ID: 973207776

View in Genome Browser
Species Human (GRCh38)
Location 4:47579691-47579713
Sequence AACCCTGGAGAACTATTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973207774_973207776 7 Left 973207774 4:47579661-47579683 CCATGTTGCAGAATCAAAACGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 973207776 4:47579691-47579713 AACCCTGGAGAACTATTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973207776 Original CRISPR AACCCTGGAGAACTATTGAG TGG Intronic
No off target data available for this crispr