ID: 973207019

View in Genome Browser
Species Human (GRCh38)
Location 4:47572183-47572205
Sequence CAAGTGGCAGACATTGGGAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973207011_973207019 28 Left 973207011 4:47572132-47572154 CCTTTTTTTCTGCCTCATGAAGG 0: 1
1: 0
2: 2
3: 30
4: 328
Right 973207019 4:47572183-47572205 CAAGTGGCAGACATTGGGATAGG 0: 1
1: 0
2: 2
3: 22
4: 199
973207015_973207019 -3 Left 973207015 4:47572163-47572185 CCAATGATGTTAGCATGATACAA 0: 1
1: 0
2: 0
3: 12
4: 148
Right 973207019 4:47572183-47572205 CAAGTGGCAGACATTGGGATAGG 0: 1
1: 0
2: 2
3: 22
4: 199
973207014_973207019 16 Left 973207014 4:47572144-47572166 CCTCATGAAGGTGATGGTGCCAA 0: 1
1: 0
2: 0
3: 16
4: 207
Right 973207019 4:47572183-47572205 CAAGTGGCAGACATTGGGATAGG 0: 1
1: 0
2: 2
3: 22
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973207019 Original CRISPR CAAGTGGCAGACATTGGGAT AGG Exonic
901336120 1:8450749-8450771 CAAGTGGTTGACACTGTGATGGG - Intronic
901787012 1:11631396-11631418 GGAGTGGCAGGCAGTGGGATTGG - Intergenic
904630227 1:31835708-31835730 CAAGTGGAAGACGTTGGAGTGGG - Intergenic
904743711 1:32697898-32697920 CAAGAGCTAGAAATTGGGATGGG + Intronic
907580842 1:55571335-55571357 AGAGTGGTAGACATTGAGATGGG + Intergenic
908472791 1:64460275-64460297 TAAGAGGCAGACATTGTGCTAGG - Intergenic
908533663 1:65057297-65057319 TAATTGGCAGAGATTGGCATTGG + Intergenic
908988022 1:70048932-70048954 CCACTTGCAGACATGGGGATAGG - Intronic
910524491 1:88162530-88162552 CAAGTGGCTGACTTTGGGATAGG - Intergenic
910838354 1:91537865-91537887 GAGGTGGCAGACATTTGAATTGG + Intergenic
911149608 1:94584627-94584649 CAAGTGGCAAACGTTTGGAGGGG + Intergenic
913099472 1:115549926-115549948 CAAGTGGTAGAAAGTGGGTTTGG + Intergenic
914734203 1:150400412-150400434 CAACTGGAAGAGACTGGGATGGG + Intronic
915052041 1:153085018-153085040 GAAGTTGCTGACATTTGGATGGG - Intergenic
915053646 1:153104016-153104038 GAAGTTGCTGACATTTGGATGGG - Intronic
920432732 1:205929098-205929120 CAACTGGCAGCCAGTGGGACAGG - Intronic
921343426 1:214156974-214156996 CAAGTGTCAGACAATGTGCTAGG + Intergenic
922868072 1:228877416-228877438 CAAGAGACAGACATTTGGTTGGG - Intergenic
1062806199 10:421416-421438 CAAGTGGCAGAGATGGTGTTTGG + Intronic
1062976633 10:1688400-1688422 CAAGCTCCAGACCTTGGGATGGG + Intronic
1063504765 10:6586651-6586673 CAAGAGGCAAACCTTGAGATGGG + Intergenic
1064000424 10:11659304-11659326 AAAATGGCTGACATTAGGATAGG - Intergenic
1064374697 10:14784820-14784842 CAAGGGGCAGCTATTGGGAAAGG - Intergenic
1065174552 10:23063957-23063979 CATGCGGCAGACATTGTGCTTGG - Intergenic
1067381575 10:45778587-45778609 CAAGTGCCAATCATTGGGAGTGG - Intronic
1067889274 10:50119221-50119243 CAAGTGCCAATCATTGGGAGTGG - Intronic
1068661635 10:59628773-59628795 CAAGTGCTACACATTTGGATGGG - Intergenic
