ID: 973232607

View in Genome Browser
Species Human (GRCh38)
Location 4:47859545-47859567
Sequence AAAAAGCAGAAATACCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 851
Summary {0: 1, 1: 0, 2: 6, 3: 87, 4: 757}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973232605_973232607 -3 Left 973232605 4:47859525-47859547 CCAAATTCATAAATAATTTTAAA 0: 1
1: 1
2: 10
3: 189
4: 1677
Right 973232607 4:47859545-47859567 AAAAAGCAGAAATACCGGCCAGG 0: 1
1: 0
2: 6
3: 87
4: 757

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973232607 Original CRISPR AAAAAGCAGAAATACCGGCC AGG Intronic
900240152 1:1612850-1612872 AAAAAGAAAAAAAACCAGCCAGG - Intergenic
901039033 1:6353175-6353197 AAAAAACTGAAATACAGGCTGGG + Intronic
901044965 1:6390638-6390660 AAAAAGCACACACACGGGCCAGG + Intronic
901112438 1:6809320-6809342 TAAAAACAGCGATACCGGCCAGG - Intronic
901479523 1:9515321-9515343 AAAAAAAAAAAATACAGGCCGGG + Intergenic
902153804 1:14466671-14466693 AAAAAGAAGAAGAAACGGCCAGG + Intergenic
902179512 1:14677380-14677402 GAAAGGCAGAAATATCTGCCTGG + Intronic
902865025 1:19272386-19272408 AAAAATCAGAAATAAGGGCCAGG + Intergenic
902867116 1:19286994-19287016 AAAAATCAGAAATAAGGGCCAGG + Intronic
903396806 1:23007791-23007813 AAAAAAAAAAAATAGCGGCCGGG + Intergenic
903636677 1:24823477-24823499 AAAAATGAGACATACAGGCCGGG + Intronic
903747863 1:25600759-25600781 AAAAAAAAAAAATACTGGCCAGG - Intergenic
903992844 1:27286296-27286318 AAAAACAAAAAAAACCGGCCAGG - Intronic
904060683 1:27707821-27707843 AAAAAATAGAAATACCTGGCCGG - Intergenic
904182092 1:28673187-28673209 AAAAAGGAGTAATACTGGCTGGG - Intronic
905063651 1:35161373-35161395 AAAAAACAGAAATAGGGGCCAGG + Intergenic
905161615 1:36040775-36040797 AAAAAGTGGAAATTCAGGCCAGG + Intronic
905560881 1:38926403-38926425 AAAAAGCAGAAACAGAGACCAGG - Exonic
905722696 1:40219949-40219971 GAAAAACAGAAGTACTGGCCAGG + Intronic
907031798 1:51179618-51179640 AAAAAACAAAAACACAGGCCGGG + Intergenic
908557179 1:65267190-65267212 AAAAATTCTAAATACCGGCCAGG - Intronic
908792096 1:67792872-67792894 GAAAAGCACCAATACTGGCCAGG - Intronic
908841634 1:68285836-68285858 AAAAAGAATAAATCTCGGCCAGG - Intergenic
911443958 1:97967552-97967574 AAAAAGCAAAAATACCAGCAGGG + Intergenic
912774171 1:112494012-112494034 AAAAAGTACATCTACCGGCCAGG + Intronic
912850242 1:113117774-113117796 AAAAGTCAGAAATGCCAGCCAGG - Intronic
913080557 1:115381358-115381380 AAAAAGTATTAAAACCGGCCAGG - Intergenic
913588631 1:120301330-120301352 AATAGGCAGAAATACCGACTGGG - Intergenic
913619554 1:120597039-120597061 AATAGGCAGAAATACCGACTGGG + Intergenic
914232787 1:145779911-145779933 AAAAATGAGAAATATTGGCCGGG - Intronic
914435158 1:147653120-147653142 AAAAACCAGTAAAACAGGCCGGG - Intronic
914570652 1:148913201-148913223 AATAGGCAGAAATACCGACTGGG - Intronic
914602179 1:149217068-149217090 AATAGGCAGAAATACCGACTGGG + Intergenic
914737951 1:150436604-150436626 AAAAAAAAGAAATACAGGGCTGG + Intronic
914737999 1:150436908-150436930 AAAAAGAAAAAATACAGGCTGGG + Intronic
915155248 1:153870273-153870295 AAAAAGGAAAAAATCCGGCCAGG + Intronic
915158720 1:153900916-153900938 AAAAATCATAAAAACTGGCCAGG + Intronic
915221201 1:154376033-154376055 AAAAAAAAGAAATATAGGCCGGG - Intergenic
915397692 1:155598111-155598133 AAAAAAAAGAAATTCTGGCCGGG - Intergenic
915611362 1:156995836-156995858 AAAAAGCACCCAAACCGGCCGGG - Intronic
916046531 1:161004104-161004126 AAAAAAAAGAAATTCCAGCCTGG - Intronic
916093260 1:161325903-161325925 AGAAAGCAGAGTTATCGGCCTGG + Intronic
916259791 1:162829904-162829926 TAAAAGAAGAAATAGGGGCCAGG - Intronic
916389729 1:164318726-164318748 AAAAAACAAAAAAACGGGCCAGG - Intergenic
916722272 1:167493336-167493358 CAAAAGGAGAAAAACTGGCCAGG - Intronic
916895992 1:169162546-169162568 AAAAAATATAAATACAGGCCAGG + Intronic
917433512 1:174996317-174996339 AAAAAATAGAAATATCAGCCAGG - Intergenic
917813181 1:178680452-178680474 AAAAAAAAGAAATACAGGCTGGG + Intergenic
917863157 1:179167719-179167741 TAAAAACAGAAATACAGGCTGGG + Intronic
918086111 1:181246805-181246827 AAAAAGCAGAAATACTAGTAAGG - Intergenic
918467693 1:184838177-184838199 CAAAAGCAGAAATACAGGCTAGG - Intronic
918484860 1:185018283-185018305 AAAAAACACCAACACCGGCCAGG + Intergenic
918732042 1:188011100-188011122 TAAAAAAAGAAATGCCGGCCGGG - Intergenic
919381718 1:196868876-196868898 AAGAAGCAGAGATAAAGGCCGGG - Intronic
919843390 1:201625621-201625643 AAGAAGCAGAAATGCAGGGCAGG + Intronic
920224409 1:204427791-204427813 AGAAAACAGAAACACCTGCCTGG - Intronic
920964566 1:210691259-210691281 CAAAGGCAGAAATGCCAGCCAGG + Intronic
922037211 1:221860801-221860823 TAAAAGTAGAAAAAGCGGCCGGG + Intergenic
922290109 1:224202845-224202867 AAAAAACACAAATATTGGCCAGG - Intergenic
922521033 1:226252675-226252697 AAAAAAAAGAAATCCAGGCCAGG + Intronic
922907142 1:229182751-229182773 AAAAAGCATAAATATGGTCCGGG + Intergenic
923412077 1:233720622-233720644 AGAAAGCAAAAATATGGGCCAGG + Intergenic
923696224 1:236254906-236254928 AAAAAAGATAAAGACCGGCCAGG - Intronic
923812159 1:237330681-237330703 AAAAACCAGAGATAGTGGCCGGG - Intronic
924046776 1:240040203-240040225 AAAAATCAGTAATACGGGCTGGG - Intronic
924534667 1:244924685-244924707 AAAAAACAGAAAAACTGGCTGGG - Intergenic
924557097 1:245127871-245127893 TACAAGCAGAAATAACAGCCTGG + Intergenic
1063284004 10:4662987-4663009 AAGAAGCAGAAATAAAAGCCAGG - Intergenic
1063579029 10:7288733-7288755 AAAAATTAGAAACAGCGGCCAGG + Intronic
1063642540 10:7844669-7844691 AAAAAGAAGAAAAGCTGGCCAGG - Intronic
1064006682 10:11704550-11704572 GAACAGCAGAAAAACCAGCCGGG + Intergenic
1064407155 10:15074241-15074263 GAAAAGCAGAAATAGGAGCCAGG + Intergenic
1064761504 10:18626242-18626264 AAAAAACAGAAAAACTGGCCAGG + Intronic
1065011523 10:21425234-21425256 AAAAAAAAGAAAAACCGGCTAGG - Intergenic
1065015876 10:21462335-21462357 AAAAAAAAAAAATACTGGCCGGG + Intergenic
1065059295 10:21881857-21881879 AAAAAAAAAAAAAACCGGCCAGG + Intronic
1065084204 10:22158212-22158234 AAAAAGCAGAAATTCTGCTCTGG + Intergenic
1065633670 10:27708871-27708893 AAAAAGCAGCAATACCGGTTGGG + Intronic
1065836960 10:29667068-29667090 AAAAAGAAGAAACACCTGCTAGG - Intronic
1065866272 10:29918096-29918118 AAAAAGCACTAAGACTGGCCAGG - Intergenic
1066028131 10:31385819-31385841 AAAAAGAAGAAACGCTGGCCAGG - Intronic
1066398556 10:35051316-35051338 AAAAAGAAAAAAAACCGGCCAGG + Intronic
1066597638 10:37068896-37068918 AAAATAAAGAAATACTGGCCGGG - Intergenic
1066675317 10:37881429-37881451 AAAAACAAGAAATACCAGCCAGG - Intergenic
1066966713 10:42273584-42273606 AAAAAGTAGAGACACAGGCCAGG + Intergenic
1066973624 10:42342643-42342665 AAAAACAGGAAATACAGGCCGGG + Intergenic
1067132854 10:43581516-43581538 AAAAAGCAGAAAGACAGGCCAGG - Intergenic
1067486830 10:46658445-46658467 AAAAAAAAGAATTACAGGCCGGG + Intergenic
1067763747 10:49069955-49069977 TAAAAAAAGAAATATCGGCCGGG + Intronic
1067857439 10:49806952-49806974 AAAATGGAGAAATACCAGTCCGG - Intergenic
1068213412 10:53952191-53952213 AAAGAGCAGTAATACCAGCAGGG - Intronic
1068422918 10:56820524-56820546 AGAAAGCAGAACTGCCTGCCAGG + Intergenic
1068929674 10:62576564-62576586 AAAAAACAAAAAAACCGGCTGGG + Intronic
1068950346 10:62770355-62770377 AATAAGAATAAATACCAGCCTGG - Intergenic
1069203016 10:65646580-65646602 AAAAAACAGTAATAGAGGCCAGG - Intergenic
1070007063 10:72435093-72435115 AAAATGAAGAAATAAAGGCCAGG + Intronic
1070081920 10:73197472-73197494 AAAAAGAAGAAATTCCAGCCAGG + Intronic
1070142340 10:73747645-73747667 AAAAAAAAAAAATACAGGCCAGG - Intronic
1070212977 10:74346185-74346207 AAAAAACAGAAATTTTGGCCAGG - Intronic
