ID: 973233248

View in Genome Browser
Species Human (GRCh38)
Location 4:47866687-47866709
Sequence GATTCCCAAGCACCAGCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973233248_973233253 14 Left 973233248 4:47866687-47866709 CCCTTGGCTGGTGCTTGGGAATC 0: 1
1: 0
2: 2
3: 24
4: 237
Right 973233253 4:47866724-47866746 GTTCCCACCATTCCCAGAACTGG No data
973233248_973233252 -8 Left 973233248 4:47866687-47866709 CCCTTGGCTGGTGCTTGGGAATC 0: 1
1: 0
2: 2
3: 24
4: 237
Right 973233252 4:47866702-47866724 TGGGAATCTGGATTTCAGGAAGG 0: 2
1: 2
2: 19
3: 69
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973233248 Original CRISPR GATTCCCAAGCACCAGCCAA GGG (reversed) Intronic
901580312 1:10237185-10237207 GAGTCCCAAGCACATGCAAATGG + Intronic
902332538 1:15737629-15737651 GATCCTCCAGCACCAGCCAAGGG - Intronic
903044526 1:20554764-20554786 GTGTCCTAAGCACCTGCCAAAGG - Exonic
903543728 1:24110932-24110954 CATTCCCTGGCACCAGCCACTGG + Intronic
904366263 1:30012753-30012775 GAGTGCCAAGCACCTGCCAGGGG + Intergenic
904560057 1:31390445-31390467 GATTCCCAAGCCCCAGACAAAGG - Intergenic
905150578 1:35923747-35923769 GATGCCCAAACAGCAGCCAGAGG - Exonic
905546672 1:38805225-38805247 GCTTCCCCAGCATCAGCCAAAGG + Intergenic
905776294 1:40669438-40669460 GAATCCCCAGCACCTGCAAAAGG - Intergenic
906072341 1:43026196-43026218 GAGTCTCAAGAACCAGGCAATGG - Intergenic
906383509 1:45347727-45347749 GATTCCATTGCACCAGCCATTGG - Intronic
909507203 1:76406215-76406237 GATTCCCAAGGACTTGCAAATGG + Intronic
909921097 1:81381124-81381146 GATTCCAAAGTACCAACAAAAGG - Intronic
915059754 1:153171601-153171623 GATACCCAAGCCCTAGCCAGTGG - Intergenic
915798771 1:158766227-158766249 GCCTCCCAACCAACAGCCAATGG + Exonic
917408472 1:174734374-174734396 GCTTTCAAAGCCCCAGCCAAAGG + Intronic
920177653 1:204113093-204113115 GACCCCCAAGCTCCAGCCCAGGG + Exonic
921159961 1:212465626-212465648 GGCTCCCACTCACCAGCCAAGGG + Intergenic
922890161 1:229055690-229055712 ACTCCCCTAGCACCAGCCAAAGG - Intergenic
923851403 1:237799940-237799962 GACTCCAAAGCTCCAGTCAAGGG - Intronic
1063613619 10:7583903-7583925 GACTCACAAGCACCAGCGAGAGG + Intronic
1064943446 10:20760569-20760591 GACTCCCAAGCCCAAGTCAAAGG + Intergenic
1067267486 10:44757936-44757958 CATTGACAAGCACCAGGCAAAGG - Intergenic
1067514572 10:46927040-46927062 AGTTCCCAGACACCAGCCAAGGG + Intronic
1067647688 10:48124773-48124795 AGTTCCCAGACACCAGCCAAGGG - Intergenic
1067979858 10:51073536-51073558 TATTCCCAGGCACCAGCTCAAGG + Intronic
1068070549 10:52189377-52189399 GGTTCCCAATCACCAGGCCATGG + Intronic
1069813988 10:71181885-71181907 GATGCCCAGGCTCCAGCCCAAGG + Intergenic
1071779732 10:88830379-88830401 GATTCAGAAGCACAAGCCTATGG - Intronic
1072319775 10:94237780-94237802 GATTCCCAAGTCCCAGCAGATGG - Intronic