1071393214 10:85195997-85196019 CCTGTGGCAGACATAGAGATAGG + Intergenic
1071945938 10:90644992-90645014 GAAGTGGCGGACATTCGGCTAGG + Intergenic
1072010271 10:91297189-91297211 GAAGTGGAAGACATTGGGGATGG + Intergenic
1074351960 10:112746575-112746597 GAAGTGGCAGAAACTGTGATAGG + Intronic
1075331467 10:121577320-121577342 TAAGTGCCAGACATTGTGCTGGG - Intronic
1075464039 10:122638103-122638125 CAAGTGGCAGATGCTGTGATTGG + Intronic
1075653649 10:124147005-124147027 CAAGTGGCTGACATTGCTAGTGG + Intergenic
1076458482 10:130621770-130621792 CAAGTGACAGACATGAGGATGGG - Intergenic
1077791200 11:5441937-5441959 TCAGGGGCAGCCATTGGGATTGG - Intronic
1078110262 11:8386537-8386559 CAAGTGGCAGGCAGTGGCCTGGG + Intergenic
1083676693 11:64329923-64329945 CAACTGGCAGCCATGGGGCTTGG + Intergenic
1083735248 11:64676437-64676459 CCAGTGGCAGCCAGTGGGGTGGG - Intronic
1087795265 11:102449887-102449909 AAAGTGGCAGAGACTGGAATTGG + Intronic
1088539046 11:110894101-110894123 CACGTGCCAAACATTGGGAAAGG + Intergenic
1089233496 11:117002007-117002029 GAAGTGGCAGGCAATGGGAAAGG - Intronic
1090583346 11:128183827-128183849 CCAATAGCAGACATTAGGATGGG + Intergenic
1092087773 12:5777886-5777908 CAAATGTCAAACACTGGGATGGG + Intronic
1093798392 12:23341363-23341385 CAACTGGCAGCCATTCTGATTGG - Intergenic
1095396730 12:41770423-41770445 CAAGGGGCAGAACTTGGGAATGG + Intergenic
1095956144 12:47807478-47807500 CAAGTGGCAGAGGTTGAGCTGGG + Intronic
1096414868 12:51404285-51404307 GGAGAGGCAGAGATTGGGATGGG + Intronic
1100608809 12:96173398-96173420 TAAGTGGCAGCCAATAGGATGGG - Intergenic
1100736008 12:97532268-97532290 TATGTGCCAGACATTGGGCTAGG - Intergenic
1101038852 12:100733589-100733611 CAGGTGCCAGACCCTGGGATGGG - Intronic
1101759884 12:107649830-107649852 CAAGAGGCAGACAGGGGGCTGGG - Intronic
1102090652 12:110184530-110184552 CAAGAAGCAGACACTGAGATGGG + Intronic
1104015584 12:124959658-124959680 CAAATGGCGGACAGTGGGACGGG + Intronic
1104348031 12:128020343-128020365 CAAGAAGCAGACATTCAGATGGG + Intergenic
1108257180 13:48622087-48622109 GAAATGGGACACATTGGGATTGG + Intergenic
1110288328 13:73775660-73775682 GAACTGGCAGACATTCTGATTGG + Intronic
1111106988 13:83658933-83658955 AAAGTGGCAGCCATTGGCAGAGG - Intergenic
1112019162 13:95356797-95356819 GAAGTGGCTGTCAGTGGGATAGG + Intergenic
1112782642 13:102917649-102917671 TAAGTGCCAGGCATTGTGATGGG + Intergenic
1113029191 13:105975374-105975396 CAGGTGGCAGTCAATGGGCTGGG - Intergenic
1115234372 14:31194221-31194243 CAAGTGCCAGGCATTGGGATGGG + Intronic
1116480960 14:45391472-45391494 CAAGTTCCAGCCACTGGGATGGG - Intergenic
1116806431 14:49498588-49498610 CAAGTGGCATACCTAGGGTTTGG + Intergenic
1119329043 14:73780285-73780307 CAAGTGGAAGAGGGTGGGATGGG - Intronic