1071553188 10:86583029-86583051 AAAAAACAAAAAAACCAGCCAGG + Intergenic
1071623524 10:87144923-87144945 AAAAAAAAGAATTACAGGCCGGG - Intronic
1072078725 10:92006123-92006145 TTAAACCAGAAATACTGGCCGGG - Intronic
1072125022 10:92437957-92437979 AAAAAATAAAAATACTGGCCAGG + Intergenic
1072144784 10:92625062-92625084 TTAAAACAGAAATACCGGCAGGG - Intronic
1072633193 10:97161018-97161040 AAAAACCACACATACCAGCCAGG - Intronic
1072689968 10:97566007-97566029 AAAAATTAAAAATACAGGCCAGG - Intronic
1072883576 10:99252579-99252601 AAAAAAATGAAATACCGGCCAGG + Intergenic
1072909791 10:99489795-99489817 AAAAATGAGAAAAACAGGCCAGG + Intergenic
1073093512 10:100965773-100965795 AGAAGGCAGAAATACTGGCATGG - Intergenic
1073231136 10:101971281-101971303 ATAAAGAAAAAATACTGGCCGGG + Intronic
1073236712 10:102022873-102022895 AAAAAGAAAAAATTTCGGCCGGG - Intronic
1074057189 10:109933387-109933409 AAAATGAAGAAATTTCGGCCAGG + Intergenic
1074505673 10:114068122-114068144 AAAATGTAGAAATACAGGGCAGG - Intergenic
1074596722 10:114874797-114874819 AAAATGAAAAAATTCCGGCCGGG - Intronic
1074685116 10:115954805-115954827 AAAAAACAGAAAAACAGGCCGGG - Intergenic
1075114628 10:119615636-119615658 AAAATACATAATTACCGGCCGGG - Intergenic
1076702045 10:132278464-132278486 AAAAAATCAAAATACCGGCCGGG + Intronic
1077054175 11:582511-582533 AAAAAGGAGGACTACAGGCCAGG - Intronic
1077201960 11:1312864-1312886 AAAAAGAAGACATACAGGCTGGG + Intergenic
1078051169 11:7965892-7965914 AACAAGGAGAAAAACAGGCCAGG + Intergenic
1078867541 11:15312070-15312092 CAAAAGAAGAGATACCGGCTGGG + Intergenic
1078926108 11:15876514-15876536 AAAAGGCTGAAATACAGGCTAGG - Intergenic
1079677559 11:23249803-23249825 AAAAAACAAAACTACAGGCCAGG - Intergenic
1079920645 11:26429940-26429962 AAAAAGTAAAAGTACTGGCCAGG + Intronic
1080444863 11:32329020-32329042 AAAAAAAAGATAAACCGGCCAGG + Intergenic
1080532750 11:33192857-33192879 AAAAGGAAGAAATAACGGACGGG + Intergenic
1081365000 11:42223753-42223775 AAAAAGAAAAAATACACGCCTGG - Intergenic
1081903997 11:46654801-46654823 AAAAACCCGAAAAACAGGCCAGG + Intronic
1082084310 11:48036887-48036909 AAAAAGCAGAAATACAATTCTGG - Intronic
1082086125 11:48051388-48051410 AAAAAACAGAAAACACGGCCAGG - Intronic
1082209473 11:49480670-49480692 AAAAAACAAAAAAATCGGCCGGG - Intergenic
1084017866 11:66397178-66397200 AAAAAACAAAAAAACAGGCCAGG - Intergenic
1084042791 11:66552082-66552104 AAAAAAAAAAAATGCCGGCCAGG + Intronic
1084802517 11:71554420-71554442 AAAAAGCAGAAAAACAGGCCGGG - Intronic
1084853850 11:71967164-71967186 AAAAAACACAAATATTGGCCGGG - Intronic
1085076140 11:73594392-73594414 AAAAACCAAAAAAACTGGCCAGG - Intronic
1085089579 11:73699146-73699168 AAAAAACAGCATTATCGGCCTGG - Intronic
1085852114 11:80132835-80132857 AAAAAGAAAAAATTCTGGCCAGG - Intergenic
1087043645 11:93825939-93825961 AAAAAAAAGAAATAAAGGCCAGG + Intronic
1088491360 11:110391258-110391280 CAAATCCAGAAATACAGGCCAGG + Intergenic
1088826878 11:113503380-113503402 TAAAAATAAAAATACCGGCCAGG + Intergenic
1090138140 11:124221638-124221660 AAAAAGCACATATAGCTGCCAGG - Intergenic
1090849799 11:130562069-130562091 AAAAGCCAGAAATGCCAGCCTGG - Intergenic
1091048972 11:132350945-132350967 AAAAAGGATAAATATTGGCCAGG + Intergenic
1091428604 12:413231-413253 AAAAAACAAAAAAACAGGCCGGG - Intronic
1092199105 12:6568929-6568951 AAAAAACAAAAAAACCAGCCGGG + Intergenic
1092251179 12:6898274-6898296 AAAAAGAAAAAATACTGGCCAGG + Intronic
1092460037 12:8678309-8678331 GAAAAAAAGAAAGACCGGCCAGG - Intergenic
1092879677 12:12878445-12878467 AAAAAGCTGACATAGGGGCCAGG + Intergenic
1093449311 12:19297325-19297347 AAAAAAAAAAAATACAGGCCGGG + Intronic
1096132359 12:49169916-49169938 AATAAGAAGAAGTACTGGCCAGG + Intergenic
1096172976 12:49488360-49488382 AAAAATATGAAATACAGGCCAGG + Intronic
1096264911 12:50115059-50115081 AAAAAAAAAAAAAACCGGCCGGG - Intronic
1096320905 12:50612019-50612041 AAAAAGCAGATATCTTGGCCAGG + Intronic
1096382129 12:51167898-51167920 AAAAAGTAGAAAAACTGGCCAGG + Intronic
1096582483 12:52596182-52596204 AAAAAGCAGAAAAACTGGAAAGG + Intronic
1096682220 12:53263733-53263755 AAAAAGAAAAAAGACTGGCCAGG - Intergenic
1096998833 12:55858735-55858757 AAAAAAAAAAAATATCGGCCGGG - Intergenic
1097116932 12:56704470-56704492 AAAAAACAGACAAACAGGCCAGG - Intergenic
1097393417 12:59043499-59043521 AAAAAGCAAAAATACAGGTGTGG + Intergenic
1097643699 12:62211282-62211304 AAAAAGCAGAAAAATGGGCCAGG + Intronic
1097806410 12:63969496-63969518 AAAAATCTGAAACATCGGCCAGG + Intronic
1098125505 12:67288421-67288443 AAAAATCAGAAAGGACGGCCAGG - Intronic
1098277398 12:68826879-68826901 AAAACGTAAAAATCCCGGCCAGG + Intronic
1098355145 12:69605567-69605589 AAAAATCACAATTACTGGCCGGG + Intergenic
1098431950 12:70429369-70429391 AAAAAGTTAAAATTCCGGCCGGG + Intronic
1098478131 12:70929124-70929146 AAACTGCAGAAATACCATCCTGG - Intergenic
1098744323 12:74216920-74216942 AAAAATCAGAAATACATCCCAGG - Intergenic
1098881390 12:75920943-75920965 AAAAAGAAAAAATGCTGGCCAGG + Intergenic
1099563239 12:84205754-84205776 AAAAAGAATAAATACCCCCCGGG + Intergenic
1099715132 12:86282732-86282754 AAAAAGCTGAAAAACAGGACTGG - Intronic
1100257839 12:92902445-92902467 AAAAAGCTGTAAATCCGGCCGGG + Intronic
1100287716 12:93183258-93183280 AAAAGAAAGAAAAACCGGCCAGG - Intergenic
1100467668 12:94861638-94861660 AAAAATCAGAACTGCGGGCCGGG + Intergenic
1100484681 12:95013775-95013797 AAAAAGAAGAGAGACTGGCCAGG - Intergenic
1100531868 12:95468640-95468662 AAAAAAAAGAAAAAACGGCCAGG - Intergenic
1100676557 12:96874910-96874932 AAAAAGCAGAGATCCCGGCCGGG - Intronic
1102249580 12:111377177-111377199 AAAAAGCTGTAATATGGGCCAGG + Intergenic
1102276083 12:111582961-111582983 AAAAAACTGAGATACTGGCCGGG - Intronic
1102362538 12:112300863-112300885 AAAAAGAAGTAATACAGGCTGGG - Intronic
1102371565 12:112385991-112386013 AAAATGAAAAAATACCAGCCTGG - Intergenic
1102373081 12:112398960-112398982 AAAAAACAAAAATATAGGCCAGG + Intergenic
1102740292 12:115200938-115200960 AAAAAGCAAAAAAAAAGGCCGGG - Intergenic
1103300571 12:119923297-119923319 AAAAAATAAAAATACCAGCCAGG + Intergenic
1103329853 12:120146524-120146546 AAAAACCAGAAAAACAGACCAGG - Intronic
1103489358 12:121304995-121305017 AAAAAGCTTCAATTCCGGCCAGG + Intergenic
1103595116 12:122020665-122020687 GAAAAGAACAAATACTGGCCGGG - Exonic
1103643751 12:122374323-122374345 AAAAAAAAAAAATAGCGGCCGGG + Intronic
1103710347 12:122907888-122907910 AAAAAAAAAAAATACAGGCCGGG - Intergenic
1103818614 12:123679090-123679112 AGAAAGCTGAATTATCGGCCAGG - Intronic
1104069620 12:125333099-125333121 CAAAAGCTGGAAAACCGGCCTGG - Intronic
1105229239 13:18474360-18474382 AAAAACAGGAAATACAGGCCAGG + Intergenic
1105616253 13:22015666-22015688 AAAAATGAAAATTACCGGCCAGG - Intergenic
1105648061 13:22342783-22342805 AAAAATAAGAAATGCTGGCCAGG + Intergenic
1105724086 13:23143402-23143424 AAAAAGCAGACATTGGGGCCGGG - Intergenic
1105917725 13:24932263-24932285 AAAATGGACAAATACCAGCCTGG + Intergenic
1105967720 13:25399695-25399717 AAAAAGAAGAACCACGGGCCGGG - Intronic
1106195734 13:27492418-27492440 AAAAAACAGAAATTTAGGCCAGG - Intergenic
1106258594 13:28044151-28044173 AAAAAGCAAAAAGAAGGGCCAGG + Intronic
1106280669 13:28266028-28266050 AAAAAAAAAAAAAACCGGCCGGG - Intronic
1106458026 13:29944533-29944555 AAAAAGCACAAAAATCAGCCGGG - Intergenic
1106748657 13:32733364-32733386 AAAAAGCAAAATTAATGGCCAGG - Intronic
1106825684 13:33518096-33518118 AAAAAGCAGAAACAACTTCCAGG + Intergenic
1107263364 13:38521271-38521293 AAAAAGAAGAAACAGTGGCCAGG + Intergenic
1107289936 13:38840405-38840427 AAAAAGGAGAAATCCCGGCAAGG - Intronic
