 9:2412735-2412757 CTCACTGAAATGCTTAATTGAGG - Intergenic
1052011271 9:23412577-23412599 CAGACTGGCATGCCTATTTGGGG - Intergenic
1188313542 X:28646305-28646327 CAGACTGTAATGCTTAATACTGG + Intronic
1188750680 X:33902128-33902150 CATACAGAAATGCATACTAGAGG + Intergenic
1190897975 X:54639879-54639901 CAGGCTGAGACGCCTACTAGGGG + Intergenic
1192961983 X:76140763-76140785 CAGCCTGAACTGTCTAATACAGG - Intergenic
1194010229 X:88553065-88553087 CAGACTGAAATGTCTTAAATGGG - Intergenic
1194532360 X:95067332-95067354 TAGACTGCAATGCTTAATATTGG + Intergenic
1196997279 X:121397701-121397723 GAGACTGAAATCACTTATAGTGG - Intergenic
1197400607 X:125984442-125984464 CAGCCTGAAATGACTGAAAGAGG + Intergenic
1197637598 X:128932558-128932580 AAGAAAGAAATCCCTAATAGTGG + Intergenic
1197855301 X:130908033-130908055 CAAATTGAAATGGCTAATACAGG - Intergenic
1197865397 X:131011437-131011459 CAGAGTGAAAAGCCTGATATGGG + Intergenic
1198426359 X:136524566-136524588 CAGTTTGAGATGCCTATTAGAGG + Intergenic
1200817037 Y:7544351-7544373 CAGACTGAATTGCCTACTCATGG - Intergenic