1072594438 10:96858308-96858330 GTTTCTGAAGCACCAGCAAATGG + Intronic
1076010769 10:126986253-126986275 GATCCCAAAGCAACAGACAACGG - Intronic
1076550715 10:131276319-131276341 TATTCCCAACCAGCAGCCCAAGG + Intronic
1078440669 11:11364062-11364084 GATTCTCAACCACCCTCCAAAGG - Intronic
1078501658 11:11885437-11885459 GAATCCCCACCCCCAGCCAAGGG + Intronic
1080268399 11:30424920-30424942 GCTTCCCAAGCAGCTGCAAAGGG - Intronic
1083871035 11:65488647-65488669 GAGCCCCTAGCACCAGCCCAAGG + Intergenic
1084110754 11:67012969-67012991 GATTCCCAACCTCCTCCCAAAGG - Intronic
1084333632 11:68444784-68444806 GCTGCCCAAGCCCCAGCCTATGG - Intronic
1084673546 11:70621525-70621547 ATTTCCCAAGCACCTGCCATGGG - Intronic
1084673940 11:70623509-70623531 ATTTCCCAAGCACCTGCCATGGG - Intronic
1085068677 11:73521811-73521833 GATTCCCCAGCACTAGACAATGG + Intronic
1085737245 11:79049567-79049589 GGTTCTCAGGCACCAGCCCAAGG - Intronic
1085837524 11:79972702-79972724 GATTCCAAAGCACCTGCCTCAGG - Intergenic
1087655630 11:100919375-100919397 CATTCCCAGACACCAGCCAAGGG + Intronic
1088603929 11:111511444-111511466 GATTCCCTAAAACCAGCAAATGG - Intronic
1090627872 11:128621704-128621726 GGTTCTCAAGCTGCAGCCAAAGG - Intergenic
1090663632 11:128900457-128900479 GATTCCCCACCACAAGCCTAAGG - Exonic
1091691714 12:2601735-2601757 AAGTCCCAAGCACCATCCATGGG - Intronic
1092985519 12:13841678-13841700 GCTTCCCAAACACTAGCCCATGG + Intronic
1093957369 12:25236354-25236376 GATTCACCAGTAGCAGCCAAAGG + Intronic
1094465144 12:30745229-30745251 AATTCTCAAGCAACAGGCAAAGG - Intronic
1096636851 12:52965609-52965631 GACACCCAGGCACCACCCAATGG - Intergenic
1096994894 12:55832295-55832317 GATTCCAAAGCAGCAGCAAAGGG - Intergenic
1098183258 12:67870118-67870140 GATTCCCCTCCCCCAGCCAAGGG - Intergenic
1100095237 12:91025901-91025923 GTTTCACAAACACCAGCCTAGGG + Intergenic
1101071132 12:101076981-101077003 AGTTCCCAGACACCAGCCAAGGG - Intronic
1101432482 12:104638045-104638067 GAGGCACAAGCACCAGGCAATGG + Intronic
1102535977 12:113581874-113581896 GCTTCCCAAGCAGCTGCCAGTGG + Intergenic
1103275698 12:119710097-119710119 GATGCCCAAGCCTCAGCTAATGG - Intronic
1104004442 12:124882278-124882300 GAATCCCCAGCACCAGCACAGGG + Intronic
1104062368 12:125279324-125279346 AGCTCCCAAACACCAGCCAAAGG - Intronic
1104760210 12:131293628-131293650 GATTCCAAGACACCAGCCAAGGG - Intergenic
1104819560 12:131667018-131667040 GATTCCAAGACACCAGCCAAGGG + Intergenic
1105039174 12:132948459-132948481 GACTCCCAAGCACACGGCAAGGG + Intronic
1106171005 13:27288481-27288503 GGGTCCCAAGCAGCAGGCAATGG - Intergenic
1111170921 13:84525373-84525395 CATTCCCAAACACCAGTGAATGG - Intergenic
1111305598 13:86409492-86409514 GATTCCCTACCCCCAGCCAAGGG + Intergenic
1111912494 13:94328157-94328179 GATTCCCAAGGGCCAACCCAGGG + Intronic