1107454731 13:40544549-40544571 AAAAAGTAAAAATATAGGCCAGG + Intergenic
1107511302 13:41088137-41088159 AAAAAGAAGAAGAACCAGCCAGG - Intergenic
1108382466 13:49867621-49867643 TAAAAATAGAATTACCGGCCAGG - Intergenic
1108693146 13:52878155-52878177 GAAAACCGAAAATACCGGCCGGG - Intergenic
1109488054 13:63054611-63054633 AAAAATCTGATATACAGGCCAGG - Intergenic
1109516986 13:63456456-63456478 AAAAAGGAGAAAGACAGGCCGGG - Intergenic
1110751487 13:79120232-79120254 AAAAAGAACAAAAAACGGCCTGG + Intergenic
1112279775 13:98052468-98052490 AAAAAGAAGAAAATACGGCCAGG - Intergenic
1113253133 13:108476332-108476354 AAAAAGAATAAATATCAGCCGGG + Intergenic
1113258312 13:108531914-108531936 CAAAAGCAGAAGGCCCGGCCTGG + Intergenic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114668129 14:24393200-24393222 AAAAAATAGAAAAATCGGCCGGG + Intergenic
1115251580 14:31354092-31354114 AAAAAAAAAAAATGCCGGCCAGG - Intronic
1115572968 14:34684106-34684128 AAAAAAAAAAAATACCAGCCGGG - Intergenic
1115595987 14:34909597-34909619 AAAAAATAGAAATACAGGCTGGG + Intergenic
1115600462 14:34950885-34950907 AAAAAAAAAAAAAACCGGCCAGG - Intergenic
1115681592 14:35745468-35745490 AAAAAGCAGAAAATCTGGCCGGG + Intronic
1115822021 14:37223191-37223213 AAAAAATAGAAAAACCAGCCAGG - Intronic
1116216530 14:42024316-42024338 AAAAAGTAGAAAAATAGGCCAGG - Intergenic
1116451468 14:45071213-45071235 AAAAAACAGAAAAAGCAGCCGGG - Intronic
1116467021 14:45245657-45245679 AAAGAGTAGAAAGGCCGGCCGGG - Intronic
1116852182 14:49919456-49919478 AAAAAACACAAATATGGGCCGGG + Intergenic
1117175484 14:53141964-53141986 AAAGAGCAAATATACCAGCCTGG + Intronic
1117318731 14:54600127-54600149 AAAAAGAAGAAAGAAAGGCCAGG - Intronic
1117590524 14:57263470-57263492 AAAAAACAAAAAAACTGGCCAGG + Intronic
1117908592 14:60614885-60614907 TAAAAATAAAAATACCGGCCGGG + Intergenic
1118277703 14:64400392-64400414 AAAAAAGAGAAATACAGGCCGGG + Intronic
1118299470 14:64602304-64602326 AAAAAGAAGAAAATACGGCCAGG - Intergenic
1118564857 14:67128415-67128437 AAAAAGTAGAAACAGCAGCCGGG - Intronic
1119269677 14:73291671-73291693 AGAAAAAAGAAATACTGGCCGGG - Intronic
1119269726 14:73291977-73291999 TAAAAACAGAAATACCGGCCAGG - Intronic
1119611018 14:76062363-76062385 AAGAAGCAGAAAAACAGGCCGGG - Intronic
1119818819 14:77596040-77596062 AAAAAACAAAAAAACTGGCCAGG + Intronic
1120825404 14:88950389-88950411 AAAAAGCACAAAAACTAGCCAGG + Intergenic
1120837090 14:89050039-89050061 GAAAAGAAGAAAGACTGGCCAGG + Intergenic
1120904202 14:89605953-89605975 AAAAAGTAAAAAAACTGGCCAGG + Intronic
1121206179 14:92169976-92169998 AAAAATCAGAAAAATTGGCCAGG + Exonic
1121399953 14:93666892-93666914 AAAAAACAGATATACCAGCCTGG + Intronic
1121595662 14:95159881-95159903 AAAAATCAGACAAACCGGCCAGG - Intergenic
1121969676 14:98344657-98344679 AGAAAAAAGAAAGACCGGCCAGG + Intergenic
1124272803 15:28298498-28298520 AAGAAGAAGAAATACTTGCCAGG + Intronic
1124480329 15:30073786-30073808 ATAAAACTGAAATGCCGGCCGGG - Intergenic
1124699823 15:31903201-31903223 AAAAAACAGAAATCCAGGCCAGG - Intergenic
1124938820 15:34199141-34199163 AGAAAACAGATTTACCGGCCAGG + Intronic
1125798086 15:42419071-42419093 AAAAAAAAAAAATACAGGCCGGG + Intronic
1126621807 15:50647448-50647470 AAAGAACAGAAAAACAGGCCGGG + Intronic
1126737024 15:51740257-51740279 AAAAAACAAAAAAACAGGCCTGG - Intronic
1126762888 15:51985661-51985683 AAAAAACAAAAAACCCGGCCAGG + Intronic
1127573482 15:60266979-60267001 AAAAAGAAGAATTCCCAGCCAGG + Intergenic
1127845152 15:62864081-62864103 CAAAAACAAAAATACCAGCCTGG + Intergenic
1128358005 15:66941963-66941985 AAAAATGGGAAATAGCGGCCTGG - Intergenic
1128538733 15:68510274-68510296 AAAAAGAAAAAAGACCAGCCTGG + Intergenic
1128664744 15:69529884-69529906 TAAAAGCAGAAAGACAGTCCTGG - Intergenic
1128810794 15:70570716-70570738 AAAAAGTTAAAATGCCGGCCGGG - Intergenic
1128950567 15:71876415-71876437 AAAAAAAAAAAATACCAGCCAGG - Intronic
1128993484 15:72279748-72279770 CAAAAGCAGAAAAGGCGGCCGGG - Intronic
1129264006 15:74384270-74384292 GAAGAGCAGAAACACTGGCCAGG - Intergenic
1129284111 15:74509979-74510001 AAAAACAAAAAATACAGGCCGGG - Intergenic
1129535048 15:76306557-76306579 AAGAAGCAAAAAAACCGGCTGGG - Intronic
1129811470 15:78514085-78514107 AAAAAACAAAAAAACAGGCCAGG - Intronic
1129863596 15:78884216-78884238 AAAAAGCTGAAATTCTTGCCAGG + Intronic
1129929230 15:79395474-79395496 AAAAACCAGAAACATTGGCCAGG - Intronic
1130167607 15:81479568-81479590 AAAAAGTGGAAAAACAGGCCAGG + Intergenic
1130338078 15:82974772-82974794 TAAAAGAAGACATACAGGCCAGG + Intronic
1130405577 15:83597901-83597923 AAAAAGCATAATTAAGGGCCAGG - Intronic
1130558610 15:84941498-84941520 AAAAAAAACAAATCCCGGCCGGG - Intronic
1131040894 15:89265815-89265837 AAAAAACAAAAAATCCGGCCAGG - Intronic
1131190612 15:90313426-90313448 AAAAAGTAGAAAAACAGGCCAGG - Intronic
1131690380 15:94820788-94820810 TATAAAAAGAAATACCGGCCAGG - Intergenic
1132160776 15:99539813-99539835 AAAAAGCAAAAATATCGGCCGGG + Intergenic
1133016860 16:2947463-2947485 AAAAAGCAAAAATCCCAGCCAGG + Intronic
1133346875 16:5077078-5077100 AAAAGGAAGAAATACAGGCCAGG - Intronic
1133422613 16:5659598-5659620 CAAAAAAAGATATACCGGCCAGG - Intergenic
1133541247 16:6756674-6756696 TAAAAGAAGATATACAGGCCGGG + Intronic
1133707750 16:8371397-8371419 AAAAAGTAGAAATACAGCCAAGG + Intergenic
1133982797 16:10645971-10645993 AAAAAAAAGAAAAACTGGCCAGG + Intronic
1134598678 16:15516126-15516148 AAAAAGCACAAATTAAGGCCAGG + Intronic
1135004967 16:18812353-18812375 AAAAACCATAAATAACAGCCAGG + Intronic
1135019003 16:18947953-18947975 AAAAAACACAAAAACAGGCCAGG - Intergenic
1135257357 16:20951728-20951750 AAAAAAAAAAAATACGGGCCAGG - Intronic
1135461259 16:22645239-22645261 AAAAAGCACAAAAATTGGCCAGG - Intergenic
1135728122 16:24872820-24872842 AAAAAGCAGAAACATAGGCTGGG - Intronic
1135962587 16:27010118-27010140 AAAAAATAGAAAAACTGGCCAGG + Intergenic
1136427137 16:30176388-30176410 AAAAAGAAGAAAGAAGGGCCGGG + Intergenic
1136456080 16:30380460-30380482 AAAAAGTACAAAAACCAGCCAGG - Intronic
1136463485 16:30426468-30426490 AAAAAAAAAAAAAACCGGCCAGG - Intronic
1136477637 16:30523540-30523562 AAAAAAAAGAAAAACAGGCCAGG + Intergenic
1136732784 16:32432955-32432977 AAAAAGTAGAGACACAGGCCAGG + Intergenic
1137238441 16:46634100-46634122 AAAAATCAGAAAAACAGGCAGGG + Intergenic
1137378849 16:47978980-47979002 AAAAAGAAAAAATTCTGGCCAGG - Intergenic
1138459680 16:57140858-57140880 AAAAAAAAAAAATCCCGGCCGGG - Intronic
1138611971 16:58132401-58132423 AAAAAGAAAAAAAACCGGCCGGG + Intergenic
1139631178 16:68232767-68232789 ATAAAGCAGAAATACGAGACGGG - Exonic
1139698766 16:68694324-68694346 AAAAAAAAAAAATTCCGGCCAGG + Intronic
1139941346 16:70608061-70608083 TAAAAAAAGAAAAACCGGCCGGG - Intronic
1140358732 16:74327397-74327419 AAAAAATAGAATTATCGGCCGGG + Intergenic
1140524946 16:75614927-75614949 AAAAATCTCAATTACCGGCCAGG + Intronic
1141457769 16:84155387-84155409 AAAAAGTAGAAAAACTTGCCAGG - Intronic
1141458815 16:84163963-84163985 AAAAAGCACAAAAACTAGCCAGG - Intronic
1141956835 16:87377860-87377882 AAAAAACAGAAATCTAGGCCAGG + Intronic
1142389206 16:89787521-89787543 AAAAAACAAAAAGACCAGCCAGG + Intronic
1203020297 16_KI270728v1_random:396648-396670 AAAAAGTAGAGACACAGGCCAGG - Intergenic
1203038632 16_KI270728v1_random:669806-669828 AAAAAGTAGAGACACAGGCCAGG - Intergenic
1142557241 17:787842-787864 AAAATACAGGAATACAGGCCAGG - Intronic
1142740093 17:1926872-1926894 AAAAATCTGAAATACGGGCGGGG + Intergenic
1142816029 17:2426433-2426455 AAAAAGTAAAAATAGCAGCCGGG + Intronic
1143489868 17:7280011-7280033 AAAAATCTGGAATGCCGGCCCGG - Intergenic
