ID: 973207774

View in Genome Browser
Species Human (GRCh38)
Location 4:47579661-47579683
Sequence GCCGTTTTGATTCTGCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973207774_973207775 -8 Left 973207774 4:47579661-47579683 CCATGTTGCAGAATCAAAACGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 973207775 4:47579676-47579698 AAAACGGCAAGAAGTAACCCTGG 0: 1
1: 0
2: 1
3: 18
4: 175
973207774_973207777 8 Left 973207774 4:47579661-47579683 CCATGTTGCAGAATCAAAACGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 973207777 4:47579692-47579714 ACCCTGGAGAACTATTGAGTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
973207774_973207776 7 Left 973207774 4:47579661-47579683 CCATGTTGCAGAATCAAAACGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 973207776 4:47579691-47579713 AACCCTGGAGAACTATTGAGTGG No data
973207774_973207780 21 Left 973207774 4:47579661-47579683 CCATGTTGCAGAATCAAAACGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 973207780 4:47579705-47579727 ATTGAGTGGGCAAACCATGTAGG 0: 1
1: 0
2: 0
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973207774 Original CRISPR GCCGTTTTGATTCTGCAACA TGG (reversed) Intronic
903409535 1:23129828-23129850 GCCATTGTGATTCTGGCACATGG - Intronic
908517345 1:64906467-64906489 GGGGTTTTGCTTCTACAACATGG - Intronic
918666750 1:187161015-187161037 GCCGGATTGATTCTGCATCCAGG + Intergenic
919621990 1:199873394-199873416 GCCATTAAGATTCTGCCACAGGG + Intergenic
923253573 1:232199463-232199485 GCCGTTAGGATTTTGGAACAAGG - Intergenic
924298630 1:242614184-242614206 GCTGATTTGTTTGTGCAACAGGG + Intergenic
1073353791 10:102837718-102837740 GTGATTTTGATTTTGCAACATGG - Intergenic
1080294737 11:30713636-30713658 GCTCTTTTCATTATGCAACAAGG - Intergenic
1084550875 11:69840938-69840960 GCCCTTTTGATTTCGGAACAAGG - Intergenic
1086377814 11:86218887-86218909 GCTGTTTTATTTCTGCAGCAGGG - Intergenic
1090231619 11:125111196-125111218 GCCAGTTTGAATCTGCAACAGGG - Intronic
1100886518 12:99076891-99076913 GCTATTTTCACTCTGCAACAGGG + Intronic
1105269575 13:18859352-18859374 GCAGTCTTGATTCCTCAACATGG + Intergenic
1110561311 13:76913198-76913220 GAACTTTTGATTCTGCAAAAAGG + Intergenic
1112603859 13:100884138-100884160 GCCCTTTTTATTCTCCAACTCGG - Intergenic
1116367078 14:44080744-44080766 GCTGTTTTGATTCTAGCACAAGG - Intergenic
1130147015 15:81282147-81282169 GCCTTTCTGGTCCTGCAACATGG + Intronic
1135759992 16:25130038-25130060 GCCCTTAAGATTCTTCAACAGGG + Intronic
1146031086 17:29366616-29366638 CCCTTTTTCATTCTGCAAAATGG - Intergenic
1154418471 18:14200631-14200653 GCAGTCTTGATTCCTCAACATGG - Intergenic
1157076911 18:44476436-44476458 GGAGTTTTGATTCTCCAAGATGG + Intergenic
1165565140 19:36719520-36719542 TCAGTATTGATTCTGCATCAGGG + Exonic