1112381787 13:98897808-98897830 GTTTCCTAAGCACAAGCCATTGG - Intronic
1114184663 14:20391362-20391384 GAGTACCAAGTACCAGCCAAAGG + Intronic
1116030762 14:39568320-39568342 CATTCAAAACCACCAGCCAAGGG - Intergenic
1117019590 14:51556073-51556095 GTTTCCCATGCAACTGCCAAAGG + Intronic
1120951696 14:90047595-90047617 TGTTCCCAAGGTCCAGCCAAGGG + Intergenic
1121885442 14:97538732-97538754 GCTCCCCCAGCACCTGCCAATGG + Intergenic
1122097441 14:99381929-99381951 GCTCCCCCAGCTCCAGCCAAGGG + Intergenic
1123194278 14:106601503-106601525 GATTCCCAGGCTCCAGGGAAGGG - Intergenic
1202829273 14_GL000009v2_random:8737-8759 ATTTCCTAAACACCAGCCAAGGG + Intergenic
1123955268 15:25328310-25328332 GATCCCCAAGATCCAGCCACTGG + Intergenic
1126897360 15:53273277-53273299 GATTCCAAAGCACCAGGAGAAGG - Intergenic
1127090068 15:55457883-55457905 CATTCCCCAGCACCAGCCTGGGG + Intronic
1127597299 15:60498567-60498589 GATTCCAAAGCACCTCACAAAGG + Intronic
1128329444 15:66746049-66746071 GCTCCCCAAGCATCAGCCAGAGG + Intronic
1128901198 15:71424029-71424051 TATTCCCCAGCAGCAGCCATGGG - Intronic
1129344617 15:74908871-74908893 GGTTCCCAAGCCCCAGGCCATGG - Intergenic
1130789387 15:87136231-87136253 GGTTCTCAGACACCAGCCAAGGG - Intergenic
1134073155 16:11273040-11273062 TGTTCCCAAGCCCCAGCCAGAGG - Intronic
1136866034 16:33755271-33755293 AATTTCCAAACACCAGCGAAGGG - Intergenic
1141523220 16:84595081-84595103 GTGTCCCAAGTACCAGCCCAGGG + Intronic
1141545130 16:84761799-84761821 AATTCCCAGACACCAGCCAAGGG + Intronic
1141796973 16:86281633-86281655 AATTCCCATGCTTCAGCCAAGGG + Intergenic
1203106120 16_KI270728v1_random:1360832-1360854 AATTTCCAAACACCAGCGAAGGG + Intergenic
1203127394 16_KI270728v1_random:1601536-1601558 AATTTCCAAACACCAGCGAAGGG - Intergenic
1143340331 17:6206139-6206161 CGTTCCCAGACACCAGCCAAGGG - Intergenic
1143683721 17:8496769-8496791 AGTTCCCACACACCAGCCAAAGG - Intronic
1143772335 17:9176652-9176674 CATTCTCAATCTCCAGCCAAAGG - Intronic
1144120729 17:12150314-12150336 GAACCCCAATCCCCAGCCAAGGG + Intergenic
1144539813 17:16129952-16129974 TATTCCCTAGCACCAGGGAAAGG - Intronic
1144696159 17:17305237-17305259 GGTTTCCAAGCACAAGGCAAAGG + Intronic
1144808189 17:17981398-17981420 GATACCCAACCACCACCCCAGGG - Intronic
1146728248 17:35173018-35173040 TCTTCCCAAGCAACTGCCAAGGG - Intronic
1147214871 17:38893304-38893326 GATTCCTAGGCCCCACCCAAGGG + Intronic
1147763768 17:42818956-42818978 GACTCTCAAGCACCAGCTGAGGG + Intronic
1150204259 17:63389743-63389765 GTTTCCCAAGCACCTCTCAAAGG - Intronic
1150775871 17:68080964-68080986 TAGTCCCATGCACCACCCAAGGG + Intergenic
1152122513 17:78427387-78427409 CATTCCCACGCACCAGCCTCTGG + Intronic
1157409906 18:47454848-47454870 GATCCCCAATCACCAGCCCATGG - Intergenic