1121933480 14:97994948-97994970 CAAGAGGCAGACCTTGAGGTGGG + Intergenic
1122103257 14:99430596-99430618 CAAGTGCCAAACATTAGGCTAGG + Intronic
1122152340 14:99731829-99731851 CCAGTGGCAGACACTGGGTGAGG + Intergenic
1124577184 15:30920270-30920292 CAGGTGGCAGACCCTGGGTTTGG + Intronic
1124971386 15:34493000-34493022 CAAATGGCAAATATTGGGATTGG + Intergenic
1125728257 15:41879163-41879185 GAAGGGACAGAAATTGGGATGGG - Intronic
1126318983 15:47401561-47401583 AAAGTAGCAGACATGGGTATTGG - Intronic
1127794503 15:62426469-62426491 TAACTGGCAGGGATTGGGATAGG + Intronic
1128440376 15:67702076-67702098 CTAGTGTCAGACACTGGGCTAGG - Intronic
1129086702 15:73101502-73101524 GAAGAGGCAGAGATTAGGATTGG - Intronic
1131736516 15:95338555-95338577 CCTGTGGCAGACATCGGGAGTGG - Intergenic
1134305122 16:13024951-13024973 CAAGGGGCAGATATTGGGGAAGG + Intronic
1138390490 16:56667103-56667125 CAACTGGTGGACATTGGAATGGG + Intronic
1139620236 16:68134370-68134392 CAAGTGGCAGACACTGGGCCTGG - Intronic
1141291679 16:82723532-82723554 CAGGTGGCAGACAGAGGAATAGG - Intronic
1144578236 17:16443365-16443387 CAAATGGCAGATAATGGGATAGG + Exonic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1145064860 17:19755503-19755525 TAAGTGGCAGACACTGGTTTTGG + Intergenic
1145225428 17:21124221-21124243 CAAGAGGCAAGCATGGGGATGGG + Intronic
1146606011 17:34258294-34258316 CAGGTGCCTGAGATTGGGATGGG - Intergenic
1146640073 17:34533686-34533708 CCAGCGGCAGAAATTGGAATGGG + Intergenic
1147721002 17:42539318-42539340 CAAATGGCAGCCCTTGGGAGTGG + Intronic
1149432915 17:56608801-56608823 CATGTGGCAGACATTGTGCCAGG - Intergenic
1153260690 18:3221411-3221433 CCAGTGCCAGACACTGGGATAGG + Intergenic
1154383678 18:13874386-13874408 CAAGTGGCAGACCTAGGATTTGG - Intergenic
1155863527 18:30934781-30934803 CAGTTGACAGACATTGGGACTGG + Intergenic
1156021945 18:32609533-32609555 CAAGAAGCAAACAATGGGATGGG + Intergenic
1158498405 18:57977870-57977892 CAAGTGGCAAATATTTGTATAGG - Intergenic
1158628025 18:59088736-59088758 TACGTGGCAGTCCTTGGGATGGG + Intergenic
1159533433 18:69684762-69684784 CAAGTAGCAGACAATGTTATTGG + Intronic
1159841593 18:73404817-73404839 CAAATGGCAGCCATTGGATTGGG - Intergenic
1160920171 19:1515912-1515934 CAAATTGCAGACACTGGGCTGGG + Intergenic
1162693123 19:12450103-12450125 CAAGTTCCAGCCACTGGGATGGG + Intronic
1166155671 19:40909471-40909493 GAAGTGGCAGGCATGGGAATTGG + Intergenic
925354866 2:3233321-3233343 GAAGTGGCATACATGGGAATTGG - Intronic
925493871 2:4424607-4424629 CAGGTGGGACACAGTGGGATGGG - Intergenic
926584929 2:14675350-14675372 CAAGTGGCTGATATTGTGAAGGG - Intergenic
927133176 2:20078025-20078047 CACGTGGCAGGCATTGTGCTGGG - Intergenic
927918088 2:26949394-26949416 CAAGTGGCAGCCATTGGAACAGG + Exonic
930186793 2:48419313-48419335 CATGTGCCAGGCACTGGGATAGG - Intergenic