1143572146 17:7766070-7766092 GAAAAGTAGAAATGCGGGCCGGG - Intronic
1144300394 17:13918247-13918269 AAAAAGCACAAAAACCAGACTGG + Intergenic
1144514245 17:15904669-15904691 AAAAAGCAAAAGTACAGGCCGGG - Intergenic
1144931223 17:18860349-18860371 ATAAAGTATAAAAACCGGCCAGG - Intronic
1144983543 17:19185083-19185105 AAAAACCAGAAATGTAGGCCGGG + Intergenic
1144984682 17:19193156-19193178 AAAAACCAGAAATGTAGGCCGGG - Intergenic
1146077938 17:29750140-29750162 AAAACACAGAAAAACTGGCCGGG + Intronic
1146112477 17:30102529-30102551 AAAAAGAAGACATAAGGGCCGGG - Intronic
1146154491 17:30509402-30509424 AAAAGTCATAAATACCGGCCGGG - Intronic
1146293566 17:31630712-31630734 AAAAAAAAGAAATACCAGCCGGG + Intergenic
1146396293 17:32470298-32470320 AAAAAACAGAAACAAAGGCCAGG - Intronic
1146778095 17:35640210-35640232 AAAAATCAGTAAAACTGGCCAGG - Intronic
1147651058 17:42062316-42062338 GAGAAGCAGAAATCCTGGCCAGG + Intronic
1147698603 17:42376549-42376571 AAAAAAAAAAAAAACCGGCCAGG + Intronic
1147750873 17:42732471-42732493 AAAAATCAAAAACATCGGCCGGG + Intronic
1147866702 17:43557749-43557771 AAAGAACAGGAATTCCGGCCGGG - Intronic
1147873797 17:43606525-43606547 AAAACAAAGAAATCCCGGCCAGG + Intergenic
1148096750 17:45057713-45057735 AAAAAACAGTAATTCAGGCCAGG + Intronic
1148167268 17:45492004-45492026 AGAAAGAAGATATACAGGCCAGG - Intergenic
1148455022 17:47806664-47806686 AAGAAGAAGAAATACCACCCTGG + Intergenic
1148947641 17:51278583-51278605 AAAAAGGAGAAATACTGGGAAGG - Intronic
1149349264 17:55770878-55770900 AAAAAGCAAAAAAATCAGCCAGG - Intronic
1149724721 17:58881861-58881883 AAAGAAAAGAAATACAGGCCAGG + Intronic
1150042991 17:61883456-61883478 ATAAAGAAAAAATTCCGGCCAGG + Intronic
1150356568 17:64491297-64491319 AAAAAGTGAAAATACTGGCCAGG + Intronic
1150398448 17:64838418-64838440 AGAAAGAAGATATACAGGCCAGG - Intergenic
1150432385 17:65128672-65128694 AAAAAGTACAAATCCCGGCCAGG - Intergenic
1150681436 17:67287763-67287785 AAAATACAAAAATACAGGCCGGG + Intergenic
1150756699 17:67921228-67921250 AAAAAAAAGAAATACAGGCCAGG + Intronic
1150789337 17:68188719-68188741 CAAAAGGAGAAATAGCTGCCTGG - Intergenic
1151134297 17:71930926-71930948 AAAAAGTTGCAATACAGGCCGGG - Intergenic
1151331271 17:73410610-73410632 AAGAAGCAGCATTATCGGCCGGG - Intronic
1151606707 17:75142262-75142284 AGAAAGCAGTAGAACCGGCCGGG + Intronic
1151707936 17:75781251-75781273 AAAAAAAAAAATTACCGGCCAGG - Intronic
1151871134 17:76837714-76837736 AAAAAGAGGAAATTCAGGCCAGG + Intergenic
1151945398 17:77316865-77316887 AAAAAGCAGAAACCCCAGCTGGG - Intronic
1152393540 17:80017384-80017406 AAAAAACGTAAAAACCGGCCAGG + Intronic
1152680170 17:81663688-81663710 AAAAAAAAAAAAAACCGGCCAGG - Intergenic
1153234171 18:2970049-2970071 AAAACTCAGAAATTCTGGCCTGG + Intronic
1153680363 18:7494686-7494708 AAAAATCAGAAAAACAGGCCGGG - Intergenic
1154218660 18:12433722-12433744 AAAAAAAAAAAATACTGGCCGGG - Intergenic
1154524214 18:15265759-15265781 AAAAACAGGAAATACAGGCCAGG - Intergenic
1155130273 18:22927910-22927932 AAAAAGCAGGAAAACAGGGCTGG + Intronic
1155192135 18:23439355-23439377 AAAAAGCAAAAATACAGAACAGG + Intergenic
1155676162 18:28431558-28431580 AAATAGCAGAACTACCTTCCAGG + Intergenic
1157260286 18:46171129-46171151 AAAAAAAAAAAATACAGGCCGGG - Intergenic
1157372340 18:47126867-47126889 AAAAACCTGGAATACCAGCCAGG + Intronic
1157697931 18:49738491-49738513 AAAAAACAAAATTAGCGGCCAGG - Intergenic
1157816573 18:50733842-50733864 AAAGCCCAGAAATACCTGCCTGG + Intergenic
1157972481 18:52286134-52286156 AAAAAGAAGAAATACAGAGCAGG - Intergenic
1158364613 18:56719266-56719288 AAAAAACAGAATTGCTGGCCGGG + Intronic
1158471854 18:57744011-57744033 AGCAAGAAGAAATACAGGCCTGG + Intronic
1159051668 18:63426238-63426260 GAAAAGCAGAAATAAAGGCGCGG + Intergenic
1159329565 18:66973243-66973265 AAAAAACAGAACTATCAGCCTGG + Intergenic
1160839566 19:1140002-1140024 ATAAAGAAGAAATGCAGGCCGGG + Intronic
1161559686 19:4965750-4965772 AAAAAGTACAAAAATCGGCCAGG - Intergenic
1162037620 19:7950496-7950518 AAAAAACAAAAATAGAGGCCAGG + Intergenic
1162500106 19:11048393-11048415 AAAAAACAAAAATTCCGGCCAGG - Intronic
1162556854 19:11392358-11392380 AAAAAGCAAAAAAAAGGGCCAGG - Intronic
1162644558 19:12039367-12039389 AAAAAGTAGAAATGAAGGCCGGG - Intronic
1163083616 19:14962610-14962632 TAAAAATAGAACTACCGGCCGGG + Intronic
1163457724 19:17418188-17418210 CATAAGAAGAAAAACCGGCCTGG - Intronic
1163568454 19:18065828-18065850 AAAAAGAAAAAATCCCAGCCTGG + Intronic
1163630601 19:18416308-18416330 AAAAACTAAAAAAACCGGCCGGG - Intergenic
1163769990 19:19185388-19185410 AACAAAAAGAAACACCGGCCAGG + Intronic
1163925772 19:20342035-20342057 AAAAATCAACAATACCAGCCTGG + Intergenic
1164288466 19:23844052-23844074 AAAAAGAAAAAATAGAGGCCAGG - Intergenic
1164974836 19:32564639-32564661 TAAAAGCACAAATTCAGGCCAGG - Intergenic
1165035693 19:33032006-33032028 AAAAAAAAAAAAGACCGGCCCGG - Intronic
1165559398 19:36666387-36666409 AAAAAGCACATTTACAGGCCGGG - Intronic
1165720747 19:38077964-38077986 GAAAAGCAAAAATATTGGCCAGG - Intronic
1166009661 19:39933112-39933134 TAAAAACAGAAAGAACGGCCAGG - Intronic
1166284617 19:41816782-41816804 CAAAAGCATACATACTGGCCTGG - Intergenic
1166363281 19:42265205-42265227 AAAAAATAAAAATACAGGCCAGG - Intergenic
1166429389 19:42711338-42711360 CAAAAGCAAAAATAATGGCCTGG - Intronic
1167070179 19:47217177-47217199 AAAAAGAAGAAAGATCGGCCGGG - Intergenic
1167071207 19:47222973-47222995 AAAAAAAAAAAATACAGGCCGGG + Intronic
1167235169 19:48309937-48309959 AAAGATCAGATAAACCGGCCGGG + Intronic
1167927857 19:52836186-52836208 AAAAAACAAAAATACCGGAATGG - Intronic
1168012117 19:53541399-53541421 TAAAAGAAGAAATATAGGCCGGG - Intronic
1168025524 19:53640902-53640924 GAAAAAGAGAAATTCCGGCCAGG + Intergenic
1168618121 19:57854879-57854901 AAAAAAAAAAAATACAGGCCAGG + Intronic
1168674060 19:58264096-58264118 AAAAAAAAAAAATACAGGCCAGG + Intronic
925271992 2:2616667-2616689 ACAAAGCAGAAACAACTGCCTGG + Intergenic
925415758 2:3669176-3669198 AAAATACAGTAATTCCGGCCAGG + Intronic
925731548 2:6922603-6922625 AAAAACAAGAAAAACCGGGCGGG - Intronic
926623166 2:15067025-15067047 AAAAGGCAGAAATCCTGGTCAGG + Intergenic
927584742 2:24291781-24291803 ATAAAGCAGAAATATGGGCCGGG - Intronic
928026367 2:27742695-27742717 AAAAAACACAAACAACGGCCAGG - Intergenic
928792723 2:34978165-34978187 AAAATGGAGAAATAAAGGCCGGG + Intergenic
929520047 2:42641200-42641222 AAAAAAAAAAAAAACCGGCCAGG - Intronic
929721644 2:44375155-44375177 AAAAAACAGAAACCCTGGCCAGG - Intronic
930470162 2:51802091-51802113 TAAAATCAGAAATACTGGCCGGG - Intergenic
930796864 2:55402712-55402734 AAAAAAAAAAAAAACCGGCCAGG + Intronic
931148194 2:59543033-59543055 AAAAAGCATGAATACCTTCCTGG - Intergenic
931295434 2:60919718-60919740 AAAAAACAGAAAAATTGGCCAGG - Intronic
931764307 2:65441066-65441088 AAAAAGCACAAAAACAGGCCAGG - Intergenic
931958315 2:67452781-67452803 AAAAAAAAGAATAACCGGCCGGG - Intergenic
932150979 2:69371540-69371562 AAAAATAAAAAATACTGGCCGGG + Intronic
932557664 2:72839628-72839650 AAAAAACTGAAATAACGGCCGGG - Intergenic
933381697 2:81556049-81556071 AAAAAGAAGAAAAACAGTCCTGG + Intergenic
933408428 2:81893230-81893252 TAAAAACAGAAAAACAGGCCAGG + Intergenic
934027754 2:88015334-88015356 AAAAAATAAAAATACCAGCCTGG - Intergenic
934312923 2:91886310-91886332 AAAAAGTAGAGACACAGGCCAGG - Intergenic
934540798 2:95172930-95172952 AAAAACCACAAAGAACGGCCAGG - Intronic
934671876 2:96219303-96219325 AAAAAACAGGAATAGCGGCTGGG - Intergenic
935034969 2:99361505-99361527 AAAAATCAGAAAAACAAGCCAGG + Exonic
935343725 2:102083648-102083670 TAAAAGTGGAAATATCGGCCAGG + Intronic
