ID: 973203941 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:47538611-47538633 |
Sequence | ACACCTCTATTTCAACCTGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 129 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 115} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
973203941_973203944 | 29 | Left | 973203941 | 4:47538611-47538633 | CCACCAGGTTGAAATAGAGGTGT | 0: 1 1: 0 2: 0 3: 13 4: 115 |
||
Right | 973203944 | 4:47538663-47538685 | TCATCCTATGCTTAGCTCACTGG | 0: 1 1: 0 2: 2 3: 7 4: 91 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
973203941 | Original CRISPR | ACACCTCTATTTCAACCTGG TGG (reversed) | Intronic | ||