1159680278 18:71341654-71341676 GATTCCCAGCAACCATCCAAAGG - Intergenic
1160280735 18:77487834-77487856 GATACCCAACCACCACCAAAAGG - Intergenic
1160579831 18:79877400-79877422 GATACACAGGCAGCAGCCAAGGG + Intronic
1163510115 19:17729431-17729453 AATTCCCAGAGACCAGCCAAAGG + Intronic
1163648509 19:18503726-18503748 TGTTCCCAAGCACCCGCCTAGGG + Intronic
1163886261 19:19967259-19967281 GAGCCCCCAGCCCCAGCCAAGGG - Intergenic
1164230998 19:23288714-23288736 GATTCTCAAGCACCTGACTATGG + Intergenic
1165165271 19:33849571-33849593 GATTCCCTGGCAGCAGCCATAGG - Intergenic
1165952295 19:39481121-39481143 GATTCCCAGCCTCCAGCCTAGGG - Intronic
1166034049 19:40154444-40154466 GATTCCCAACCCCCAGGCTATGG - Intergenic
1166437428 19:42780179-42780201 GATGCCCAAGCCCCACCCATAGG - Intronic
1166466321 19:43034845-43034867 GATGCCCAAGCCCCACCCATAGG - Intronic
1166472475 19:43090916-43090938 GATGCCCAAGCCCCACCCATAGG - Intronic
1166486121 19:43214261-43214283 GATGCCCAAGCCCCACCCAGAGG - Intronic
1166493233 19:43277904-43277926 GATGCCCAAGCCCCACCCATAGG - Intergenic
1168290460 19:55354775-55354797 GACGCCCGAGCCCCAGCCAATGG + Exonic
1168643878 19:58047533-58047555 GCAGCCCAAGCACCACCCAAGGG - Intronic
1202643420 1_KI270706v1_random:119052-119074 ATTTCCTAAACACCAGCCAAGGG - Intergenic
928019344 2:27689790-27689812 GATTCCCAGATGCCAGCCAAGGG + Intronic
928168001 2:28984744-28984766 GACTTCCAAGCCCCAGCCAATGG + Intronic
930695588 2:54408292-54408314 GATTTCCAGGTACCAGCCAATGG - Intergenic
933142945 2:78816367-78816389 GATAGGCAACCACCAGCCAAGGG + Intergenic
933534822 2:83558279-83558301 GACTCCACACCACCAGCCAAGGG - Intergenic
934499315 2:94842556-94842578 ATTTCCTAAACACCAGCCAAGGG - Intergenic
934634547 2:95972143-95972165 AATTTCCAAACACCAGCAAAGGG - Intronic
934799087 2:97133093-97133115 AATTTCCAAACACCAGCGAAGGG + Intronic
934834352 2:97570378-97570400 AATTTCCAAACACCAGCAAATGG - Intronic
935496614 2:103789802-103789824 CATTCCAAAGTTCCAGCCAAAGG + Intergenic
935578284 2:104733714-104733736 GAGTCCCAGGCACCAGACCAGGG + Intergenic
940192008 2:151051005-151051027 GAATCTCCAGCAGCAGCCAATGG - Intergenic
940611836 2:156003153-156003175 AATGCCCAAGCTCCATCCAAGGG + Intergenic
941341967 2:164317552-164317574 TATTACCAAGTCCCAGCCAAAGG - Intergenic
942944870 2:181661141-181661163 AATACCCAAGCTTCAGCCAAAGG - Intronic
944602879 2:201321221-201321243 TATTCCCTAGCACCAGCCTGGGG + Intronic
944639881 2:201714165-201714187 AATTCCCAAGTGCCAGCCAAGGG - Intronic
944729933 2:202505637-202505659 GCTTGCCAAGCTCCAGCCAAAGG - Intronic
945029586 2:205650835-205650857 GTCCCCCAAGCACCAGCCCAGGG + Intergenic
945599148 2:211836663-211836685 ACTTCCCAAACACCAGACAAGGG + Intronic
945654874 2:212611115-212611137 TGTTCCCAGACACCAGCCAAGGG - Intergenic