936275537 2:111093567-111093589 TAAAAACATAAATACTGGCCAGG + Intronic
936289632 2:111211531-111211553 AAAAATATGAAATACTGGCCAGG - Intergenic
936887991 2:117335661-117335683 TAAACGAAGAAAAACCGGCCGGG - Intergenic
937224740 2:120361950-120361972 TAAGACCAGCAATACCGGCCGGG + Intergenic
938703743 2:133901671-133901693 AAAAAGAAAAAAAACCAGCCGGG + Intergenic
938727236 2:134119912-134119934 AGAAGGCAGAAATTCCGGCCGGG - Intergenic
939452721 2:142394815-142394837 AAAAAGTAGAGATACTGGCTGGG - Intergenic
940384803 2:153058134-153058156 AAAAACCAGGAATGGCGGCCAGG + Intergenic
940768804 2:157818781-157818803 AAAAACCAGTAAGATCGGCCGGG + Intronic
941574634 2:167214860-167214882 AAAAAACAGATATACCAGCCTGG - Intronic
942086104 2:172445259-172445281 ACAAAGTATAAATACCAGCCGGG - Intronic
942809201 2:179976857-179976879 TAAAAACAGAATTACCAGCCAGG + Intronic
943026284 2:182633341-182633363 GAAAAGCACAAATACCAGCCTGG - Intergenic
944037531 2:195313295-195313317 AAAAAGTAGAAAACCTGGCCGGG - Intergenic
944407543 2:199401969-199401991 AAAAGGCAGAGATACCAGCTAGG + Intronic
944657777 2:201893297-201893319 AAACTGCAGAAATACAGCCCTGG - Exonic
944698186 2:202222195-202222217 AAAAAGCATAAATACCTTCCAGG + Intronic
944709164 2:202320249-202320271 AAAAAACAAACATACAGGCCGGG - Intergenic
944772549 2:202929023-202929045 CAAAAGAAGATATACAGGCCAGG - Intronic
944993632 2:205268619-205268641 AAAAAGTAAAAATACAGGTCTGG + Intronic
945281377 2:208038510-208038532 AAAAAACAAAAAAACAGGCCAGG - Intergenic
945413656 2:209543932-209543954 AAAAAGGAAAAAAACAGGCCTGG + Intronic
945522987 2:210852558-210852580 GAAAAGCAGAAATCCTGGCCAGG + Intergenic
946113546 2:217441333-217441355 AAATATAAGAAATACAGGCCGGG - Intronic
946379584 2:219336803-219336825 TAAAAGCAAAAATTCCAGCCTGG + Intergenic
946779509 2:223178536-223178558 AAGAAGCAGAAAGACCAGACAGG + Intronic
946920865 2:224581099-224581121 AAAAAACAGAACTATTGGCCGGG + Intronic
947568020 2:231207767-231207789 TAAAAATAGAACTACCGGCCAGG - Intronic
948833250 2:240610927-240610949 AAAAAACAAAAAGACAGGCCGGG - Intronic
1169987359 20:11460445-11460467 AAACAGCAGAGACACTGGCCAGG - Intergenic
1170283849 20:14683172-14683194 AAAAAGAAGAAATAAAGGCCGGG - Intronic
1170308567 20:14967457-14967479 AACAAACAAAACTACCGGCCAGG - Intronic
1170533861 20:17321000-17321022 AAAAGGCAGAAATAACCGACAGG - Intronic
1170867849 20:20175824-20175846 AAAAAGCAGAAGCCCCAGCCAGG - Intronic
1172024482 20:31938580-31938602 AGAAATCACAAATAGCGGCCGGG + Intronic
1172247505 20:33456072-33456094 AAAAAAAAAAAAAACCGGCCGGG - Intergenic
1172247617 20:33456755-33456777 AAAAAAAAAAAAAACCGGCCGGG - Intergenic
1172264461 20:33598915-33598937 AAAAAGCTGGAAAACCAGCCTGG - Intronic
1172505319 20:35457075-35457097 AAAAAGCAAAAAAACAGGCTGGG - Intronic
1172730659 20:37084489-37084511 AAAAAGAAAAAACACCAGCCTGG + Intronic
1173436708 20:43039743-43039765 AAAAAGAAGAAAACCAGGCCGGG + Intronic
1174335843 20:49860039-49860061 AAAAAGCAGTGAAACCAGCCTGG + Intronic
1174384806 20:50180933-50180955 AAAAAACAGAATTACTGGCCGGG + Intergenic
1174600364 20:51719437-51719459 AAAAAGAAGAAACATGGGCCAGG + Intronic
1175094332 20:56529531-56529553 AAAAAATAAAAATACAGGCCTGG + Intergenic
1175264224 20:57692772-57692794 AAAAGGCAGAGATCCAGGCCAGG + Intronic
1175846682 20:62063471-62063493 CAAAAGCAGCAATGCTGGCCAGG + Intronic
1175879990 20:62252177-62252199 AAAAAAAAGACATACTGGCCAGG - Intronic
1176773230 21:13102714-13102736 AAAAACAGGAAATACAGGCCAGG + Intergenic
1176971614 21:15272344-15272366 AAAATGCACAAAAACCGGCCAGG - Intergenic
1177238070 21:18419518-18419540 AAAAAGAGGAAATGTCGGCCGGG - Intronic
1177280804 21:18980785-18980807 AAAAATGGGAAAAACCGGCCAGG + Intergenic
1177431472 21:20997161-20997183 AAGAGGCAGAATCACCGGCCCGG - Intergenic
1177558321 21:22718881-22718903 AAAAAGTGGAAATTCCCGCCGGG - Intergenic
1177605346 21:23370666-23370688 AAAAAGAATAAATATGGGCCAGG + Intergenic
1178302460 21:31464545-31464567 AAAAAATAAAAATACAGGCCGGG + Intronic
1179792833 21:43765315-43765337 AAAAAACAGAAATAAGAGCCAGG - Intergenic
1180390049 22:12221733-12221755 CAAAAGAAGAAATATTGGCCTGG - Intergenic
1180415887 22:12712736-12712758 CAAAAGAAGAAATATTGGCCTGG + Intergenic
1180539665 22:16432166-16432188 AAAAAGTAGAGACACAGGCCAGG - Intergenic
1180684764 22:17657106-17657128 AAAAAGCAGCCAAGCCGGCCTGG - Intronic
1180689972 22:17705590-17705612 AAAAAAAAGCAATATCGGCCGGG - Intronic
1180824341 22:18852418-18852440 AAAAAGCATCACTTCCGGCCGGG + Intronic
1180860417 22:19076458-19076480 TAAAAGTAGAATTACCTGCCGGG - Intronic
1181124767 22:20695572-20695594 AAAAAGCATCACTTCCGGCCGGG + Intergenic
1181188393 22:21122130-21122152 AAAAAGCATCACTTCCGGCCGGG - Intergenic
1181210805 22:21288363-21288385 AAAAAGCATCACTTCCGGCCGGG + Intergenic
1181272730 22:21669142-21669164 AAAAACAAAAAAAACCGGCCGGG - Intronic
1181501435 22:23317881-23317903 AAAAAGCATCACTTCCGGCCGGG - Exonic
1181563824 22:23721756-23721778 AAAAAAAAAAAATACAGGCCGGG + Intergenic
1181616331 22:24057229-24057251 AAAAAGCAGAAGGACTGGCCGGG - Intronic
1181706664 22:24653204-24653226 AAAAAGCATCACTTCCGGCCGGG - Intergenic
1181708056 22:24661044-24661066 AAAAAGAAAAAATAGTGGCCAGG + Intergenic
1181824029 22:25499150-25499172 AAAAATCAGATATTCTGGCCAGG + Intergenic
1182270735 22:29151712-29151734 AAAAAGTGTAAAAACCGGCCAGG + Intronic
1182290867 22:29278527-29278549 AAAATGCAAAAATACCGGGGGGG + Intronic
1182338333 22:29600277-29600299 ATAAAGAATAAATACGGGCCGGG - Intergenic
1182505768 22:30781275-30781297 AAAAAACAAAAACATCGGCCGGG - Intronic
1182614126 22:31574896-31574918 AAAATGCAGAAAAATCAGCCAGG + Intronic
1183677813 22:39309576-39309598 AAAAAGAAAAAATACCTGCTGGG - Intergenic
1183837771 22:40470651-40470673 AGAAAACAGAAAAACAGGCCAGG + Intronic
1183846390 22:40544716-40544738 CAAAAGAGGAAATACAGGCCAGG + Intronic
1184196212 22:42930641-42930663 AAAAAGCAAAAATACCTCCATGG + Intronic
1184424470 22:44401278-44401300 AAAAACCAGGAATTCCGGCTGGG - Intergenic
1184612129 22:45611239-45611261 AAAAAACAGAAAACCAGGCCCGG + Intergenic
1184939623 22:47753450-47753472 AAAAAGCAGAAAAAGTGCCCAGG + Intergenic
1203216142 22_KI270731v1_random:7067-7089 AAAAAGCATCACTTCCGGCCGGG - Intergenic
950323959 3:12087537-12087559 AAATCCCAGAAATACCAGCCTGG + Intronic
950384537 3:12647303-12647325 AAAAAAAAGAAATTCAGGCCAGG + Intronic
950650044 3:14401638-14401660 TGAAAGAAGAAATACCGGCCAGG - Intergenic
950800336 3:15546087-15546109 AAAAAGTAGAAAAACTGGCTGGG - Intergenic
950830428 3:15869671-15869693 AAAAAGGAGGAATCCTGGCCGGG + Intergenic
951048878 3:18072213-18072235 AAAAAACAGAAATTCCTACCTGG - Intronic
951589974 3:24254066-24254088 AAAAATCAGATTTACCGGCCGGG + Intronic
951632760 3:24739320-24739342 AAAAAACTCAAATACCGGCCAGG - Intergenic
951852308 3:27155206-27155228 AAAAAGTACAAATACTGGCTGGG + Intronic
952296211 3:32064257-32064279 TAAAAAAAGAAATACTGGCCAGG - Intronic
952368180 3:32693375-32693397 GAAAAACAGAAAAACTGGCCAGG - Intronic
952372447 3:32736380-32736402 AAAAAGCAGAATTTCCAGCTGGG - Intronic
954228084 3:49195938-49195960 AAAAAAAAAAAATACAGGCCAGG + Intergenic
954780867 3:53058994-53059016 AAAAAAAAAAAATACCAGCCAGG - Intronic
955468888 3:59265265-59265287 AAAATTCAGAAAAACAGGCCGGG - Intergenic
956301871 3:67781255-67781277 AAAAGGCAGCAGTACCAGCCAGG - Intergenic
956426058 3:69136615-69136637 AAAAAACAGAAAAATTGGCCTGG + Intergenic
956826902 3:73005551-73005573 AAAAAGCAGTGTTACGGGCCGGG + Intronic
957526207 3:81381181-81381203 AAAAATCAGAAAAACCACCCAGG + Intergenic
958026105 3:88050646-88050668 AAAAAATAAAAATCCCGGCCGGG - Intergenic
959067250 3:101670121-101670143 AGAAAGCAATAATAACGGCCAGG - Intronic
