ID: 973229375

View in Genome Browser
Species Human (GRCh38)
Location 4:47824408-47824430
Sequence GGACCTGCAAGATCTCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973229375_973229383 18 Left 973229375 4:47824408-47824430 CCCAGGTGAGATCTTGCAGGTCC 0: 1
1: 0
2: 0
3: 4
4: 103
Right 973229383 4:47824449-47824471 CGTTCTCACCAGGATGCCTTAGG 0: 1
1: 0
2: 0
3: 9
4: 100
973229375_973229381 8 Left 973229375 4:47824408-47824430 CCCAGGTGAGATCTTGCAGGTCC 0: 1
1: 0
2: 0
3: 4
4: 103
Right 973229381 4:47824439-47824461 GGCCACTTCACGTTCTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973229375 Original CRISPR GGACCTGCAAGATCTCACCT GGG (reversed) Intronic
902139542 1:14341381-14341403 GGAGCTGCAGGATCTGACTTAGG - Intergenic
904132956 1:28288899-28288921 GGTCCTGCTAGATCTGCCCTGGG - Intergenic
918998143 1:191789485-191789507 GGGCCTGAAAGATCACACATAGG + Intergenic
920008210 1:202848873-202848895 GGACCTGCAGGAAGTCATCTAGG + Intergenic
921445525 1:215242484-215242506 GGGCCTGAAAGATCGCACATAGG + Intergenic
1063986663 10:11511569-11511591 AGACCTGCTAGATCTCAGCAGGG - Intronic
1064729306 10:18313422-18313444 GAACCTGCCAGATGTCTCCTGGG + Intronic
1067069524 10:43121617-43121639 CCCCCTGCAAGATCTCCCCTGGG - Intronic
1072105912 10:92273785-92273807 GGACCAGAAACATCTCACCTAGG - Intronic
1078894477 11:15585735-15585757 GGTCCAGCAAGATCTCCCCAAGG - Intergenic
1079141406 11:17812459-17812481 GAACCTGCCAGATCTAACCCTGG - Intronic
1080795287 11:35557568-35557590 GGAGCTGCATGAGCTCAGCTGGG + Intergenic
1083545263 11:63544855-63544877 GGACTTGCCATATCTCAGCTGGG - Exonic
1083703089 11:64493560-64493582 GTACCAACAAGATCTCATCTTGG + Intergenic
1083928111 11:65821437-65821459 AGCCCTGCAAGTTCTCCCCTGGG - Intergenic
1083952749 11:65965904-65965926 GGACCTGCAGGGCCTCACCGTGG + Exonic
1085637984 11:78172825-78172847 GTACCTGCAAGTGATCACCTTGG - Exonic
1086850119 11:91798902-91798924 GGACCTGCACTTTCCCACCTAGG - Intergenic
1088945000 11:114503024-114503046 GGGCCTGAAAGATCACACATAGG + Intergenic
1091391621 12:129564-129586 GGACCTGCATGCTCACTCCTTGG - Intronic
1092914769 12:13179849-13179871 GGAAATGCAAGATCTCTCCGTGG + Intergenic
1100481282 12:94982072-94982094 GTAGCTGCATAATCTCACCTAGG - Intronic
1101449027 12:104759629-104759651 GCAGCTGCAACATCTCACCGGGG + Exonic
1104598278 12:130134566-130134588 GGACCTGGTGGCTCTCACCTGGG - Intergenic
1115459775 14:33647757-33647779 GAACATGCAAGATGTGACCTGGG - Intronic
1117322466 14:54636990-54637012 GGAACTGCATGAGCTCACCAGGG + Intronic
1118326940 14:64787612-64787634 GGGCCTGAAAGAGATCACCTTGG + Intronic
1118968707 14:70613057-70613079 GGGCCTGAAAGATCACACATGGG + Intergenic
1119350970 14:73965367-73965389 GGACCTGGAAGATCTCCCTGTGG - Exonic