945924619 2:215790536-215790558 GACTTCCAAACACCAGGCAAAGG - Intergenic
1169060323 20:2656179-2656201 GATTCCCAGGGCCCAGCAAAGGG + Intronic
1170850165 20:19997386-19997408 CATTCCCAAGCAGCAGCTCACGG - Intronic
1171040034 20:21754465-21754487 GATTCCAAAGCAGCAGCCTAGGG - Intergenic
1171890539 20:30709258-30709280 ATTTCCTAAACACCAGCCAAGGG - Intergenic
1173645802 20:44632417-44632439 GTTTCCCACGCAGCAGCCAGAGG - Intronic
1174068002 20:47879450-47879472 GATTCCCCAGCAGCTGCCAAGGG - Intergenic
1174625856 20:51913733-51913755 GACTGCCATGCACCAGCCATTGG - Intergenic
1174739422 20:52997762-52997784 GATTCCCAAGCTCCAGGCAGAGG + Intronic
1176608457 21:8853577-8853599 ATTTCCTAAACACCAGCCAAGGG + Intergenic
1178019007 21:28387824-28387846 GAATACCAAGAAACAGCCAAAGG + Intergenic
1180919541 22:19514198-19514220 GATACCCATGGCCCAGCCAAGGG - Intronic
1181491276 22:23262314-23262336 CAGCCCCCAGCACCAGCCAAGGG - Intronic
1181859446 22:25806712-25806734 AATACACAAGCACCAGCTAATGG - Intronic
1184855459 22:47144111-47144133 CATTCCCAAACACCAGGGAAAGG + Intronic
1185178320 22:49344359-49344381 GCAGCCCAAGCCCCAGCCAACGG - Intergenic
949895298 3:8763761-8763783 GATTCCGAAGAAAGAGCCAATGG - Intronic
950699614 3:14731760-14731782 AGTTCCCAGACACCAGCCAAGGG + Intronic
952163416 3:30719410-30719432 GATTCACAGGCTCCAGACAACGG + Intergenic
952473973 3:33686294-33686316 GATCCCCAAGCCCCAGGCCATGG + Intronic
952800541 3:37286825-37286847 GCTTCACAAGCAGCAGCCACAGG - Intronic
954745664 3:52786225-52786247 GAGCCCCTAGCACCAGCCAGGGG + Intronic
954831515 3:53425212-53425234 GATTCCTGAGCTGCAGCCAAAGG - Intergenic
955771058 3:62384884-62384906 GAATCAGAAGCTCCAGCCAAAGG + Intergenic
956697176 3:71928586-71928608 CATTCCCAATCTACAGCCAAGGG - Intergenic
964294413 3:155217521-155217543 GCTTCCAAAGCCCCAGACAAGGG - Intergenic
964901029 3:161658825-161658847 GGCTCCCAGACACCAGCCAAGGG + Intergenic
965823586 3:172709096-172709118 CATTCCCAAGCACCACCTGAGGG + Intronic
968736629 4:2300614-2300636 GCTTCCCAGCCACCAGCCAGGGG - Intronic
969653065 4:8478942-8478964 GAATCCCCAGCACCAGTCCAAGG - Intronic
971706851 4:30056179-30056201 GAATACCAAGCACCAGGCACTGG + Intergenic
972213371 4:36865806-36865828 GCTTCCCAAGCAACTGCCAGAGG - Intergenic
972249693 4:37287074-37287096 GAGCCCCAACCCCCAGCCAAGGG + Intronic
973233248 4:47866687-47866709 GATTCCCAAGCACCAGCCAAGGG - Intronic
974120394 4:57631256-57631278 GAGTGCCAAGGACCAGCCATGGG - Intergenic
974964475 4:68744508-68744530 GAGTCCCTACCCCCAGCCAAAGG + Intergenic
975153296 4:71044272-71044294 GAATCCCCACCCCCAGCCAAGGG + Intergenic
975828056 4:78340299-78340321 GATTTCTAAGCACCAGACAATGG - Intronic
977550916 4:98442537-98442559 GCTTCCCAAGCACCAAAAAATGG - Intronic
979252379 4:118578983-118579005 CTTTCGCAAGCCCCAGCCAAGGG + Intergenic