930726471 2:54686664-54686686 CTAGTGATAGACAATGGGATTGG - Intergenic
935392089 2:102563654-102563676 CATGTGGCAGACATTGTTTTAGG - Intergenic
936171326 2:110178862-110178884 TAAGTGGCAGAACTTGGGATTGG - Intronic
936652934 2:114450456-114450478 TATGTGGCAGATATTAGGATAGG - Intronic
936662573 2:114558833-114558855 TATGTGTCAGACATTGTGATGGG - Intronic
937147118 2:119656916-119656938 CAGGTGGCAGACAGTGGCAGGGG + Intronic
938143852 2:128818025-128818047 CACGTGCCAGACACTGGGATGGG - Intergenic
938874633 2:135519718-135519740 CATGTAGCAGACATTGTGCTAGG + Intronic
939878071 2:147600124-147600146 CATGTGCCAGACATTGTGCTAGG - Intergenic
941449890 2:165647312-165647334 TATTTTGCAGACATTGGGATAGG + Intronic
941553928 2:166951865-166951887 CAAGTAGCAGGCAATAGGATAGG - Intronic
944309690 2:198219630-198219652 CGAGTGGTAGACATTGGGAGAGG - Intronic
946475606 2:220003950-220003972 TGAGTGTCAGACATTGGGTTAGG + Intergenic
946820131 2:223620585-223620607 CAAGAGGCAGAGATGGGGAAGGG - Intergenic
947483188 2:230522078-230522100 CAGGTACCAGACAGTGGGATTGG + Intronic
1169181819 20:3575878-3575900 CCAGTGGCAGTCATTGGTGTTGG - Exonic
1170471157 20:16669582-16669604 CAAGTGTCAGTCATTGGGAAAGG + Intergenic
1172871247 20:38136730-38136752 CAAATGGCAGAAAGTGGGATGGG + Intronic
1174734336 20:52950982-52951004 CAAATGGAAGACTTTGGAATTGG - Intergenic
1175843458 20:62046080-62046102 CAGACGGCAGACATTGGGATTGG + Intronic
1177740706 21:25149357-25149379 CAAGTTCCAGCCACTGGGATGGG + Intergenic
1178682426 21:34684171-34684193 CAAGTAGCAGACATTGTGCTTGG + Intronic
1180608895 22:17083280-17083302 CAAGTGGCAGAGAATGAGAAAGG - Intergenic
1181172439 22:21017258-21017280 GGAGTGGCAGCCATTAGGATTGG - Intronic
949105145 3:194563-194585 CAAGTGTCAGACAGTAGAATGGG + Intergenic
950502205 3:13371792-13371814 CAGGTGCCAGATACTGGGATTGG - Intronic
951947406 3:28155784-28155806 CTACTGGCAGACATTGAGATAGG - Intergenic
952553025 3:34500490-34500512 CAAGTGGGGAATATTGGGATGGG + Intergenic
953644439 3:44741244-44741266 CAAATGACAGACATTTGGATTGG - Intronic
955575858 3:60362552-60362574 TAAGTGGCAGACACTGTGATGGG - Intronic
957285770 3:78215646-78215668 CAAGTGGCAGCCTCTGTGATTGG - Intergenic
959842130 3:110989662-110989684 CAAATGGCAGACATATGGAAAGG + Intergenic
960929264 3:122828061-122828083 CAAGTGGCAGAAAATGAGACTGG + Intronic
961600748 3:128059708-128059730 CAAGTGCCTGACATTGAGTTTGG + Intronic
962036869 3:131661184-131661206 CAGGTACCAGACATTGTGATGGG - Intronic
963150148 3:142037215-142037237 CATGTGCCAGACATTAGGAGAGG + Intronic
967787179 3:193509927-193509949 CATGTACCAGACATTGGCATAGG - Intronic
969465054 4:7351357-7351379 CAAGTGCCAGCCACGGGGATGGG - Intronic
970578492 4:17451280-17451302 AAAGTGGCACTCAGTGGGATGGG + Intergenic