1122176121 14:99920415-99920437 CCACCTGCAAGAGCTCACCCAGG - Intronic
1127768495 15:62210979-62211001 GGACCAGCAAGTTCTCCCTTTGG - Intergenic
1128719761 15:69939808-69939830 GGACCTGCAGGATGGCCCCTGGG + Intergenic
1131227654 15:90638642-90638664 GCTCCTGCCAGAACTCACCTGGG - Exonic
1133448208 16:5880589-5880611 AGACCTGCTAGAGGTCACCTTGG + Intergenic
1133838714 16:9389118-9389140 GGTCCTGCATGGTCTGACCTTGG - Intergenic
1139653627 16:68374852-68374874 GGACCTGCAAGCTCTCCCTCTGG - Intronic
1139666189 16:68458345-68458367 GGGCCTGCCAGACTTCACCTGGG - Intergenic
1146628944 17:34456195-34456217 GTACCTGGAACATCTCAGCTGGG + Intergenic
1151332310 17:73417615-73417637 AGACCTGCAAGTTCTGCCCTGGG - Intronic
1155863958 18:30941155-30941177 GGGCCTGCAAGATTTCTGCTGGG + Intergenic
1157139372 18:45090317-45090339 GTACCTGCAGGATCTCACTTGGG - Intergenic
1159088534 18:63821018-63821040 GGAACTGGCAGAGCTCACCTGGG - Intergenic
1160851378 19:1194556-1194578 GGACCCGGAGGATCTCACCGCGG + Intronic
1163830307 19:19544375-19544397 GGACCCCCGAGACCTCACCTCGG + Exonic
1165477544 19:36039926-36039948 GGACCTCCCAGCGCTCACCTTGG + Exonic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1166970901 19:46566890-46566912 GCACCTGCAAGAGTTCCCCTGGG - Intronic
1167587134 19:50381610-50381632 GGACCAGCACGATGTGACCTAGG + Intronic
925107155 2:1301345-1301367 GGACCTGCAGGATGTAACCAAGG + Intronic
925333329 2:3075349-3075371 AGACATTCAAGAGCTCACCTGGG + Intergenic
926685160 2:15692390-15692412 AGACCTGGAAGAGCTCACATGGG - Intronic
930059592 2:47277142-47277164 GGTCCTGAAAGCTGTCACCTGGG - Intergenic
931540716 2:63326288-63326310 GGACCTCCAAGAGATCATCTCGG - Intronic
935109014 2:100074725-100074747 GGACCTGCACATCCTCACCTTGG - Intronic
940557502 2:155249502-155249524 GGACCTTAAAGATCCCACATAGG + Intergenic
940722256 2:157294700-157294722 GGGCCTGAAAGATCACACATAGG + Intronic
946016456 2:216607956-216607978 GGACCTACAAGATGAAACCTGGG + Intergenic
946828664 2:223705423-223705445 TGAACTGCAACAGCTCACCTTGG + Intergenic
948641741 2:239379521-239379543 GGACCTGCCAGACCCCTCCTGGG - Intronic
949009673 2:241671401-241671423 GGACTTGGCAGCTCTCACCTAGG - Exonic
1173781150 20:45758499-45758521 GGGCCTGAGAGTTCTCACCTAGG - Intronic
1179059357 21:37965365-37965387 GGACCTGAAAGATCACACATGGG + Intronic
1179398355 21:41061583-41061605 GGTCCTGCAAGGCCTCCCCTGGG + Intergenic
1180741848 22:18058995-18059017 GGTGCTGCAGGACCTCACCTGGG + Intergenic
949505582 3:4724609-4724631 GGAACTGCCAGACCCCACCTGGG - Intronic
950234527 3:11307258-11307280 GGACATCCAGGCTCTCACCTGGG + Intronic
951383538 3:22015863-22015885 GCATCTGCAAGATGGCACCTTGG + Intronic
953682964 3:45053110-45053132 GGACCTGGAAAATGTCACTTTGG + Intergenic
961155267 3:124674450-124674472 GGACCTGGACCACCTCACCTTGG - Intronic