959734468 3:109642346-109642368 AAAAAGTAGAATTACCAGCCTGG + Intergenic
960331718 3:116367802-116367824 AAAAGGAAGAAAAACCGGCCAGG - Intronic
960551760 3:118983923-118983945 AAAAAGCAGAAAGACCTGAGAGG - Intronic
960657992 3:120027077-120027099 AAAAAGCAGCAGGAACGGCCAGG + Intronic
961199787 3:125035926-125035948 AAAGAACAGAAATAGAGGCCTGG + Intronic
961256622 3:125559964-125559986 AAAAAATAAAAAGACCGGCCAGG + Intronic
961318248 3:126055217-126055239 AAAAAGCAAAACTGCAGGCCAGG + Intronic
961584752 3:127913228-127913250 CAAAAGGAGAAATTCTGGCCAGG + Intergenic
961720290 3:128890119-128890141 AAAAAAAGGAAATACAGGCCAGG - Intronic
961771796 3:129255470-129255492 AAAAAGAAGAAAGAGAGGCCAGG - Intronic
961963616 3:130879360-130879382 AAAAAACAGAAATATCAGCCAGG - Intronic
962248076 3:133814424-133814446 AAAAAACAAAAAAACCGGCCAGG - Intronic
962796643 3:138855349-138855371 ATAAAACAGAAATGTCGGCCAGG - Intergenic
963085068 3:141428769-141428791 AAAAAATGGAAATACTGGCCGGG - Intronic
963780162 3:149479060-149479082 AAAAAACAGAACAATCGGCCAGG - Intronic
964002241 3:151788974-151788996 AAAATGTAGATATACAGGCCGGG + Intergenic
964116615 3:153142493-153142515 AAAAAACATAATTACAGGCCAGG + Intergenic
964139992 3:153386733-153386755 AAAAAGCAAAAATGTTGGCCAGG - Intergenic
964619053 3:158702331-158702353 AAAAAGCAGAAATGCAGGCTGGG - Intronic
965283662 3:166787440-166787462 AAAAAGAAGAAAAACCTGGCTGG + Intergenic
965408717 3:168302846-168302868 CAACAGCAAAAAAACCGGCCAGG + Intergenic
965641875 3:170837221-170837243 TAAAAGAAGAGAAACCGGCCGGG - Intronic
966112404 3:176418979-176419001 AAAAAGGGGAAATAGGGGCCGGG + Intergenic
966202152 3:177368520-177368542 AAGAAGTGGAAATACAGGCCAGG - Intergenic
966769958 3:183494737-183494759 AAAAAGCAAAGATACAGACCTGG + Intronic
967208816 3:187148791-187148813 AAAAATTAGAAAAACAGGCCGGG + Intronic
968019839 3:195375514-195375536 AAAAAAAAAAAATACTGGCCAGG + Intronic
968034084 3:195530817-195530839 AAAAAACAAAAATAATGGCCCGG - Intronic
968202680 3:196769002-196769024 AAAAAGGAGAACTTCCAGCCTGG - Intronic
970244997 4:14051532-14051554 AACAAGAAGAATTACAGGCCAGG + Intergenic
971328120 4:25660838-25660860 AAAAAGAAGCAATCCAGGCCGGG - Intronic
971408558 4:26345714-26345736 AAAAAGCAGAAGTAGCAGCTTGG - Intronic
972235952 4:37134715-37134737 AAAAACCAGAAAAACAGGCTGGG - Intergenic
972357787 4:38297227-38297249 AAAAAACAGAAGGACAGGCCAGG - Intergenic
972484762 4:39530658-39530680 AAAAAGCAGATAAACAGGCCAGG - Intergenic
972750263 4:41981240-41981262 AAAAATAAGAAATACAGGCAGGG + Intergenic
973054835 4:45642550-45642572 AAAAAATAGTAATACTGGCCAGG - Intergenic
973232607 4:47859545-47859567 AAAAAGCAGAAATACCGGCCAGG + Intronic
973676615 4:53269729-53269751 ATAAAGAAAAAATACAGGCCCGG + Intronic
974473634 4:62351897-62351919 AAAAAATAGAAAAACCTGCCAGG - Intergenic
974874749 4:67689634-67689656 AAAAACCAGTATTACTGGCCAGG - Intronic
975126439 4:70787554-70787576 AAAAATCTGAAATTCTGGCCGGG - Intronic
975191915 4:71474038-71474060 AAAAAATAGAAAAACCAGCCGGG + Intronic
975455711 4:74587445-74587467 AAAAAGCTTAAATATAGGCCAGG - Intergenic
975559696 4:75697636-75697658 TAAAAGAAGAAATACAGGCCAGG + Intronic
975565327 4:75748197-75748219 AAAAAAAAGAAATACCAGCTGGG - Intronic
975705328 4:77106031-77106053 AAAAAACAGACAAACTGGCCAGG - Intergenic
976054773 4:81050899-81050921 AACAAACAGAAATTCCGGACTGG + Intronic
976192282 4:82499424-82499446 AAAGAGCACAAATAGAGGCCGGG + Intronic
976816619 4:89155559-89155581 AAAAAATAAAAATACAGGCCTGG - Intergenic
976971154 4:91104257-91104279 AAAAAGCAGAACTACCGATAAGG - Intronic
977106261 4:92889245-92889267 AAGAAGCAGAAGTTCTGGCCAGG + Intronic
977733733 4:100385518-100385540 AATAAGCAGAAATACCTGCTAGG + Intergenic
977819253 4:101453317-101453339 AAAAAAAAGAAAGACCAGCCTGG - Intronic
977945124 4:102904353-102904375 AAAAAGTAGAGACACAGGCCAGG - Intronic
978154741 4:105475614-105475636 AAAAAGTACAAAAATCGGCCAGG + Intergenic
978234143 4:106437515-106437537 AAAAAGATAAAATACTGGCCGGG - Intergenic
978722653 4:111930214-111930236 AAAATGAAAAAATACAGGCCAGG + Intergenic
978743442 4:112164813-112164835 CAAAAGAAGACATACAGGCCAGG + Intronic
979270967 4:118761010-118761032 TAAAAATAGAATTACCGGCCAGG - Intronic
979586773 4:122429140-122429162 AACAAGAAGAAAAACTGGCCAGG + Intronic
979639230 4:122993144-122993166 AAAAAGCACAAAAATCAGCCAGG - Intronic
980127987 4:128791556-128791578 AAGAAGCAGGAAAACCGGCCGGG + Intergenic
980457341 4:133061937-133061959 AAAAAGCTTAAATATGGGCCGGG - Intergenic
980847211 4:138338434-138338456 AAAATTATGAAATACCGGCCGGG + Intergenic
981712458 4:147722792-147722814 AAAAATGAGAAATCCAGGCCAGG + Intergenic
981739912 4:147990853-147990875 AAAATACAGAAAAACGGGCCTGG + Intronic
983073061 4:163292523-163292545 AAAAAGCATGAATATAGGCCGGG + Intergenic
983468185 4:168122133-168122155 AAAAAGCTGAAAAACTGGCCGGG - Intronic
983471124 4:168156796-168156818 AAAAACAAGAAATAGGGGCCGGG - Intronic
983876944 4:172887857-172887879 AAAAAGTAAAAATAGAGGCCGGG - Intronic
984643875 4:182199885-182199907 AAAAAGTACAAATACTAGCCAGG - Intronic
984919292 4:184749810-184749832 AAAAAACAGAAGTACCGGCCAGG + Intergenic
984924507 4:184794814-184794836 AAAAATCAGAAAACCCAGCCAGG - Intronic
985272131 4:188203619-188203641 AAGAAGCAGAATTATGGGCCGGG - Intergenic
986689160 5:10299686-10299708 AAAAAGCAGAAAAATTAGCCAGG + Intronic
987149298 5:15022713-15022735 AAAAGACAGAAAGACAGGCCGGG + Intergenic
987556700 5:19461350-19461372 TAAAAGAAAAAATATCGGCCAGG + Intergenic
987602554 5:20090732-20090754 AAAAAAAAGAAATACTGGCTGGG + Intronic
988002624 5:25368186-25368208 AAAAAGGAAAAAAACAGGCCGGG + Intergenic
988227674 5:28433614-28433636 TAAAAGTAGAAATCCTGGCCAGG + Intergenic
990425848 5:55687990-55688012 AAAAAACTAAAATACCGGCCGGG - Intronic
990751720 5:59023498-59023520 AAAAAACAGAAAAGCCGGTCTGG + Intronic
991072127 5:62495629-62495651 AAAAAACAGAAAAATCAGCCAGG - Intronic
991380553 5:66018928-66018950 AAAAATATGACATACCGGCCAGG - Intronic
991568820 5:68033464-68033486 TAAAAGCAAAAAAACAGGCCAGG + Intergenic
991688503 5:69204583-69204605 AAAAAAAAGAAATACAAGCCAGG - Intronic
992132569 5:73707891-73707913 AAAAATCAGTAATACCAGCCAGG - Intronic
992246717 5:74832973-74832995 AACAAGCAGAAATAGAGGCTAGG + Intronic
992699458 5:79327343-79327365 AAGAGGCAGAAATACAGGCATGG - Intergenic
992778696 5:80109475-80109497 AAAATGCAGAAATGCCAGCCAGG - Intergenic
996078536 5:119227596-119227618 AAAAAACAGAAAAACTGGCCTGG - Intronic
996304695 5:122033752-122033774 AGAAAGCAGAAGCACCGGCTGGG - Intronic
996444202 5:123525696-123525718 TAAAAGTAGAAATACTGGCTGGG + Intronic
997748809 5:136325030-136325052 CAAAAGCAGAAATATCTCCCAGG - Intronic
997916387 5:137930375-137930397 TCAAAGAAGAAATACAGGCCGGG + Intronic
997928508 5:138052938-138052960 AAAAAACAGAATTTCTGGCCAGG + Intergenic
998686561 5:144533685-144533707 AAAAATCACAAATCCAGGCCAGG - Intergenic
999318191 5:150597628-150597650 AAAAACCAGAAAAACCTGGCTGG - Intergenic
999925211 5:156368384-156368406 AAAAAGCATGAGTACAGGCCAGG - Intronic
1000434952 5:161196708-161196730 AAAAAGCAGAAGTCATGGCCAGG - Intergenic
1000685240 5:164240362-164240384 AAAAAAAAAAAATACTGGCCAGG + Intergenic
1001312617 5:170622324-170622346 AAAAAGAAGGGATACAGGCCGGG + Intronic
1001628971 5:173160527-173160549 AGTAAACAGAAATACGGGCCGGG - Intronic
1001974970 5:175990882-175990904 AAAATGCAAAAATATTGGCCAGG - Intronic
1002166184 5:177348389-177348411 AAAAAACTGACATACTGGCCAGG + Intronic
1002242464 5:177852893-177852915 AAAATGCAAAAATATTGGCCAGG + Intergenic
1002490158 5:179570037-179570059 AAAAAAAAAAAATACAGGCCGGG - Intronic