971297525 4:25410958-25410980 CAAGTGGCAGAAATTGCTATAGG - Intronic
972064113 4:34917806-34917828 CAAGGGTCAGAAATTGGGAGGGG + Intergenic
973207019 4:47572183-47572205 CAAGTGGCAGACATTGGGATAGG + Exonic
974206282 4:58706706-58706728 TATGTGGCAAACATTGCGATAGG + Intergenic
975687819 4:76934667-76934689 CAAGTGGCAGACATAGACACTGG - Intergenic
975907596 4:79233041-79233063 CACGTGGCAGACATTGTACTAGG - Intronic
976403424 4:84635192-84635214 TAAGTGGCAGATATTCGGAAAGG - Intronic
977255301 4:94733513-94733535 TAAGTGGCAGAGTTGGGGATTGG + Intergenic
977580335 4:98717996-98718018 CTTGTGGCAGGCATTGGGACAGG - Intergenic
978283771 4:107050303-107050325 TTAGTGGCAGAGATGGGGATAGG + Intronic
979926725 4:126576782-126576804 TAAGTGGCAGACATTGTTTTAGG + Intergenic
980821292 4:138020831-138020853 GAAGGGGAAGACATTAGGATGGG + Intergenic
986127436 5:4896078-4896100 CATGTGGCAGAGATAGAGATGGG + Intergenic
990339413 5:54807998-54808020 CATGTGTCAGGCACTGGGATAGG - Intergenic
991009501 5:61868251-61868273 CAAGTTGCAGACCTAGGGCTTGG + Intergenic
991947789 5:71916448-71916470 CAAGTGGTCCACATTGGTATTGG - Intergenic
995009114 5:107238316-107238338 CAGGTGGCAGATAATGGGTTTGG + Intergenic
996666475 5:126066071-126066093 CAAGTTCCAAACACTGGGATGGG - Intergenic
997083882 5:130773544-130773566 TAAGTGGCAGATACTGGGAGTGG - Intergenic
997101577 5:130975128-130975150 CAAGAGGCAGATAATGGGAGGGG + Intergenic
997391714 5:133522629-133522651 AAAGTGGCAGCCACTGAGATAGG - Intronic
997661232 5:135590879-135590901 CATGTGCCGAACATTGGGATGGG - Intergenic
999840691 5:155422779-155422801 TAAGGGGAAGACATTAGGATTGG - Intergenic
1000049339 5:157548370-157548392 TATGTGGCAGGCACTGGGATAGG - Intronic
1001674061 5:173497898-173497920 CAAGTGGCCGGCTGTGGGATGGG + Intergenic
1001950496 5:175813388-175813410 TAAGTGACAGACACTGTGATTGG - Intronic
1002016906 5:176331608-176331630 TAAGTTGCAGACATAGGGCTGGG - Intronic
1003377595 6:5593963-5593985 CACGTGGCAGGCATGGGGACAGG + Intronic
1003818351 6:9866708-9866730 CATGTGCCAGACATTGGGACAGG - Intronic
1004530933 6:16455038-16455060 CATGTGGCAGGCATTGGGTTGGG + Intronic
1005219417 6:23569953-23569975 TATGTGGCAGACATTGTGCTGGG + Intergenic
1005996445 6:30934275-30934297 CAAGAGGATGACCTTGGGATAGG + Intergenic
1006264933 6:32913027-32913049 CAAGGAGAAGAAATTGGGATGGG + Intergenic
1007097311 6:39221508-39221530 CAGGTGCCAGACATTGGGCTGGG - Intronic
1008676967 6:53829327-53829349 CAAGTGCCAGACATTAGGCCAGG - Intronic
1012245592 6:96923006-96923028 TATGTGGCAGACATTGTGCTAGG + Intergenic
1013732275 6:113182872-113182894 CAAATTACAGACATTTGGATGGG + Intergenic
1014084508 6:117327806-117327828 CAAGTGCCAGTCATTGGATTAGG - Intronic
1015601225 6:134912771-134912793 AAAGTAGCATATATTGGGATGGG + Intergenic
1021673796 7:23060238-23060260 GAAGTGGGAAACATTGGGAAAGG - Intergenic