979891837 4:126106929-126106951 GCTCACCAAGCTCCAGCCAAAGG - Intergenic
980250987 4:130314639-130314661 GATTCCTTAGCACCAGCCAAAGG - Intergenic
983972354 4:173890348-173890370 GAGCCCCCAACACCAGCCAAGGG - Intergenic
1202770792 4_GL000008v2_random:204966-204988 ATTTCCTAAACACCAGCCAAGGG - Intergenic
985542563 5:493699-493721 GATTCCAAAACACCAGCCCCGGG + Intronic
986136805 5:4987580-4987602 GCTTCCCAAGAACTAGCCAACGG - Intergenic
987043866 5:14088114-14088136 GATTCCAAAGCCCCTGGCAATGG - Intergenic
987829123 5:23073581-23073603 GCTTCCCAGATACCAGCCAAGGG - Intergenic
988289736 5:29270253-29270275 GATTCCCCTCCCCCAGCCAAGGG + Intergenic
988619850 5:32811884-32811906 TATTCCTCAGGACCAGCCAATGG + Intergenic
990385226 5:55253835-55253857 AGTTCCCAGGCTCCAGCCAAGGG - Intergenic
990563959 5:57010417-57010439 AGTTCCCAAACTCCAGCCAAGGG + Intergenic
995995752 5:118296618-118296640 GATTTCTAAGCAACAGACAAAGG + Intergenic
997734005 5:136200258-136200280 GCTGCCCAGGCAGCAGCCAAGGG - Intergenic
1000011738 5:157239589-157239611 AGTTCCCAAACACCAGCCAAGGG + Intronic
1001385885 5:171338368-171338390 CATTTCCAAGCAGCAGCCATGGG + Intergenic
1001745670 5:174090556-174090578 GCTTCCCAGACACCAGCCAAGGG + Intronic
1003502374 6:6713068-6713090 GATGCCTAAGCACCAGACAGAGG - Intergenic
1004478931 6:16000573-16000595 GATTGACAAGCTCCAGCCACAGG + Intergenic
1004817571 6:19329159-19329181 GGTTCCCAAGCCACAGCCAATGG - Intergenic
1007438669 6:41838457-41838479 TATTCCCCAGAACCAGCCCAGGG + Intronic
1007730273 6:43941288-43941310 GATGGCCTGGCACCAGCCAAGGG + Intergenic
1011608952 6:89131738-89131760 GCTTCCCAAGGACCAGCCTGAGG - Intergenic
1012093770 6:94932388-94932410 GAATCCCCACCCCCAGCCAAGGG - Intergenic
1012425400 6:99108586-99108608 GATCCCCAAGCAACAGGCCATGG - Intergenic
1017792797 6:157816097-157816119 GAGTGCCAAGCACCAGGCCAGGG + Intronic
1021090005 7:16472371-16472393 GATTCCTAGGCTCCAGCCCAAGG - Intronic
1022027489 7:26462333-26462355 GCTTTCTAACCACCAGCCAAGGG + Intergenic
1023404902 7:39822978-39823000 AGGTCCCAAACACCAGCCAAGGG + Intergenic
1026679616 7:72455753-72455775 GATTCCCAGGCTCCAAGCAAGGG + Intergenic
1027376778 7:77558638-77558660 AGTTCCCAGACACCAGCCAAGGG - Intronic
1029852944 7:103483693-103483715 CATCGCCCAGCACCAGCCAAAGG - Exonic
1029999783 7:105047359-105047381 AATTCCCAAATGCCAGCCAAGGG + Intronic
1030231679 7:107214401-107214423 CTTTCCCAAGCAACAGCTAATGG + Intronic
1031254178 7:119427666-119427688 GAACCCCAAACCCCAGCCAAGGG + Intergenic
1032270009 7:130396226-130396248 GGTTCACAAGCCCCAGACAAGGG + Exonic
1033226636 7:139568088-139568110 CATTCCCAAGGTCCAACCAAGGG + Exonic
1033401176 7:141026716-141026738 CATTGCCTAGCACCAGCCCAGGG - Intergenic
1034341334 7:150358246-150358268 GCTTGCCAAGCAGCAGCCAAGGG + Intergenic