961266504 3:125647374-125647396 AGGCCTGCTAGAACTCACCTTGG + Intergenic
967280190 3:187814866-187814888 GCTCCTTCAAGAGCTCACCTAGG - Intergenic
971935174 4:33138423-33138445 GGACCTGAAAGTGCTGACCTTGG - Intergenic
973229375 4:47824408-47824430 GGACCTGCAAGATCTCACCTGGG - Intronic
977834573 4:101633295-101633317 GGACTTCTAAGAGCTCACCTTGG + Intronic
978406645 4:108386001-108386023 GGACCAGGAAGATCTCAAATTGG + Intergenic
989866088 5:46509913-46509935 GGACCTGCAAGTTTTCATTTGGG + Intergenic
994838633 5:104891648-104891670 GCACCTGCCAAATCTCACTTCGG + Intergenic
996349294 5:122520579-122520601 TGTCCTGCAAGAACTCAACTAGG + Intergenic
1002775175 6:322461-322483 GAAGCTGCAAAATCTCAGCTTGG - Intronic
1002786372 6:403303-403325 GGATCTGGAAGAGCTCACATGGG + Intronic
1003298687 6:4856751-4856773 GGAACTTCAGGATCTCAACTTGG + Intronic
1006991494 6:38218512-38218534 GGACCTGCCAGATGTCCCCTGGG + Intronic
1008063657 6:47025255-47025277 TCACCTGGAAGATCTCACCCTGG + Intronic
1011175059 6:84551139-84551161 GGACCTGCATGGCATCACCTAGG - Intergenic
1013854190 6:114552161-114552183 GGACCAGCAAGAGCTAACTTGGG - Intergenic
1015228638 6:130887526-130887548 GGCCCTGCATGATCTGACCCAGG + Intronic
1015686659 6:135870802-135870824 GGAACTGGATGAGCTCACCTAGG + Intronic
1023754638 7:43405288-43405310 GGATCTCCAAGATCACCCCTAGG + Intronic
1028401958 7:90433947-90433969 GGACCTGCCCCTTCTCACCTAGG + Intronic
1030653839 7:112144557-112144579 GGTCCTCCTAGATCTGACCTAGG - Intronic
1035779634 8:2217289-2217311 AGTCCTGTAAGATCTCCCCTTGG + Intergenic
1035958350 8:4108345-4108367 TGGCATGCAAGATCTCACCCCGG + Intronic
1038493779 8:27987785-27987807 GGACCTGGAGGATGGCACCTGGG - Intronic
1045001403 8:97881302-97881324 ACACCTGCATGACCTCACCTAGG - Intronic
1047045063 8:121044053-121044075 GGACCAGCCAGGTTTCACCTTGG + Intergenic
1048514424 8:135093050-135093072 GGTCCTGTAACATCTCATCTTGG + Intergenic
1050945011 9:11505766-11505788 GAACCTGTAATCTCTCACCTAGG + Intergenic
1052334885 9:27309026-27309048 GGACCTGAAAGATCACACAAAGG + Intergenic
1056299759 9:85228949-85228971 TGACCTGCAATATGTGACCTGGG + Intergenic
1057046507 9:91890221-91890243 GGACCAGCAAGGACCCACCTTGG + Intronic
1061762601 9:132860784-132860806 TGACCTGCAAGAGCCCACCCGGG - Intronic
1062001548 9:134218407-134218429 GCATCTGCAAGATCACATCTGGG + Intergenic
1062535183 9:137018334-137018356 GGGTCTGGAAGATCACACCTGGG + Exonic
1185532106 X:830242-830264 GGACCTGCATGGTTTTACCTTGG + Intergenic
1189005122 X:36986414-36986436 GGTCCTGCCAGAGATCACCTCGG - Intergenic
1189043900 X:37571528-37571550 GGTCCTGCCAGAGATCACCTCGG + Intronic
1190853340 X:54267972-54267994 GTACATGCAAGATCTCCACTTGG - Intronic
1193197528 X:78651367-78651389 TGACTAACAAGATCTCACCTCGG - Intergenic