1022553084 7:31260682-31260704 CAAGTGGTAGGATTTGGGATGGG - Intergenic
1023212576 7:37823860-37823882 CAAGGGACAGATATGGGGATGGG - Intronic
1025258174 7:57399356-57399378 CAAGTGGGAGACCTGGGGAGGGG + Intergenic
1025709039 7:63890917-63890939 CAAGTGGGAGACCTGGGGAGGGG + Intergenic
1028929646 7:96398295-96398317 CAAGTTCCAGCCACTGGGATGGG + Intergenic
1030969702 7:116040749-116040771 CAAATGGCAGAGATGGGGCTGGG - Intronic
1033662149 7:143409384-143409406 TCAGTGGCAGAGATTGGGAAAGG + Intergenic
1034430171 7:151037336-151037358 GAAGTGGCAGGCATGGGGAAGGG - Intronic
1035226502 7:157436245-157436267 CAAGTGGCTGGCGTTGGGACGGG - Intergenic
1035848580 8:2891315-2891337 CAAGTGGTAGACAAAGGGAAGGG + Intergenic
1040519143 8:48160292-48160314 CGAGTGACAGAGCTTGGGATGGG + Intergenic
1041093912 8:54330365-54330387 CAAGAGACAGAAAATGGGATTGG + Intergenic
1041391223 8:57349084-57349106 CAAGTAGCTGACATTGGAATTGG + Intergenic
1043180336 8:77081069-77081091 CAAGTGGCAGGCATTATGCTAGG - Intergenic
1043658950 8:82710113-82710135 CAAGTGGAAGACAAGGTGATGGG + Intergenic
1044533531 8:93334626-93334648 CAAGGGGCTGACATTGGAACTGG - Intergenic
1045017214 8:98010200-98010222 CATGGGGGTGACATTGGGATGGG - Intronic
1046899511 8:119508977-119508999 CAAGTGGCAAGCACTGTGATAGG + Intergenic
1047577159 8:126169176-126169198 CAGGTGGCAGACAATGTGACTGG - Intergenic
1048221758 8:132548769-132548791 CAAGTGGCAGCCAGTGAGACAGG + Intergenic
1048445563 8:134490325-134490347 CAGTTGGAAGAGATTGGGATGGG - Intronic
1050059149 9:1687414-1687436 AAAGTGGCTGTCATTGGGATGGG + Intergenic
1050723119 9:8613678-8613700 CGAGTGGCAGATTTTTGGATTGG - Intronic
1053056506 9:34996198-34996220 CAGGGGGAAGACACTGGGATTGG + Intronic
1056501470 9:87213933-87213955 CAACGGGCAGACAGTGGGACAGG + Intergenic
1057274448 9:93668858-93668880 CAAATGGGAGACTTTGGGAGAGG - Intronic
1057477956 9:95420510-95420532 TAAGTGGGACACACTGGGATGGG + Intergenic
1059730831 9:117055241-117055263 AAAGTGCCAGACATTGTGTTGGG + Intronic
1059750060 9:117239251-117239273 CAAATGCCAGGCATTGGGCTAGG + Intronic
1061695653 9:132371362-132371384 CAAGTGACAGATTTTGAGATGGG + Intergenic
1185492843 X:532034-532056 CAAGTGGGGGACAGTGGGGTGGG - Intergenic
1185708686 X:2284660-2284682 CAATTTTCAGACATGGGGATGGG + Intronic
1187509228 X:19902695-19902717 AAATTGGCAGACTTTGGGGTTGG + Intergenic
1189998841 X:46665079-46665101 CAACTGGAAGACGATGGGATGGG + Intronic
1190227920 X:48560259-48560281 CAAGTGGCAGACGCTGGTTTTGG + Exonic
1192239966 X:69321101-69321123 TATGTGACAGACATTGTGATGGG - Intergenic
1196395901 X:115261461-115261483 CAAGTGGCTCTCAGTGGGATGGG + Intergenic
1197041025 X:121935328-121935350 AAAATGACAGGCATTGGGATTGG + Intergenic
1198661250 X:138970236-138970258 CATGTGCCAGACATTGTGTTAGG - Intronic