941008947 2:160276677-160276699 GCTGTTTTGAAACTGCTACAGGG - Intronic
941070910 2:160953536-160953558 GATGTTTTGGTTCTGCATCAGGG - Intergenic
946101311 2:217326930-217326952 TCCTTTTTGATTCTGTAAAATGG - Intronic
1169589478 20:7124316-7124338 GCCGCTTTCATTCTCCAACCTGG + Intergenic
1170903942 20:20494559-20494581 GCTGAATTGATTCTGCAGCAAGG + Intronic
1170973000 20:21133993-21134015 GCCGTTCTGAGTTTGCAGCATGG - Intronic
1171149877 20:22818357-22818379 GCCTTTTTGATTCTGCAAGGAGG - Intergenic
1171319037 20:24222681-24222703 CCCGTTTTTATTTTGCATCATGG + Intergenic
1176854828 21:13958664-13958686 GCAGTCTTGATTCCTCAACATGG + Intergenic
1180394161 22:12314150-12314172 GCAGTTGTGCTTCTGCATCAGGG + Intergenic
1185053967 22:48568415-48568437 CAAGTTTTGATTCTGCACCAAGG - Intronic
953210568 3:40871454-40871476 GCTGTTCTGCATCTGCAACAGGG - Intergenic
954151900 3:48662093-48662115 GACTTTTTGATTCGGCACCACGG - Exonic
955747468 3:62154435-62154457 GCCCTTTTGAGTTTGCAGCAGGG + Intronic
958940826 3:100312143-100312165 GCAGTTTTTATTCTGAGACAGGG + Intronic
961676162 3:128568165-128568187 GCTGCTTTGATTCTGCAAAATGG - Intergenic
965259766 3:166467238-166467260 GCCTTTAGGATTCTGGAACAAGG + Intergenic
965858730 3:173120805-173120827 GCCTTTTTCTTTCTGCAAGAAGG + Intronic
971015596 4:22485841-22485863 TCCAGTTTGCTTCTGCAACAAGG - Intronic
973207774 4:47579661-47579683 GCCGTTTTGATTCTGCAACATGG - Intronic
977120861 4:93099414-93099436 GCCTTTACTATTCTGCAACAAGG + Intronic
988807859 5:34757057-34757079 GCTGGTTTGGTTCTGTAACACGG + Intronic
991419865 5:66429804-66429826 ACCCTTTAGCTTCTGCAACAGGG - Intergenic
995821648 5:116241313-116241335 GCTGTTTTGATTTTGCTCCAGGG - Intronic
997756524 5:136404868-136404890 GCTGTTTTGAAACTGCAAAAGGG - Intergenic
1003033956 6:2626593-2626615 ACCGCGTTGATTCAGCAACATGG - Intronic
1007262391 6:40572847-40572869 GGCATGTTCATTCTGCAACAAGG + Intronic
1015457826 6:133448866-133448888 TCCTTTTTGATTCTACAACTGGG - Intronic
1021095187 7:16527433-16527455 GCAGTCTTGATTCTCCAACAGGG + Intronic
1026506431 7:70988497-70988519 GTCTTTTGGATTTTGCAACATGG - Intergenic
1026796522 7:73369398-73369420 TCCTTTTTGATTCTGCAAGGAGG + Intergenic
1030491711 7:110243787-110243809 GGCGTTTTGATACTGCAGCCAGG + Intergenic
1036865019 8:12388777-12388799 GCTTTTTTGGTTCTGCAACCTGG + Intergenic
1040816397 8:51512481-51512503 GCGGCATTGATTCTGTAACAGGG + Intronic
1046828373 8:118716930-118716952 GCTCTTTTGACTCTGCAACCTGG + Intergenic
1048927598 8:139284587-139284609 GCCTTTTTGCCTCAGCAACAGGG - Intergenic
1051228582 9:14929395-14929417 GACATTTTGAATCTGCAACGTGG - Intergenic
1055015160 9:71608705-71608727 GCCTGTTTTATTTTGCAACATGG - Intergenic
1058898296 9:109418956-109418978 GCCGTTTTGAGTCTGCAGTGGGG - Intronic
1187861394 X:23687195-23687217 TCCGTTTTGTTTCTGAGACAGGG + Intergenic