1002536234 5:179877365-179877387 TAAAAATAGAAATACTGGCCAGG + Intronic
1003209385 6:4046951-4046973 AGAAAGCTGAAAGACCGGCCGGG - Intronic
1003343397 6:5243066-5243088 TAAGAGCAGAAATCCTGGCCGGG - Intronic
1003487498 6:6592237-6592259 AAAAAGCAGAAGTCCTGGCCTGG + Intronic
1003666471 6:8116220-8116242 AAAAAAAAGAAATTGCGGCCGGG + Intergenic
1004002448 6:11607602-11607624 AAAAAGCAGGAAGAACAGCCTGG - Intergenic
1004383941 6:15155926-15155948 AATAAACAGAAATATGGGCCAGG - Intergenic
1005383576 6:25262996-25263018 AAAAAGAAAAAAACCCGGCCGGG + Intergenic
1005390427 6:25327256-25327278 AAAGAACAGAAAGAACGGCCAGG + Intronic
1005403824 6:25464115-25464137 AAAAAGGAGAACAACTGGCCGGG - Intronic
1005830296 6:29665389-29665411 AAAAATCACAAATATTGGCCAGG - Intronic
1005910024 6:30301243-30301265 AGAAACCTGAAATACCGGCCAGG - Intergenic
1006125748 6:31836799-31836821 AAAACGTAAAAATACAGGCCGGG - Intronic
1006534619 6:34688242-34688264 AAAAAGCACAAAAACTGGCTGGG + Intronic
1007514266 6:42398909-42398931 GAGCAGCAGAAATACTGGCCTGG + Intronic
1007529489 6:42528973-42528995 TAAAAACAGAAATACTAGCCAGG - Intergenic
1007544390 6:42681175-42681197 AAAAAAAAGAAAGACCAGCCTGG + Intronic
1007611038 6:43149074-43149096 AAAAAAAAGAAATGCAGGCCAGG + Intronic
1008338581 6:50336703-50336725 AGAAAGAACAAATAGCGGCCGGG + Intergenic
1008608549 6:53164855-53164877 CAAAAGAAGACATACAGGCCGGG + Intergenic
1008680904 6:53871284-53871306 AAAAACAACAAATACCGGCAAGG - Intronic
1009439151 6:63655370-63655392 AAAAAACACAAAAACAGGCCGGG - Intronic
1009577920 6:65491131-65491153 CAAAAGCAGAAATGGCTGCCTGG + Intronic
1009897318 6:69769003-69769025 GAAAAGCAGAGATACAGACCTGG - Intronic
1010283391 6:74046075-74046097 AAAAAAAAAAAAAACCGGCCGGG - Intergenic
1010543947 6:77126857-77126879 AAAAAAAAAAAAAACCGGCCAGG + Intergenic
1010999337 6:82570249-82570271 AAAATGCAGATATACCAGCGGGG + Intergenic
1011445748 6:87437261-87437283 ATAAAGCAGTAATAAGGGCCTGG - Intronic
1011448858 6:87472347-87472369 AAAAATCAGATGTATCGGCCGGG - Intronic
1012037192 6:94157485-94157507 ATAAAGAAGAATTACAGGCCAGG + Intergenic
1013161417 6:107548970-107548992 TAAAAACAGATAAACCGGCCGGG + Intronic
1013254823 6:108373871-108373893 TTAAAACAGAACTACCGGCCAGG - Intronic
1014016138 6:116532395-116532417 AAATACTAGAAAAACCGGCCGGG - Intronic
1014150103 6:118044541-118044563 AAAAAACAGAAATACTGCCAGGG - Intronic
1014188409 6:118462285-118462307 AAAAACCACAAATACTGGCTAGG - Exonic
1014638882 6:123883680-123883702 AAAAAAAAAAATTACCGGCCAGG + Intronic
1014680927 6:124429341-124429363 AAAAAGAAAAAATATGGGCCAGG - Intronic
1015298968 6:131631474-131631496 AAAAAGCAGAAAAACCTACAAGG - Intronic
1015829362 6:137351232-137351254 AAAAAGGAGAAAAATGGGCCAGG + Intergenic
1016059025 6:139609298-139609320 AAAAATAAGATATACAGGCCGGG + Intergenic
1016235841 6:141865395-141865417 AAAAAGCAAAAAAATCAGCCAGG + Intergenic
1016263815 6:142207786-142207808 ACAAAGCAAAAATCCTGGCCGGG + Intronic
1016932014 6:149420930-149420952 AAAAGGAACAAATACCAGCCTGG + Intergenic
1017198242 6:151724794-151724816 AAAAAGCAGGAATACAGACCAGG - Intronic
1017566791 6:155695649-155695671 AAAAAACACAAAAACTGGCCAGG + Intergenic
1017915396 6:158827728-158827750 AAAAAAAAGAAATAACGGCCGGG + Intergenic
1018970260 6:168523381-168523403 AAAAAAAAGAATTACTGGCCGGG - Intronic
1019343545 7:519366-519388 AATATGCAGAATTACCGGCCGGG - Exonic
1019356144 7:580256-580278 AAAAAACAGAAAAACTGGCCGGG + Intronic
1019389176 7:776042-776064 AAAAAGCAGAAAACGTGGCCGGG + Intronic
1019676069 7:2313565-2313587 AAAAGACAGAAATACAGGCCAGG + Intronic
1019814015 7:3186073-3186095 AAAAAGCTTAAATTCCGGCCAGG + Intergenic
1020167241 7:5817530-5817552 AATAAGCAGTAATAGCTGCCTGG - Intergenic
1020191107 7:5998694-5998716 AAAAAAAAAAAAAACCGGCCGGG + Intronic
1020344906 7:7152236-7152258 AAAGAAAAGAAATACAGGCCAGG - Intergenic
1020949358 7:14655379-14655401 AAAAATAAGAAATACTGGCTAGG + Intronic
1021276056 7:18652939-18652961 AATAAACAGTAATACAGGCCGGG + Intronic
1021418065 7:20411448-20411470 AAAAAGGAGAATTAGCAGCCTGG - Exonic
1021436969 7:20629465-20629487 AAAAAGAAGAAATCAAGGCCGGG + Intronic
1021681483 7:23137772-23137794 AAAAAGCATAAAACCTGGCCAGG - Intronic
1021681500 7:23137879-23137901 AAAAAGCATAAAACCTGGCCAGG + Intronic
1022280840 7:28907585-28907607 AAAAAGGAAAAAAACTGGCCAGG + Intergenic
1022687924 7:32613992-32614014 AAAAAAGAGAAATATAGGCCAGG + Intergenic
1022819533 7:33945545-33945567 TAAAAGCAGTAACACTGGCCAGG - Intronic
1023893642 7:44413755-44413777 AGAAATTAGAAATACAGGCCGGG + Intronic
1023931005 7:44706614-44706636 AAAAAAAAAAAATACCAGCCGGG - Intronic
1024311106 7:47969936-47969958 AAGAACCAGAAAAACCAGCCGGG + Intronic
1024872163 7:53976559-53976581 AAAAAGCAGAAAAATTAGCCAGG - Intergenic
1025154749 7:56594549-56594571 AAAAACCAGAAATCCTGGCCAGG - Intergenic
1025617381 7:63133363-63133385 AAAAAGGAGACATAATGGCCAGG + Intergenic
1025731991 7:64115368-64115390 AAAAATCAAAAAAACAGGCCAGG - Intronic
1025929858 7:65984895-65984917 AAAAATCAGTAATTCAGGCCAGG + Intergenic
1025992652 7:66507180-66507202 AAAAAACAGAAAAAGGGGCCAGG - Intergenic
1026971563 7:74471696-74471718 AAAAAACAAAAAAAACGGCCGGG + Intronic
1027055688 7:75047969-75047991 AAAAAAAAGAACCACCGGCCAGG + Intronic
1027234361 7:76289225-76289247 AAAAGAAAGAAATACAGGCCAGG - Intergenic
1027543417 7:79497002-79497024 AAAAAGTAACAATAGCGGCCGGG + Intergenic
1028117095 7:87010970-87010992 AAAAAGAAAATATACCGACCAGG + Intronic
1028600663 7:92597096-92597118 AAAAAGAAGAGATCCCGGCTGGG - Intergenic
1030591998 7:111493405-111493427 AAAAAGAAAAAAAACAGGCCGGG + Intronic
1030958670 7:115887926-115887948 AAAAAACAGTAAAACAGGCCAGG + Intergenic
1032145223 7:129373437-129373459 AAAAAGCAAAAAAACTAGCCAGG + Intronic
1032220401 7:129990042-129990064 AAAAAAAAAAAATTCCGGCCAGG + Intergenic
1032231406 7:130077848-130077870 AGAAAGTAGAAACCCCGGCCGGG - Intronic
1032328256 7:130952124-130952146 AGAAAGCAGAAACAGGGGCCAGG + Intergenic
1032615546 7:133465838-133465860 AAAAAGGAGAAAACTCGGCCGGG + Intronic
1032858290 7:135854999-135855021 AATAAGAAGAAATATAGGCCAGG - Intergenic
1033206876 7:139430711-139430733 AGAAAGCAGATAAACAGGCCAGG + Intergenic
1033209244 7:139448289-139448311 AAAAAGGAGAAATGTTGGCCAGG - Intergenic
1033248785 7:139740849-139740871 CAAAAGTACAAATTCCGGCCAGG + Intronic
1033310312 7:140256465-140256487 AAAAAACAGAAATTGGGGCCGGG - Intergenic
1033632213 7:143170100-143170122 AAAAAAAGGAAATACTGGCCAGG + Intergenic
1033961590 7:146920116-146920138 AAAAATGTGAAATACTGGCCAGG + Intronic
1034170765 7:149061307-149061329 AAAAATAAAAAATACAGGCCAGG + Intergenic
1035187428 7:157137551-157137573 AAAAAAAAGAAATACAGTCCTGG - Intergenic
1035377369 7:158414324-158414346 AAAGAGCAGAATTAACGGGCTGG + Intronic
1035462383 7:159050039-159050061 AAAAAGAAAAAACACTGGCCAGG + Intronic
1036194996 8:6706622-6706644 AAAAAACAGAAAAACAGGGCCGG + Intergenic
1036573406 8:10002042-10002064 AGAAAGCATATATACAGGCCGGG + Intergenic
1037379192 8:18266151-18266173 AAAAAGCAGAAACTCTGGCTAGG + Intergenic
1037888498 8:22607919-22607941 AAAAACCCTAAAAACCGGCCGGG - Intronic
1037961293 8:23100290-23100312 TAAAAGGAGAAATTCTGGCCAGG + Intronic
1038087318 8:24213599-24213621 TAAAAGCAGAAAGATAGGCCGGG + Intergenic
1038297512 8:26309019-26309041 AAAAAGTAGAAATATGAGCCAGG - Intronic
1038467591 8:27779206-27779228 AAAAATCAGATTCACCGGCCAGG - Intronic
1038495806 8:28001345-28001367 AAAAATCTGAAATCCAGGCCAGG - Intergenic
1038956600 8:32474797-32474819 TAAAAACAGGAATATCGGCCGGG - Intronic
1039474395 8:37831897-37831919 AAAAAGCACAAAAATCAGCCAGG + Intronic
