ID: 973203941

View in Genome Browser
Species Human (GRCh38)
Location 4:47538611-47538633
Sequence ACACCTCTATTTCAACCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973203941_973203944 29 Left 973203941 4:47538611-47538633 CCACCAGGTTGAAATAGAGGTGT 0: 1
1: 0
2: 0
3: 13
4: 115
Right 973203944 4:47538663-47538685 TCATCCTATGCTTAGCTCACTGG 0: 1
1: 0
2: 2
3: 7
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973203941 Original CRISPR ACACCTCTATTTCAACCTGG TGG (reversed) Intronic