1034345614 7:150383707-150383729 GCTCCCCAAACCCCAGCCAAAGG - Intronic
1035091965 7:156320136-156320158 GATTCTCCAGCTGCAGCCAAGGG - Intergenic
1036552875 8:9830590-9830612 GATTAGGAAGCTCCAGCCAATGG + Intergenic
1038555251 8:28507710-28507732 GATTCCCAAGCATCCATCAAAGG + Intronic
1041009457 8:53527410-53527432 GGTTCCCAAGCACCTTTCAAGGG + Intergenic
1042285152 8:67101349-67101371 TATTCCCAGGTGCCAGCCAAGGG + Intronic
1044555194 8:93555693-93555715 AATTCCCCATCACCAGCTAAAGG + Intergenic
1046089823 8:109488230-109488252 GGTTCCCAAGCATCCTCCAAAGG + Intronic
1047005152 8:120612486-120612508 GATTTCCAAGCCCTAGCCACTGG + Intronic
1049556155 8:143283278-143283300 GATTCCCAGGCCCCACCCCAAGG + Intergenic
1051384770 9:16495710-16495732 GATTTCTAAGCCCCAGCCACTGG - Intronic
1052176874 9:25472948-25472970 GAATCCCCACCCCCAGCCAAGGG - Intergenic
1053437713 9:38087904-38087926 GATTCTTGAGCACCAGTCAAAGG - Intergenic
1053468904 9:38331407-38331429 AGTTCCCAGACACCAGCCAAGGG + Intergenic
1053657844 9:40237981-40238003 ATTTCCTAAACACCAGCCAAGGG + Intronic
1054369967 9:64384253-64384275 ATTTCCTAAACACCAGCCAAGGG + Intronic
1054455907 9:65430310-65430332 CATTCCCCAGCAGCAGCCAGAGG + Intergenic
1054526752 9:66138244-66138266 ATTTCCTAAACACCAGCCAAGGG - Intronic
1054677596 9:67874007-67874029 ATTTCCTAAACACCAGCCAAGGG + Intronic
1056461041 9:86810205-86810227 CATTCCAAAGCAGCAGACAAAGG - Intergenic
1060232395 9:121835315-121835337 GAGACCCAAGCACCTGCCCAAGG + Intronic
1060671945 9:125477639-125477661 AATTACAATGCACCAGCCAAAGG - Intronic
1061326213 9:129866272-129866294 GCTTCTCAAGCAGGAGCCAAAGG - Intronic
1062385931 9:136311536-136311558 CCTTCCCAAGCACCAGCAGAGGG - Intergenic
1203703858 Un_KI270742v1:18787-18809 ATTTCCTAAACACCAGCCAAGGG + Intergenic
1203560162 Un_KI270744v1:47035-47057 ATTTCCTAAACACCAGCCAAGGG - Intergenic
1186555946 X:10558491-10558513 GTTTCTAAAGCACCTGCCAAAGG - Intronic
1189466504 X:41281611-41281633 AGTTCCCAGACACCAGCCAAGGG + Intergenic
1190025782 X:46921577-46921599 ATTTCCCAAACACCAGCTAAGGG - Intronic
1190098145 X:47499299-47499321 AGTTCCCAGACACCAGCCAAGGG - Intergenic
1191029861 X:55958081-55958103 TATTCCCAAGACCCAGTCAAAGG - Intergenic
1191097690 X:56691010-56691032 GTTTCCCCAGCACCAGCATAGGG - Intergenic
1192930568 X:75801548-75801570 TATTCCCCAGCAACAGCCGAGGG + Intergenic
1194675536 X:96789440-96789462 GGTTCCCAGATACCAGCCAAGGG + Intronic
1195488337 X:105436689-105436711 GGATGCCAAGCAACAGCCAAAGG + Intronic
1196483945 X:116182098-116182120 GCTTCCCAAGCCCCAACAAATGG - Intergenic
1198640815 X:138754599-138754621 AGTTCCCAGACACCAGCCAAGGG - Intronic
1201712547 Y:17008570-17008592 TGTTCCCAGTCACCAGCCAAGGG - Intergenic
1202585951 Y:26427321-26427343 AATTTCCAAACACCAGCAAAGGG + Intergenic