1039695492 8:39905835-39905857 AAAAAACAAAAAAACAGGCCAGG + Intronic
1040020306 8:42735240-42735262 AAAAAACACTAATACAGGCCGGG + Intronic
1040518940 8:48158844-48158866 AAAAATAAAAAATACAGGCCAGG - Intergenic
1041601590 8:59723453-59723475 AAAAAGAAGCAAAACCGGCTGGG - Intergenic
1041630720 8:60083654-60083676 CAAAAGCAGAAAGACAGGCAGGG + Intergenic
1041971284 8:63746101-63746123 AAAGCGCAGAAATATCTGCCTGG + Intergenic
1042168330 8:65968490-65968512 AAAAATCAGAATTAACAGCCTGG + Intergenic
1042525789 8:69763317-69763339 AAAAAAAAGAAAAACAGGCCAGG + Intronic
1042890706 8:73607432-73607454 TAAAAGCAAAAATTCAGGCCGGG + Intronic
1043014385 8:74920117-74920139 AAAAATCATAAAAACAGGCCGGG - Intergenic
1045029978 8:98125833-98125855 AAAAAGCAAAATTTCCAGCCAGG - Intronic
1045275071 8:100696838-100696860 AAAAAACAGGCATATCGGCCGGG + Intronic
1045363740 8:101456345-101456367 AAAAGATAGAAATACGGGCCAGG + Intergenic
1045864714 8:106851951-106851973 AAAAAAAAAAATTACCGGCCGGG - Intergenic
1048065925 8:130968464-130968486 AAAAAGCAGAATAACTGGCCGGG - Intronic
1048157721 8:131975709-131975731 AAAAAGGAAAAATATTGGCCGGG - Intronic
1049336611 8:142089979-142090001 AAAAAGCACAAATCCCTTCCTGG - Intergenic
1049521979 8:143096044-143096066 AAGAAGAAGAAATACCTGGCTGG - Intergenic
1049814926 8:144594397-144594419 AAAAATCAAACATACCGGCCAGG + Intronic
1049974034 9:845015-845037 AAAAAACACAACTACAGGCCGGG - Intronic
1049978973 9:886417-886439 AAAAAACAGAAAAACTAGCCGGG - Intronic
1050004049 9:1109313-1109335 AAAAAGAAAAAAAACAGGCCAGG - Intergenic
1050040410 9:1487455-1487477 AAAAAACAAAAAAACCGGCTGGG + Intergenic
1050651391 9:7780720-7780742 AAAAAGCAGAAAGAGCAGTCAGG + Intergenic
1051460709 9:17311435-17311457 AAAAAACAGAAAAACCCTCCTGG - Intronic
1051569353 9:18538132-18538154 AAGAAGCAGAAATTCCAGCAGGG + Intronic
1051586981 9:18737021-18737043 AAAAAGGTGAAGTACAGGCCAGG + Intronic
1051676249 9:19561223-19561245 AAAAAATACAAATACAGGCCAGG - Intronic
1052175143 9:25452445-25452467 AAAAACAACAAATCCCGGCCAGG + Intergenic
1052209614 9:25887508-25887530 CAAAAACAAAAATACAGGCCAGG - Intergenic
1052381146 9:27772349-27772371 AAACTGCAGAAATACCTGTCAGG + Intergenic
1052873840 9:33536999-33537021 AAAAAGCAAAATTACAGGCCAGG + Intronic
1052976401 9:34413791-34413813 AGAAAGCAGAAATCAGGGCCAGG + Intronic
1053040302 9:34864879-34864901 AAAAAGCAGAGGGACAGGCCAGG + Intergenic
1053204941 9:36178170-36178192 AAAAAGCAGAGGGACAGGCCGGG + Intergenic
1053486161 9:38458059-38458081 AAAAGGCAGTAATAACTGCCAGG - Intergenic
1053502205 9:38607350-38607372 AAAAAGCAAAATTACAGGCCAGG - Intergenic
1053595361 9:39555655-39555677 AAAAAGAGGAAAAACAGGCCAGG - Intergenic
1053852309 9:42301326-42301348 AAAAAACAAAAAAACAGGCCAGG + Intergenic
1053853324 9:42312296-42312318 AAAAAGAGGAAAAACAGGCCAGG - Intergenic
1054570891 9:66809317-66809339 AAAAAGAGGAAAAACAGGCCAGG + Intergenic
1054824816 9:69562668-69562690 TTAAAGCAGAAATACAGGCCGGG - Intronic
1054922479 9:70555861-70555883 AAAGAGCAGAAATAACTGCTTGG + Intronic
1055283766 9:74705823-74705845 CAAAAGAAGACATACAGGCCAGG + Intergenic
1055631158 9:78224806-78224828 TAAAAGAAGAAATACTGGCCAGG - Intergenic
1055720644 9:79169716-79169738 AAAAAGAAGAAAGACTGTCCTGG - Intergenic
1055730756 9:79277512-79277534 AAAAAGAAGCATTGCCGGCCAGG + Intergenic
1056551147 9:87653642-87653664 AAAAAAGAGAAATACAGTCCTGG - Intronic
1057153897 9:92822331-92822353 AAAAGGCAAAATTACAGGCCAGG + Intergenic
1057337148 9:94165304-94165326 AAAAAGCAGAGCTACAGCCCAGG + Intergenic
1057681569 9:97191654-97191676 AAAAAGCAAAATTACAGGCCAGG - Intergenic
1058024557 9:100126984-100127006 AAAAAGTTGAAATCCCAGCCTGG + Intronic
1058059320 9:100477920-100477942 AAAAAGGAGAAATGCAGGCCGGG - Intronic
1058217963 9:102258378-102258400 CAAAAGAAGACATACAGGCCGGG - Intergenic
1059078483 9:111221083-111221105 AAAATGAAGAAATATAGGCCAGG - Intergenic
1059244800 9:112840772-112840794 AAAAAAAAGAAATATCAGCCAGG - Intronic
1059309079 9:113376337-113376359 AAAAAGAAAAAAAGCCGGCCGGG - Intronic
1059629677 9:116107440-116107462 ACAAAGTAGAATTACCTGCCAGG - Intergenic
1059831819 9:118104643-118104665 AAAAATCAGAAATACTCTCCTGG + Intergenic
1060035230 9:120249791-120249813 AAAATGCAGAAATGCAGGCATGG + Intergenic
1060632797 9:125174911-125174933 AAAAAAAAGAAAAACAGGCCAGG + Intronic
1060678404 9:125538247-125538269 CACAAGCAGAAAAACCAGCCAGG + Intronic
1061018271 9:127995872-127995894 AAAAAGAAGAAAACACGGCCAGG + Intergenic
1061109688 9:128560028-128560050 AAAAATCAAAATTATCGGCCAGG - Intronic
1061342572 9:129994443-129994465 AAGAAACAGAAAGACCAGCCTGG - Intronic
1061747777 9:132752906-132752928 ACAGAGCAGAAATACCTGCTAGG - Intronic
1061891262 9:133621708-133621730 AAAAAACAGAAATCTTGGCCGGG - Intergenic
1061986666 9:134134296-134134318 AAAAATGAGAAAATCCGGCCGGG - Intergenic
1062072204 9:134562273-134562295 TAAAAGCAGCAAGACCGCCCTGG - Intergenic
1062153842 9:135035043-135035065 CAAAAGCAGGATTACCAGCCGGG + Intergenic
1062701979 9:137911712-137911734 AAATAGGATAAATATCGGCCGGG - Intronic
1185665567 X:1762735-1762757 AAAAAGAAGAAAAAGAGGCCGGG - Intergenic
1185824671 X:3238518-3238540 ACAGAGCAGAGATACCAGCCTGG - Intergenic
1186050185 X:5584241-5584263 CAAAAGCAGACAAACAGGCCAGG + Intergenic
1186997073 X:15135043-15135065 AAAAAACAAAAAAACAGGCCAGG + Intergenic
1187315605 X:18191367-18191389 AAAGAGCAGAAATATGGGCGTGG + Intronic
1187904222 X:24051177-24051199 AAAAAAAAAAAATACAGGCCAGG - Intergenic
1188083498 X:25874939-25874961 TAAAAACAGAAATACTGGGCCGG + Intergenic
1188192440 X:27188506-27188528 AAAAAAAAGAAATACCCACCAGG - Intergenic
1188490924 X:30738441-30738463 AAAAACCACAAATACCGGCTGGG - Intergenic
1189131724 X:38505806-38505828 AAAAAGAAGAAAGACCTCCCAGG + Intronic
1189348134 X:40257992-40258014 AAAAAAAAAAAATACAGGCCGGG - Intergenic
1189449728 X:41117852-41117874 AAAAAGAAGAAAAAAGGGCCGGG - Intronic
1189476013 X:41356440-41356462 AAAAAAAAGAAATACTGGCCAGG - Intronic
1189762689 X:44338893-44338915 TAAAAGCAGAAAGAGCGGCCAGG + Intronic
1189832863 X:44992516-44992538 AAAAAGCAGTATTGCTGGCCAGG - Intronic
1190068126 X:47256881-47256903 AAAAACAAAAAATACCAGCCGGG - Intergenic
1190112399 X:47601459-47601481 AAAAAGAATTAATACCGACCAGG + Intronic
1190175638 X:48146817-48146839 AAAAAGTAGAAAAATCTGCCGGG - Intergenic
1190242937 X:48671821-48671843 AAAAAAAAAAAATACAGGCCAGG - Intergenic
1190315914 X:49150868-49150890 AAAAAGAAGAAAAAGTGGCCGGG - Intergenic
1190531293 X:51380104-51380126 AAAAAACAGATAAACTGGCCAGG + Intergenic
1190929310 X:54934611-54934633 AAAGAGCACAAAGACCAGCCTGG - Intronic
1192744202 X:73922496-73922518 AAAAATCAGAAATACATGTCAGG + Intergenic
1192818347 X:74617290-74617312 TAAAAAGATAAATACCGGCCGGG + Intergenic
1192904323 X:75534076-75534098 AAAAAAAAGAAATACTGGCCAGG - Intergenic
1193674332 X:84430667-84430689 AAAAATCACAAATACTGGCGAGG - Intronic
1194305996 X:92248997-92249019 TAAAAGGAGAATTACTGGCCGGG - Intronic
1195396398 X:104415049-104415071 AAAAAGCAGCAGTAGAGGCCGGG + Intergenic
1195554004 X:106200751-106200773 AAGAAACAGAATTGCCGGCCGGG + Intronic
1195579500 X:106485178-106485200 AAACAGCAGGAATATCAGCCTGG + Intergenic
1195661378 X:107382338-107382360 AATAAAAAGAAATACAGGCCAGG - Intergenic
1196761603 X:119205716-119205738 AAGAAGCAGAAATAGAGGCAGGG + Intergenic
1197399113 X:125966799-125966821 CAAAAGAAGACATACAGGCCGGG - Intergenic
1198192605 X:134324746-134324768 ATAAAGGAGACATACAGGCCAGG - Intergenic
1198814718 X:140577411-140577433 AAACAACAAAAATACAGGCCAGG - Intergenic
1198814776 X:140577943-140577965 AAAAAGCACAGAAGCCGGCCCGG + Intergenic